Nucleoli are membrane-less structures located within the nucleus and are known to be involved in many cellular functions, including stress response and cell cycle regulation. Besides, many viruses can employ the nucleolus or nucleolar proteins to promote different steps of their life cycle such as replication, transcription and assembly. While adeno-associated virus type 2 (AAV2) capsids have previously been reported to enter the host cell nucleus and accumulate in the nucleolus, both the role of the nucleolus in AAV2 infection, and the viral uncoating mechanism remain elusive. In all prior studies on AAV uncoating, viral capsids and viral genomes were not directly correlated on the single cell level, at least not in absence of a helper virus. To elucidate the properties of the nucleolus during AAV2 infection and to assess viral uncoating on a single cell level, we combined immunofluorescence analysis for detection of intact AAV2 capsids and capsid proteins with fluorescence in situ hybridization for detection of AAV2 genomes. The results of our experiments provide evidence that uncoating of AAV2 particles occurs in a stepwise process that is completed in the nucleolus and supported by alteration of the nucleolar structure.
Nucleoli are membrane-less structures located within the nucleus and are known to be involved in many cellular functions, including stress response and cell cycle regulation. Besides, many viruses can employ the nucleolus or nucleolar proteins to promote different steps of their life cycle such as replication, transcription and assembly. While adeno-associated virus type 2 (AAV2) capsids have previously been reported to enter the host cell nucleus and accumulate in the nucleolus, both the role of the nucleolus in AAV2 infection, and the viral uncoating mechanism remain elusive. In all prior studies on AAV uncoating, viral capsids and viral genomes were not directly correlated on the single cell level, at least not in absence of a helper virus. To elucidate the properties of the nucleolus during AAV2 infection and to assess viral uncoating on a single cell level, we combined immunofluorescence analysis for detection of intact AAV2 capsids and capsid proteins with fluorescence in situ hybridization for detection of AAV2 genomes. The results of our experiments provide evidence that uncoating of AAV2 particles occurs in a stepwise process that is completed in the nucleolus and supported by alteration of the nucleolar structure.
Adeno-associated virus type 2 (AAV2) is a small, non-pathogenic, helper virus-dependent parvovirus with a single-stranded (ss) DNA genome of approximately 4.7 kb. In absence of a helper virus, AAV2 can integrate its genome site-preferentially into the adeno-associated virus integration site 1 (AAVS1) on human chromosome 19 or persist in an episomal form in the nucleus [1,2]. Co-infection with a helper virus, such as herpes simplex virus type 1 (HSV-1), leads to a lytic replication cycle including the production of progeny virus particles [3]. The AAV2 genome consists of two large open reading frames (ORFs) flanked by 145 nt long inverted terminal repeats (ITRs) located on either side. The rep gene encodes the four non-structural Rep proteins, two of which are transcribed from the p5 and the p19 promoter, respectively. An alternative splice site regulates expression of the alternative transcripts, whereby the unspliced RNAs encode Rep78 and Rep52, whereas Rep68 and Rep40 are encoded by their corresponding spliced variant [4,5]. The promoter activity is regulated by the Rep binding site (RBS), therefore allowing the Rep protein to act either as a trans-activator or repressor [6]. In the absence of a helper virus, only little expression of Rep takes place, which nonetheless is sufficient to repress any further transcription.The three structural proteins VP1, VP2 and VP3, constituting the icosahedral capsid, are encoded by the cap gene. Furthermore, the cap gene encodes the assembly-activating protein (AAP) and the membrane-associated accessory protein (MAAP) by means of nested alternative ORFs [7,8].Adeno-associated viruses exhibit a broad cellular tropism [9]. Referring to AAV2, the cellular receptors facilitating cell attachment and entry, include heparan sulfate proteoglycan, human fibroblast growth factor receptor 1, αVβ5 integrin, α5β1 integrin (reviewed in [10]) and the host factor KIAA0319L (synonymous AAVR) [11]. Different entry pathways were proposed for AAV2, including clathrin- and dynamin-dependent endocytosis or internalization supported by the Ras-related C3 botulinum toxin substrate 1 (Rac1), a small GTPase and a major effector of macropinocytosis (reviewed in [10]). However, internalization through clathrin-independent carriers (CLICs) and GPI-enriched endocytic compartments (GEECs) was also reported as major endocytic infection route [12]. It was shown that acidification in endocytic compartments and the activity of proteases trigger conformational changes of the AAV2 capsid, leading to the exposure of the N-terminal domain of the VP1 protein, known as VP1 unique