Jing Zhang1, Zang Liu1, Yipeng Dong1. 1. Department of Neurosurgery, Beijing Friendship Hospital, Capital Medical University, No. 95 Yong'an Road, Xicheng District, Beijing 100050, China.
Abstract
Objective: Meningiomas are one of the most common primary tumors of the central nervous system. Most of them are benign and can be cured by surgery, while a few meningiomas are malignant. Ferroptosis gene characteristics might be associated with drug therapy and survival in patients with clinically aggressive, unresectable meningiomas. This study explored the mechanism of differentially expressed miRNAs and ferroptosis in meningioma to provide a new reference to treat meningioma. Methods: Bioinformatics analysis of differential miRNA profiles and functions in patients with meningioma was performed. The contents of lactate dehydrogenase (LDH), malondialdehyde (MDA), and Fe2+ were determined. Reactive oxygen species (ROS) values, as well as cell cycle changes, were analyzed by flow cytometry. The targets of miR-127-5p and JAM3 were detected by dual luciferase assays. Cell counting kit-8 (CCK8) and Transwell assays were used to analyze cell activity. Ki67 expression was analyzed by immunohistochemistry. Expression levels of miR-127-5p and JAM3 were analyzed by RT-qPCR. GPX4 expression was quantified by western blotting. Results: miR-127-5p was expressed at low levels in IOMM-Lee cells, while JAM3 was highly expressed in IOMM-Lee cells. A dual luciferase assay demonstrated that miR-127-5p could target JAM3. Upregulation of miR-127-5p in IOMM-Lee cells resulted in cell cycle arrest and inhibition of cell activity. Upregulation of miR-127-5p increased LDH, MDA, and ROS levels and Fe2+ content and inhibited the expression of GPX4 protein. Upregulation of JAM3 reversed the results of miR-127-5p upregulation. Conclusion: miR-127-5p regulated meningioma formation and ferroptosis through JAM3, providing insights for the development of new treatments for meningioma.
Objective: Meningiomas are one of the most common primary tumors of the central nervous system. Most of them are benign and can be cured by surgery, while a few meningiomas are malignant. Ferroptosis gene characteristics might be associated with drug therapy and survival in patients with clinically aggressive, unresectable meningiomas. This study explored the mechanism of differentially expressed miRNAs and ferroptosis in meningioma to provide a new reference to treat meningioma. Methods: Bioinformatics analysis of differential miRNA profiles and functions in patients with meningioma was performed. The contents of lactate dehydrogenase (LDH), malondialdehyde (MDA), and Fe2+ were determined. Reactive oxygen species (ROS) values, as well as cell cycle changes, were analyzed by flow cytometry. The targets of miR-127-5p and JAM3 were detected by dual luciferase assays. Cell counting kit-8 (CCK8) and Transwell assays were used to analyze cell activity. Ki67 expression was analyzed by immunohistochemistry. Expression levels of miR-127-5p and JAM3 were analyzed by RT-qPCR. GPX4 expression was quantified by western blotting. Results: miR-127-5p was expressed at low levels in IOMM-Lee cells, while JAM3 was highly expressed in IOMM-Lee cells. A dual luciferase assay demonstrated that miR-127-5p could target JAM3. Upregulation of miR-127-5p in IOMM-Lee cells resulted in cell cycle arrest and inhibition of cell activity. Upregulation of miR-127-5p increased LDH, MDA, and ROS levels and Fe2+ content and inhibited the expression of GPX4 protein. Upregulation of JAM3 reversed the results of miR-127-5p upregulation. Conclusion: miR-127-5p regulated meningioma formation and ferroptosis through JAM3, providing insights for the development of new treatments for meningioma.