region (VP1u). VP1u containing a phospholipase A2 domain (PLA2) as well as a nuclear localization signal enables the endosomal escape of AAV2 and nuclear entry, respectively [13]. After nuclear entry, AAV2 capsids were shown to accumulate in nucleoli [14], possibly mediated by nucleoli-associated proteins [15,16]. Nucleoli are membrane-less structures located within the nucleus and are organized in three distinct compartments. The fibrillary center is surrounded by the dense fibrillary compartment and further embedded in the granular compartment. The structural (re-)organization of the nucleolus is strongly linked to its function in transcription and pre-rRNA processing. Besides, the nucleolus is known to be involved in many other cellular functions, including stress response, cell cycle regulation and apoptosis (reviewed in [17-20]). Additionally, many different viruses such as HSV-1, human immunodeficiency virus type 1 (HIV-1) or adenovirus (AdV) can harness the nucleolus or specific nucleolar proteins in order to promote different steps of their life cycle including replication, transcription and virus assembly [21,22]. While AAV2 capsids have previously been reported to enter the host cell nucleus and accumulate in the nucleolus, probably in a nucleolin- and nucleophosmin-dependent manner [15,16], both the role of the nucleolus in AAV2 infection, and the viral uncoating mechanism remain elusive. The current paradigm proposes a model where AAV2 capsids accumulate in the nucleolus upon nuclear entry and then translocate to the nucleoplasm for uncoating [14]. This model is based on the observation that treating cells with either proteasome inhibitors or hydroxyurea, both known to enhance AAV2 transduction, improve nucleolar accumulation and mobilization of virions into the nucleoplasm, respectively. Besides, the post-transcriptional silencing of nucleophosmin, a highly expressed multifunctional nucleolar phosphoprotein, enhanced nucleolar accumulation and increased transduction similar to the treatment with proteasome inhibitors, while silencing of nucleolin, an abundant non-ribosomal protein of the nucleolus [23], mobilized capsids to the nucleoplasm and enhanced transduction similar to the treatment with hydroxyurea. Other studies concluded that uncoating occurs before or during nuclear entry [24-26]. These conclusions were mainly based on the fact that only AAV2 genomes were detected in the nucleus and that perinuclear genomes did not always co-localize with AAV2 capsids. In all these prior studies on AAV uncoating, however, viral capsids and viral genomes were not directly correlated on the single cell level, at least not in absence of a helper virus [27], but rather quantified by quantitative (q)PCR, Western or slot blot analysis, single AAV capsid specific immunostainings or fluorescently labelled AAV virions [14,24-30].To elucidate the sink-like properties of the nucleolus during AAV2 infection and to assess viral uncoating on a single cell level, we combined immunofluorescence (IF) analysis to detect intact AAV2 capsids as well as capsid proteins with fluorescence in situ hybridization (FISH) to visualize AAV2 genomes. The results of our experiments support the hypothesis that AAV2 uncoating takes place in the nucleolus in a cell cycle-dependent manner.
Results
AAV2 capsids and AAV2 genomes accumulate in the nucleoli of infected cells
Previous studies have shown that nucleoli act as a sink for incoming AAV2 capsids. However, it is unknown whether the nucleolar localization is merely a result of the interaction of the AAV2 capsids with specific nucleolar proteins or a pre-requisite for an early step of the viral replication cycle such as uncoating or second strand-synthesis. While prior reports suggested that AAV2 capsids translocate from the nucleoli to the nucleoplasm for uncoating, these studies have not simultaneously tracked capsids and genomes on the single cell level [14,31].Here, we investigated the spatial and temporal distribution of both AAV2 capsids and AAV2 genomes in single cells. For this, normal human fibroblast (NHF) cells were either mock-infected or infected with wild-type (wt) AAV2 at a multiplicity of infection (MOI) of 20’000 genome containing particles (gcp) per cell (herein referred to as MOI). The cells were fixed at different time points post infection and processed for combined multicolor immunofluorescence (IF) analysis to detect AAV2 particles using an antibody that detects a conformational capsid epitope and fluorescence in situ hybridization (FISH) to detect AAV2 genomes (hereinafter referred to as IF-FISH). The results showed both AAV2 capsids and AAV2 DNA accumulated in the nucleoli of wtAAV2 infected cells over time (Fig 1A and 1B). The nucleolar accumulation of AAV2 capsids and AAV2 DNA was observed also at a ten-fold lower MOI both in NHF cells and lung epithelial (A549) cells (S1 Fig) and with recombinant AAV2 vectors (S2 Fig). Of note, transduction efficiency (% GFP positive cells) correlated with the uncoating efficiency (% rAAV DNA-positive and rAAV capsid-negative cells).
Fig 1
Spatial distribution of AAV2 capsids and DNA over time.
NHF cells were infected with wtAAV2 (MOI 20`000). At various time points post infection, the cells were fixed and processed for multicolor IF analysis combined with FISH and CLSM. Nucleoli (Nuc) were visualized using an antibody against fibrillarin (yellow). Intact capsids were stained using an antibody that detects a conformational capsid epitope (green). AAV2 DNA (magenta) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. (A) Spatial and temporal distribution of AAV2 capsids and DNA. The white line represents the edge of the nucleoli (fibrillarin staining), the blue line represents the edge of the nucleus (4‘,6-diamidino-2-phenylindole (DAPI) staining). (B) Orthogonal projections of a z-stack at 24 hpi. The white line represents the edge of the nucleus (DAPI staining). (C) Image-based quantification of the uncoating rate of 50 individual cells per time point in the nucleolus and (D) in the cytoplasm. p-values were calculated using an unpaired Student`s t-test (*—p ≤ 0.05, **—p ≤ 0.01, ***—p ≤ 0.001, ****—p ≤ 0.0001).
Spatial distribution of AAV2 capsids and DNA over time.
NHF cells were infected with wtAAV2 (MOI 20`000). At various time points post infection, the cells were fixed and processed for multicolor IF analysis combined with FISH and CLSM. Nucleoli (Nuc) were visualized using an antibody against fibrillarin (yellow). Intact capsids were stained using an antibody that detects a conformational capsid epitope (green). AAV2 DNA (magenta) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. (A) Spatial and temporal distribution of AAV2 capsids and DNA. The white line represents the edge of the nucleoli (fibrillarin staining), the blue line represents the edge of the nucleus (4‘,6-diamidino-2-phenylindole (DAPI) staining). (B) Orthogonal projections of a z-stack at 24 hpi. The white line represents the edge of the nucleus (DAPI staining). (C) Image-based quantification of the uncoating rate of 50 individual cells per time point in the nucleolus and (D) in the cytoplasm. p-values were calculated using an unpaired Student`s t-test (*—p ≤ 0.05, **—p ≤ 0.01, ***—p ≤ 0.001, ****—p ≤ 0.0001).Neither AAV2 capsids nor genomes were detected in the nucleoli upon infection of cells with mutant AAV2 76HD/AN (S3 Fig) which contains two mutated residues in the catalytic center of the phospholipase A2 (PLA2) domain and is therefore deficient for endosomal escape [32].Interestingly, we did not only observe capsid-positive, genome-negative (AAV2 capsid+DNA-) signals in the cytoplasm (cytosol and the endocytic organelles contained therein), as it would be expected when capsids are intact and therefore do not allow binding of the FISH probe to the virus genome, but frequently also capsid-positive, genome-positive signals (AAV2 capsid+DNA+; see insets in Fig 1A, 0 h, 3 h, 10 h and Fig 1C and 1D), which largely vanished after DNase I treatment (S4 Fig). This indicates that either the virus stocks contained improperly encapsidated AAV2 DNA or that the AAV2 genome is accessible to the FISH probe within the cytoplasm (herein referred to as genome accessibility). While the main focus of this study was on simultaneously tracking AAV2 capsids and AAV2 genomes in the nucleus, it was important to first investigate the origin of the AAV2 capsid-positive and AAV2 genome-positive signals in the cytoplasm (Fig 1A insets and Fig 1D).