Meningioma originates from the meninges around the brain and spinal cord and is one of the most common primary intracranial tumors in adults, accounting for approximately one-third of major brain tumors in adults [1]. The World Health Organization currently classifies meningiomas into three grades, of which approximately 80% are benign WHOI grade tumors that are usually curable by surgical resection, with an estimated 10-year overall survival rate of 80-90% [2]. However, grade II and III meningiomas result in poor prognosis [3]. To date, many chemotherapeutic drugs and hormone therapies have been used to treat meningiomas, but with only modest benefits, such as gold standard drug treatment with the chemotherapeutic drug temozolomide, which only slightly improved survival [4, 5]. Therefore, exploring the pathogenesis of meningioma may contribute to the development of new targeted therapies.In patients with clinically aggressive, unresectable meningiomas, several molecular biomarkers of angiogenesis as well as gene mutations (SMO, AKT1, KLF4, etc.) have been shown to play a key role in the pathophysiology of these tumors [6]. The loss of merlin, the protein product of NF2, leads to uncontrolled tumor growth, which is related to the activation of the downstream mitotic pathway mTOR and hedgehog cascade [7]. MicroRNA (miRNA) is a posttranscriptional mediator that can play a major role in the regulation of genes in meningioma-related diseases [8]. For example, the lncRNA MEG3 was shown to regulate the AKAP12-modified cell cycle and proliferation in malignant meningioma cells by sponging miR-29C [9]. The lncRNA SNHG1/miR-556-5p/TCF12 feedback loop was shown to promote meningioma through the WNT signaling pathway [10]. Also, LINC00460 promoted MMP-9 expression by targeting miR-539, acting as oncogenic RNA in meningioma malignancies and accelerating the proliferation and metastasis of meningioma [11]. Therefore, exploring the mechanism of miRNA in meningioma disease may contribute to the development of new gene therapies.Ferroptosis is a recently discovered form of cell death that is distinct from apoptosis, necrosis, and necrotizing apoptosis and is characterized by lipid peroxidation and the accumulation of reactive oxygen species [12, 13]. Recent studies have shown that MEF2C silencing downregulates NF2 and E-cadherin and enhances ferroptosis in meningiomas, suggesting that NF2 loss or low E-cadherin expression predisposes meningiomas to ferroptosis [14]. In addition, experimental studies have shown that temozolomide's efficacy against neuroblastoma, meningioma, and glioma can be improved by inducing ferroptosis [5]. However, there are few reports on the specific mechanism of ferroptosis in meningioma and the development of drugs to induce ferroptosis; thus, further exploration is needed. Therefore, in this study, we attempted to explore the miRNAs associated with ferroptosis in IOMM-Lee cells and to further study the mechanism of action of the miRNA-ferroptosis pathway in meningioma to provide new strategies for the treatment of meningioma.
2. Materials and Methods
2.1. Cell Experiments and Grouping
Human meningeal cells (HMCs, HUM-iCell-n002, iCell) were purchased from iCell. Malignant meningioma cells (IOMM-Lee, CTCC-400-0154) were purchased from Zhejiang Meisen Cell Biotechnology Co., Ltd. IOMM-Lee cells were randomly divided into the mimic-NC, miR-127-5p mimic, miR-127-5p mimic+oe-NC, and miR-127-5p mimic+oe-JAM3 groups. To construct these groups, hsa-miRNA NC, hsa-miR-127-5p (GenePharma), oe-NC, and oe-JAM3 plasmids (Honorgene, Changsha, China) were transfected with Lip2000 (11668019, Invitrogen) [15].
2.2. Biochemical Tests
Lactate dehydrogenase (LDH, A020-2-1, Njjcbio), malondialdehyde (MDA, A003-1-2, Njjcbio), and Fe2+ content (ab83366, Abcam) detection kits were used to determine the levels of LDH, MDA, and Fe2+ in cell supernatant or tissue homogenate, respectively.
2.3. ROS Levels [16]
ROS levels were detected using an ROS kit (S0033S, Beyotime Biotechnology). In short, the cells from the above groups were added appropriate volumes of diluted DCFH-DA during the treatment. The cells were maintained in a 37°C cell culture chamber for 20 minutes. Next, ROS levels were measured using flow cytometry (Beckman).
2.4. Cell Cycle
The cells were added to 400 μL PBS and suspended gently to separate them into single cells. The cells were added drop by drop with 1.2 mL of precooled 100% ethanol to reach a concentration of 75% and incubated overnight at 4°C for fixation. The fixed sample was removed and centrifuged. The cells were added to 1 mL precooled PBS and resuspended and centrifuged for collection. The cells were added to 150 μL propidium iodide (MB2920, Meilunbio) working solution and dyed at 4°C for 30 min without light. The cells were transferred to a flow detection tube and detected by a computer. A total of 10,000 cells were collected by FSC/SSC scatter plot.