Co-detection of AAV2 capsids and AAV2 genomes in the cytoplasm is supported by AAV2 genome accessibility and requires acidification
To address the question whether wtAAV2 stocks contained improperly encapsidated AAV2 genomes, wtAAV2 particles were directly applied to fibronectin coated coverslips and processed for IF-FISH (Fig 2A). While in the untreated wtAAV2 samples all capsid-positive signals (green) were genome-negative, only genome-positive signals (red) but no capsids were observed upon incubation for 5 min at 75°C, which is known to destabilize AAV2 capsids [33]. In the heat-treated samples, the AAV2 capsids were indeed disintegrated as confirmed by electron microscopy (Fig 2B), and the AAV2 genome signals disappeared upon DNase I treatment (Fig 2A). These experiments demonstrate that the virus stocks were not contaminated with improperly encapsidated AAV2 DNA. To address the hypothesis that co-detection of AAV2 capsids and AAV2 genomes in the cytoplasm is enabled by genome accessibility, we determined the ratios of AAV2 capsid+DNA+/AAV2 capsid+DNA- signals at different timepoints after infection using CellProfiler. As shown in Fig 1C and 1D, these ratios significantly increased with time of infection, both in the cytoplasm and the nucleoli, indicating that AAV2 capsid+DNA- signals decrease over time.
Fig 2
AAV2 particles on fibronectin coated coverslips.
(A) wtAAV2 particles were directly applied to fibronectin coated coverslips and processed for IF analysis combined with FISH and CLSM, exactly as described for Fig 1. Intact capsids were stained using an antibody that detects a conformational capsid epitope (green). AAV2 DNA (red) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. (B) Electron photomicrographs show complete disintegration of the AAV2 capsids at 75°C.
AAV2 particles on fibronectin coated coverslips.
(A) wtAAV2 particles were directly applied to fibronectin coated coverslips and processed for IF analysis combined with FISH and CLSM, exactly as described for Fig 1. Intact capsids were stained using an antibody that detects a conformational capsid epitope (green). AAV2 DNA (red) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. (B) Electron photomicrographs show complete disintegration of the AAV2 capsids at 75°C.As acidification has been shown to lead to conformational changes in the AAV2 capsid and to be important for AAV2 infection, endosomal escape, and nuclear entry in particular [25], we examined whether acidification leads to co-detection of AAV2 capsid- and AAV2 genome signals in the cytoplasm, likely within endocytic vesicles of this compartment [34]. To this end, NHF cells were treated with bafilomycine A1 (50 or 200 nM) 1 h prior to infection with wtAAV2 (MOI 20`000). At 3 hours post infection (hpi), the samples were processed for IF-FISH and CLSM. Treating cells with bafilomycine A1, a vacuolar H+-ATPase inhibitor which blocks endosomal acidification, significantly reduced the AAV2 capsid+DNA+/AAV2 capsid+DNA- signal ratios in the cytoplasm (Fig 3A and 3B; see also insets in Fig 3A) and, as demonstrated previously [25], also the import of AAV2 capsids into the nucleus (Fig 3C). Collectively, these experiments confirm the specificity of the IF-FISH assay and support the hypothesis that the co-localization of AAV2 capsids and AAV2 DNA in the cytoplasm is due to genome accessibility and is enhanced by acidification.
Fig 3
Acidification enhances genome accessibility of AAV2.
NHF cells were treated with bafilomycine A1 (50 or 200 nM) or DMSO 1 h prior to infection with wtAAV2 (MOI 20`000). At 3 hpi, the cells were fixed and processed for multicolor IF analysis combined with FISH and CLSM. Nucleoli (Nuc) were visualized using an antibody against fibrillarin (yellow). Intact capsids were stained using an antibody that detects a conformational capsid epitope (green). AAV2 DNA (magenta) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. (A) Genome accessibility of AAV2 capsids after inhibition of the acidification of the endosome-lysosome system. The white line represents the edge of the nucleoli (fibrillarin staining), the blue line represents the edge of the nucleus (DAPI staining). (B) Image-based quantification of the genome accessibility (ratio of AAV2 capsid+DNA+/AAV2 capsid+DNA- signal) of 50 individual cells per sample in the cytoplasm and (C) nuclear AAV2 capsid counts. p-values were calculated using an unpaired Student`s t-test (*—p ≤ 0.05, **—p ≤ 0.01, ***—p ≤ 0.001, ****—p ≤ 0.0001).