2.5. Animal Experiments and Grouping
Thirty nude mice were classified into 4 groups: mimic-NC, miR-127-5p mimic, miR-127-5p mimic+oe-NC, and miR-127-5p mimic+oe-JAM3. Meningioma model mice [17] were constructed as follows: after abdominal skin disinfection, 1% pentobarbital sodium (135 pL) was intraperitoneally injected into the nude mice. The head of the nude mice was fixed with a stereotaxometer, and two ear needles were symmetrically fixed in the bony parts slightly in front of each ear of the nude mice. The skin of the head of nude mice was cut approximately 0.6 cm lengthwise at 5 mm after the intersection of the inner canthal line and sagittal midline. The skin and fascia on both sides of the incision were bluntly separated with forceps to fully expose the skull. The location of the drill hole was determined according to the stereotactic anatomical map of the head: 0.5 mm behind the intersection of the coronal and sagittal suture and 2.5 mm to the right of the midline. The electric drill drilled a hole of approximately 1 mm at this position. The cells of the third generation of the logarithmic growth stage were taken. The cell suspension was absorbed with a 10 μL microsyringe, and the needle was slowly injected vertically to a depth of approximately 1.5 mm. The cell suspension (5 × 105 cells/100 μL) was slowly injected, and the needle remained for 2 min after injection before being slowly withdrawn. After surgery, ear nails were tagged in nude mice. All nude mice were sacrificed 6 w after inoculation, and the whole brain tissue was removed for subsequent detection.
2.6. CCK8
The cells were digested and inoculated into 48-well plates. Each group was set up with 5 compound holes for culture adhesion. The cells were removed from the drug-containing medium, and 100 μL CCK8 medium (1 : 10, NU679, Dojindo) was added. After further incubation at 37°C with 5% CO2, the absorbance value at 450 nm was analyzed by a Bio-Tek microplate analyzer (MB-530, Huisong).
2.7. Bioinformatics Analysis
The datasets GSE126563 and GSE53934 were used in this study. R language (limma package) was used to analyze the differences in miRNA (|logFC| > log2 (1.5) and P < 0.05) and mRNA (|logFC| > 1 and P < 0.05). A heatmap showing the changes in the abundance and quantity of miRNA expression profiles was generated. And Venn diagram showing the changes in the abundance and quantity of mRNA expression profiles was generated. Kyoto Encyclopedia of Genes and Genomes (KEGG, https://www.kegg.jp/) and Gene Ontology (GO) platforms were used to predict the functions of differentially expressed miRNAs and mRNAs, respectively.
2.8. Dual Luciferase Assay
293A cells were purchased from HonorGene. A Dual Luciferase Assay Kit (E1910) was purchased from Promega. pHG-miRTarget-JAM3 WT-3U and pHG-miRTarget-JAM3 MUT-3U were transfected into the plasmid. The cells were cultured and transfected with Lip2000 transfection reagent (11668019, Invitrogen) to transfect all plasmids, hsa-miRNA NC, and hsa-miR-127-5p (GenePharma). The specific groups were as follows: miRNA NC+JAM3 WT group (cells cotransfected with phG-miRtarget-JAM3 WT-3U large plasmid and miRNA NC), hsa-miR-127-5p+JAM3 WT group (cells cotransfected with phG-miRtarget-JAM3 WT-3U large plasmid and hsa-miR-127-5P mimics), miRNA NC+JAM3 MUT group (cells cotransfected with pHG-miRTarget-YAP1 MUT-3U large plasmid and miRNA NC), and hsa-miR-127-5p+JAM3 MUT group (cells cotransfected with pHG-miRTarget-YAP1 MUT-3U large plasmid and hsa-miR-127-5p mimics). The cells were lysed with 1 × PLB lysate. Then, 20 μL of cell lysate was combined with 100 μL LARII solution and 100 μL Stop&Glo solution to detect firefly and sea kidney luciferase activity.