Acidification enhances genome accessibility of AAV2.
NHF cells were treated with bafilomycine A1 (50 or 200 nM) or DMSO 1 h prior to infection with wtAAV2 (MOI 20`000). At 3 hpi, the cells were fixed and processed for multicolor IF analysis combined with FISH and CLSM. Nucleoli (Nuc) were visualized using an antibody against fibrillarin (yellow). Intact capsids were stained using an antibody that detects a conformational capsid epitope (green). AAV2 DNA (magenta) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. (A) Genome accessibility of AAV2 capsids after inhibition of the acidification of the endosome-lysosome system. The white line represents the edge of the nucleoli (fibrillarin staining), the blue line represents the edge of the nucleus (DAPI staining). (B) Image-based quantification of the genome accessibility (ratio of AAV2 capsid+DNA+/AAV2 capsid+DNA- signal) of 50 individual cells per sample in the cytoplasm and (C) nuclear AAV2 capsid counts. p-values were calculated using an unpaired Student`s t-test (*—p ≤ 0.05, **—p ≤ 0.01, ***—p ≤ 0.001, ****—p ≤ 0.0001).
Complete AAV2 uncoating takes place in the nucleoli
After establishing that the co-detection of AAV2 capsids and AAV2 genomes by combined IF-FISH and CLSM is part of the infection biology and not caused by improperly encapsidated virus particles, we continued to analyze the distribution of AAV2 capsids and genomes in the nuclei of individual cells. For this, NHF cells were mock-infected or infected with wtAAV2 (MOI 20`000) and 24 h later processed for combined IF-FISH and CLSM to detect AAV2 capsids and genomes. Interestingly, we observed three distinct patterns of nucleolar AAV2 genome and AAV2 capsid staining: (I) nucleoli with robust AAV2 genome and AAV2 capsid signal, (II) nucleoli with robust AAV2 DNA signal but weak AAV2 capsid signal, and (III) nucleoli in which only the viral DNA was detected in absence of capsids (Fig 4; see also S1 Movie). The pattern, in particular the observation of AAV2 DNA in the nucleoli in absence of AAV2 capsids, led to the hypothesis that complete AAV2 uncoating takes place in the nucleolus.
Fig 4
Absence of intact AAV2 capsids in AAV2 genome positive nucleoli points towards complete viral uncoating.
NHF cells were infected with wtAAV2 (MOI 20`000). At 24 hpi, the cells were fixed and processed for multicolor IF analysis combined with FISH and CLSM. Nucleoli (Nuc) were visualized using an antibody against fibrillarin (yellow). Intact capsids were stained using an antibody that detects a conformational capsid epitope (green). AAV2 DNA (magenta) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. Nuclei were counterstained with DAPI and illustrated as white lines. (A) Distinct pattern (I—III) of AAV2 capsid signal in cells with AAV2 genome positive nucleoli. (B) Quantification of 50 individual cells with distinct AAV2 capsid signal. (C) Image-based quantification of the integrated intensity of AAV2 capsid signals in dense or dispersed nucleoli of 70 individual cells. p-values were calculated using an unpaired Student`s t-test (*—p ≤ 0.05, **—p ≤ 0.01, ***—p ≤ 0.001, ****—p ≤ 0.0001).
Absence of intact AAV2 capsids in AAV2 genome positive nucleoli points towards complete viral uncoating.
NHF cells were infected with wtAAV2 (MOI 20`000). At 24 hpi, the cells were fixed and processed for multicolor IF analysis combined with FISH and CLSM. Nucleoli (Nuc) were visualized using an antibody against fibrillarin (yellow). Intact capsids were stained using an antibody that detects a conformational capsid epitope (green). AAV2 DNA (magenta) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. Nuclei were counterstained with DAPI and illustrated as white lines. (A) Distinct pattern (I—III) of AAV2 capsid signal in cells with AAV2 genome positive nucleoli. (B) Quantification of 50 individual cells with distinct AAV2 capsid signal. (C) Image-based quantification of the integrated intensity of AAV2 capsid signals in dense or dispersed nucleoli of 70 individual cells. p-values were calculated using an unpaired Student`s t-test (*—p ≤ 0.05, **—p ≤ 0.01, ***—p ≤ 0.001, ****—p ≤ 0.0001).In order to assess the functionality of the nucleolar AAV2 DNA, NHF cells were either infected with wtAAV2 or rAAVCFPRep (a recombinant AAV2 vector encoding the cyan fluorescent reporter protein fused in frame with AAV2 Rep under the control of the wt p5 promoter; both at a MOI 20`000). After 24 h, the cells were fractionated (S5 Fig), and purity of the nuclear, nucleolar, and nucleoplasmic fractions were confirmed by IF-FISH analysis and Western blot. Transfection of bead-purified (uncoated) nucleolar rAAVCFPRep DNA resulted in CFP-signal in the transfected cells (S6 Fig), indicating that the rAAV DNA released into the nucleoli is transcriptionally active. Southern analysis of the nucleolar fraction prepared at 24 and 48 hpi revealed bands representing the single-stranded (ss)AAV2 DNA and, most interestingly, the replication form monomer (rfm) which is the product of AAV2 second-strand synthesis (Fig 5). In the nucleoplasmic fraction neither ssAAV2 DNA nor rfm was detected at 24 hpi. At 48 hpi, a band representing the ssAAV2 DNA became visible also in the nucleoplasmic fraction, however, although the signal intensity of that band was comparable to the respective band observed in the nucleolar fraction, no rfm was detected in the nucleoplasmic fraction by 48 hpi.
Fig 5
Southern analysis of AAV2 DNA in cell fractions.
Southern Blot of denatured Hirt DNA extracted at 24 and 48 hpi from isolated nuclei, nucleoplasm, or nucleoli of NHF cells infected with wtAAV2 (MOI 20’000; 1.5x106 cell equivalents per lane). AAV2 DNA was visualized with an AAV2 rep-specific probe disclosing bands representing the single-stranded (ss)AAV2 DNA and the replication form monomer (rfm; product of AAV2 second-strand synthesis). Representative images from two independent experiments are shown.
Southern analysis of AAV2 DNA in cell fractions.
Southern Blot of denatured Hirt DNA extracted at 24 and 48 hpi from isolated nuclei, nucleoplasm, or nucleoli of NHF cells infected with wtAAV2 (MOI 20’000; 1.5x106 cell equivalents per lane). AAV2 DNA was visualized with an AAV2 rep-specific probe disclosing bands representing the single-stranded (ss)AAV2 DNA and the replication form monomer (rfm; product of AAV2 second-strand synthesis). Representative images from two independent experiments are shown.
Detection of AAV2 capsid proteins in absence of AAV2 capsids
If the absence of AAV2 capsid staining in the nucleoli with positive AAV2 genome signal was indeed due to complete viral uncoating, we would expect the presence of disassembled AAV2 capsid proteins in those nucleoli. To assess this hypothesis, NHF cells were mock-infected or infected with wtAAV2 (MOI 20`000) and 24 h later processed for combined IF-FISH and CLSM to detect AAV2 capsids (conformational epitope), AAV2 capsid proteins (linear epitope) and AAV2 DNA (Figs 6 and S7). The results show the absence of AAV2 capsids in presence of AAV2 capsid proteins in the nucleolus, supporting the hypothesis that AAV2 uncoating indeed takes place in the nucleoli. For technical reasons, co-staining of AAV2 capsids, AAV2 capsid proteins VP1/2/3 and AAV2 DNA did not allow to directly visualize nucleoli. However, the DAPI staining in Fig 6 indirectly reveals the position of the nucleoli, since the nucleoli have a lower DNA density than the surrounding structures and therefore appear as dark regions [35]. Moreover, individual staining of either AAV2 capsids or AAV2 capsid proteins together with AAV2 DNA and a nucleolar marker demonstrated that both intact AAV2 capsids (e.g., Fig 1) and AAV2 capsid proteins VP1/2 (Fig 6B) accumulated with AAV2 DNA in nucleoli.
Fig 6
Co-detection of AAV2 DNA with AAV2 capsids and AAV2 capsid proteins.