2.9. Immunohistochemical Assay
The nude mouse brain tissue was sectioned coronally and sequentially into 5 μm slices, which were dewaxed in water. The sections were placed inside citrate buffer for thermal antigen repair. Then, 1% periodate acid was added to the sections to inactivate endogenous enzymes. Sections were washed with PBS. Sections were incubated with anti-Ki67 (ab16667, 1 : 500, Abcam, UK) overnight at 4°C. Then, anti-HRP polymer was added to the sections, and they were incubated. Next, DAB working solution was added to the sections, and they were incubated. Sections were restained with hematoxylin and turned blue with PBS. Sections were dehydrated with alcohol (60~100%) and placed in xylene. The sections were sealed and observed.
2.10. Transwell Assay
The treated cells were digested with trypsin into single cells, and the cells were suspended at 2 × 106 cells/mL. The cells were incubated at 37°C for 48 hours. Then, the upper chamber was removed and placed into a new well with PBS and washed with PBS, and the cells were removed with a cotton ball. The cells were fixed with paraformaldehyde. Then, the membrane was removed. The cells were stained with 0.1% crystal violet and washed with water 5 times. The upper outdoor surface cells were observed under 3 fields for each plate. The chamber was removed and soaked with 500 μL 10% acetic acid to decolorize it.
2.11. RT-qPCR
Total RNA was extracted from cells or tumor tissues using TRIzol reagent (15596026, Thermo). cDNA was synthesized using an mRNA reverse transcription kit (CW2569, CWBIO) and miRNA reverse transcription kit (CW2141, CWBIO). The expression levels of target genes were analyzed by UltraSYBR Mixture (CW2601, CWBIO) and the 2− method. Primer sequences are shown in Table 1.
Table 1
Primer sequences.
Gene
Primer sequences
Length (bp)
H-miR-127
F:GATCACTGTCTCCAGCCTGC
91
R:GATGAGACTTCCGACCAGCC
H-U6
F:CTCGCTTCGGCAGCACA
94
R:AACGCTTCACGAATTTGCGT
H-JAM3
F:CGGCTGCCTGACTTCTTCC
84
R:TGGGGTTCGATTGCTGGATTT
H-actin
F:ACCCTGAAGTACCCCATCGAG
224
R:AGCACAGCCTGGATAGCAAC
2.12. Western Blot
RIPA lysis buffer was used to lyse cells or tumor tissues and extract total protein. The concentration of extracted protein was determined by the BCA method. The protein samples were separated and transferred to a PVDF membrane. Then, the PVDF membrane was incubated with anti-GPX4 (67763-1-Ig, 1 : 500, Proteintech, USA) and anti-β-actin (66009-1-Ig, 1 : 500, Proteintech, USA) antibodies at 4°C overnight and finally with secondary anti-IgG (SA00001-1, 1 : 5000, Proteintech, USA). Visualization was performed using chemiluminescence.
2.13. Data Statistics and Analysis
GraphPad Prism 8.0 statistical software was used for data analysis. First, normality and homogeneity of variance tests were carried out. The test conformed to a normal distribution, and the variance was homogeneous. One-way ANOVA or ANOVA of repeated measurement data was used for multigroup comparisons. Tukey's posttest was carried out. P < 0.05 indicates that the difference is statistically significant.
3. Results
3.1. Bioinformatics Predicted and Analyzed Differential miRNAs in Meningioma
The heatmap showed differentially expressed miRNAs in the meningiomas (Figure 1(a)). KEGG enrichment showed significant enrichment of oocyte meiosis, glioma, and ErbB signaling pathways (Figure 1(b)). GO functional enrichment showed that microspike assembly, cell junction organization, and rhythmic processes were significantly enriched in biological process (BP); the COPI-coated vesicle membrane, macropinocytic cup, and anchored component of membrane were significantly enriched in cell component (CC); and protein heterodimerization activity, G protein-coupled receptor binding, and signal sequence binding were significantly enriched in molecular function (MF) (Figure 1(b)). Compared with HMCs, miR-127-5p expression was reduced in IOMM-Lee cells (Figure 1(c)). The above results proved that miR-127-5p was expressed at low levels in meningioma and was involved in regulating the function of genes related to meningioma disease.
Figure 1
Bioinformatics predicted and analyzed differential miRNAs with low expression in patients with meningioma. (a) Heatmap showing the differential expression of miRNAs in meningiomas. (b) KEGG and GO enrichment analyses of gene function. (c) The expression of miR-127-5p was detected by qRT-PCR. ∗P < 0.05 vs. HMC. BP: biological process; CC: cell component; MF: molecular function.
3.2. Elevated Expression of miR-127-5p Affected the Cycle of IOMM-Lee Cells
In contrast to the NC group, elevated expression of miR-127-5p significantly inhibited IOMM-Lee cell activity after culture 48 h (Figure 2(a)). Elevated expression of miR-127-5p prolonged the IOMM-Lee cell S phase and resulted in cell cycle arrest (Figure 2(b)). Increased expression of miR-127-5p inhibited IOMM-Lee cell migration and invasion (Figures 2(c) and 2(d)). These results demonstrated that increased expression of miR-127-5p inhibited the activity of IOMM-Lee cells.
Figure 2
Increased expression of miR-127-5p affected the activity of IOMM-Lee cells. (a) Cell proliferation. (b) Cell cycle. (c and d Transwell assay (100×). ∗P < 0.05 vs. mimic-NC.
3.3. Elevated Expression of miR-127-5p Promoted Ferroptosis in IOMM-Lee Cells
In contrast to the NC group, LDH and MDA levels were increased in the miR-127-5p mimic group (Figures 3(a) and 3(b)). Increased expression of miR-127-5p increased the ROS level and Fe2+ content in IOMM-Lee cells (Figures 3(c) and 3(d)). In addition, increased expression of miR-127-5p suppressed GPX4 protein expression in IOMM-Lee cells (Figure 3(e)). These data suggested that increased expression of miR-127-5p promoted ferroptosis in IOMM-Lee cells.
Figure 3
Elevated expression of miR-127-5p promoted ferroptosis in IOMM-Lee cells. (a and b) LDH and MDA levels were detected by biochemical methods. (c) ROS levels were detected. (d) The Fe2+ content was detected. (e) The expression of GPX4 was quantified by western blotting. ∗P < 0.05 vs. mimic-NC.
3.4. miR-127-5p Targeted JAM3
Venn diagram showed the number of miRNAs targeting JAM3 (Figure 4(a)). Compared with the NC group, JAM3 was dramatically elevated in the miR-127-5p mimic group (Figure 4(b)). Dual luciferase assay confirmed that miR-127-5p could target JAM3 (Figure 4(c)). In contrast to the miR-127-5p mimic group, upregulation of JAM3 promoted cell proliferation, migration, and invasion and inhibited cell cycle arrest (Figures 4(d)–4(g)). Upregulation of JAM3 also promoted the expression of GPX4 protein in IOMM-Lee cells with miR-127-5p upregulation (Figure 4(h)). The above results proved that miR-127-5p regulated JAM3 and participated in the pathogenic characteristics of IOMM-Lee cells.
Figure 4
miR-127-5p targeted JAM3 expression. (a) Venn diagram showing the JAM3-targeted miRNAs. (b) JAM3 expression. (c) Dual luciferase assay. (d) CCK8. (e) Flow cytometry. (f and g) Transwell assay (100×). (h) The expression of GPX4 was detected by western blot. ∗P < 0.05 vs. mimic-NC. #P < 0.05 vs. miR-127-5p mimic.
3.5. miR-127-5p Regulated JAM3 Expression In Vivo
Compared with the NC group, the miR-127-5p overexpression group had decreased tumor volume and weight (Figures 5(a) and 5(b)). After overexpression of miR-127-5p and JAM3, the tumor volume and weight were increased (Figures 5(a) and 5(b)). Exogenous miR-127-5p resulted in decreased expression of proliferative antigen and increased LDH and MDA levels in tumor tissues (Figures 5(c)–5(f)), and oe-JAM3 treatment reversed this effect (Figures 5(c)–5(f)). In addition, exogenous miR-127-5p resulted in increased ROS and iron levels and decreased GPX4 protein expression (Figures 5(g)–5(i)). After overexpression of miR-127-5p and JAM3, ROS and iron levels were decreased, and GPX4 protein expression was increased in tumor tissues (Figures 5(g)–5(i)). Our study proved that miR-127-5p inhibited the development of meningioma by regulating JAM3.
Figure 5
miR-127-5p inhibited meningioma formation by regulating JAM3. (a and b) Tumor volume and weight were analyzed. (c and d) The positive rate of Ki67 was quantified by immunohistochemistry (100× and 400×). (e and f) LDH and MDA levels were detected. (g) ROS levels were detected by flow cytometry. (h) The iron content of the tissue was detected. (i) The expression of GPX4 was quantified by western blot. ∗P < 0.05 vs. mimic-NC. #P < 0.05 vs. miR-127-5p mimic.
4. Discussion
Meningioma is the most common primary intracranial tumor [18]. Epigenetic abnormalities in meningiomas include abnormal microRNA expression, DNA methylation changes, and histone and chromatin modifications [19]. miR-127-5p is a miRNA that has been shown to mediate the polarization of M1 macrophages, inhibiting the migration of cancer cells and polarizing macrophages into the M1 phenotype [20]. miR-127-5p was downregulated in breast cancers [21], cervical cancers [22], gastric cancers [23], and many other tumor types [24]. miR-127-5p mediated the phenotype of cutaneous squamous cell carcinoma cells by binding to the ADCY7 gene [25]. Our study found that miR-127-5p was underexpressed in IOMM-Lee cells, and the increased expression of miR-127-5p resulted in meningioma cell cycle arrest and suppression of the proliferation, migration, and invasion of cells. The above studies confirmed that miR-127-5p was involved in the developmental process of meningioma, but the specific mechanism still needs to be studied.JAM3, an adhesion and migration regulatory element, is considered a novel tumor suppressor gene for epigenetic reduction in colorectal cancers [26]. JAM3 is related to the proliferation of cancer cells [27]. Knockdown of JAM3 inhibited the migration of renal cancer cells and promoted the apoptosis of renal cancer cells [28]. The upregulation of JAM3 was related to the heterogeneity of systemic metastasis of primary colorectal cancer [29]. JAM3 could be used as a candidate gene to assist in the diagnosis of cervical intraepithelial neoplasia in clinical practice [30]. Methylation of JAM3 can be used for the diagnosis, screening, and prognosis prediction of cervical intraepithelial neoplasia and severe lesions [31, 32]. Our study demonstrated that JAM3 was highly expressed in IOMM-Lee cells. These studies suggested that JAM3 is a potential therapeutic target for meningioma and that it might be used for the development of gene therapy for meningioma.Brain tumors show altered redox homeostasis, which triggers the activation of various survival pathways leading to disease progression [33]. Ferroptosis is an iron-dependent oxidative cell death pathway that may be a common and dynamic form of cell death in cancer therapy [34]. GPx4 directly reduces phospholipid hydroperoxide and regulates ferroptosis by inhibiting phospholipid peroxidation in ferroptosis induced by erastin and RSL3 [35]. Our study found that increased expression of miR-127-5p suppressed GPX4 protein expression in IOMM-Lee cells. Upregulation of JAM3 also promoted GPX4 protein expression in IOMM-Lee cells with miR-127-5p upregulation. These studies have proven that miR-127-5p regulates ferroptosis of IOMM-Lee cells through JAM3.Upregulation of miR-127-5p inhibited the proliferation of hepatocellular carcinoma cells by regulating the expression of TRIM25 and IGF2BP3 genes [36]. Elevated expression of miR-127-5p promoted premature ovarian failure by targeting HMGB2 to downregulate granulosa cell activity and weaken DNA damage repair ability [37]. CircKIF4A promoted the progression of ovarian cancers through sponging miR-127 and upregulating JAM3 [38]. The discovery of new molecular targets may be a new strategy for the development of ferroptosis-inducing therapies for meningioma, such as MEF2C [14]. Our studies demonstrated that miR-127-5p could target JAM3 to regulate ferroptosis in IOMM-Lee cells. These studies have proved that the miR-127-5p/JAM3 axis was involved in the regulation of meningioma formation, and gene therapy targeting miR-127-5p or JAM3 might be helpful in the treatment of meningioma.
Authors: Lin Huan; Chunyang Bao; Di Chen; Yan Li; Junwei Lian; Jie Ding; Shenglin Huang; Linhui Liang; Xianghuo He Journal: Cancer Sci Date: 2016-02-09 Impact factor: 6.716