NHF cells were infected with wtAAV2 (MOI 20`000). At 24 hpi, the cells were fixed and processed for multicolor IF analysis combined with FISH and CLSM. (A) Intact capsids (green) or capsid proteins (yellow) were detected using either an antibody against intact AAV2 capsids (conformational capsid epitope) or an antibody (linear epitope) against VP1, VP2 and VP3. AAV2 DNA (red) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. Nuclei were counterstained with DAPI (blue). The wtAAV2 infected cells shown were assigned as pattern I and III according to the intensity of the capsid staining and following a similar classification as defined in Fig 4. (B) AAV2 capsid proteins (green) were detected using an antibody (linear epitope) against VP1 and VP2. AAV2 DNA (magenta) was detected by linking the amine-modified DNA to AF647. Nucleoli (Nuc) were visualized using an antibody against fibrillarin (yellow). Nuclei were counterstained with DAPI and illustrated as white lines.
Co-detection of AAV2 DNA with AAV2 capsids and AAV2 capsid proteins.
NHF cells were infected with wtAAV2 (MOI 20`000). At 24 hpi, the cells were fixed and processed for multicolor IF analysis combined with FISH and CLSM. (A) Intact capsids (green) or capsid proteins (yellow) were detected using either an antibody against intact AAV2 capsids (conformational capsid epitope) or an antibody (linear epitope) against VP1, VP2 and VP3. AAV2 DNA (red) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. Nuclei were counterstained with DAPI (blue). The wtAAV2 infected cells shown were assigned as pattern I and III according to the intensity of the capsid staining and following a similar classification as defined in Fig 4. (B) AAV2 capsid proteins (green) were detected using an antibody (linear epitope) against VP1 and VP2. AAV2 DNA (magenta) was detected by linking the amine-modified DNA to AF647. Nucleoli (Nuc) were visualized using an antibody against fibrillarin (yellow). Nuclei were counterstained with DAPI and illustrated as white lines.Intriguingly, we noticed a distinct difference in the nucleolar structure when comparing AAV2 DNA-positive nucleoli that were positive also for intact AAV2 capsids with AAV2 DNA-positive nucleoli that were negative for intact AAV2 capsids or positive for AAV2 capsid proteins. Specifically, the nucleoli appeared dense when positive for both AAV2 DNA and AAV2 capsids and dispersed when positive for AAV2 DNA and negative for AAV2 capsids or positive for AAV2 DNA and AAV2 capsid proteins (Figs 4A and 6B). The image-based quantification of the mean integrated intensity of AAV2 capsid signals relative to the nucleolar structure revealed a higher capsid signal intensity in dense nucleoli than in dispersed nucleoli (Fig 4C). Overall, these experiments imply that complete AAV2 uncoating takes place in the nucleoli and coincides with changes in the nucleolar structure.As the ratios of dense to dispersed nucleoli was comparable in mock-infected and wtAAV2 infected cells (S8 Fig), we hypothesized that not virus infection per se but cellular processes such as apoptosis, stress response, or cell cycle regulation are responsible for the different structures of AAV2 capsid-positive and AAV2 DNA-positive versus AAV2 capsid-negative and AAV2 DNA-positive nucleoli and may thereby control AAV2 uncoating.
Changes in nucleolar morphology correlate with cell cycle progression
To address the question whether the changes in nucleolar structure are linked to cell cycle progression, we performed image-based cell cycle analysis using DAPI and fibrillarin staining. To this end, a DAPI integrated intensity protocol was adapted from Ruokos et al. [36] and validated in NHF cells by correlating cyclin A, which is only expressed in late S and G2 cell cycle phases, with the integrated intensity of DAPI (S9 Fig; see also Materials and methods). As a first step, the background of each image was subtracted (step 1). Next, nuclei as well as the cyclin A staining were identified as primary objects using CellProfiler (step 2). In step 3 and 4, nuclei and cyclin A were related to each other and the DAPI integrated intensity of each cell was measured. The measured properties of each individual cell were subsequently exported and read into Matlab, where histograms were plotted. Visual thresholds were set (red dotted lines) to distinguish the distribution of the histogram into G1, S and G2 (step 5). The images were then analyzed with a second CellProfiler pipeline using the visual thresholds of the integrated intensity of DAPI to classify cells into G1: 54.85%, S: 9.67% and G2: 35.48% (step 6). Lastly, overlay images, showing the cell cycle stage of each cell, were saved to allow the tracking of individual cells for further analysis (step 7).To further validate the adapted protocol, NHF cells were synchronized using a double thymidine block. After the release, the cells were either mock-treated or treated with nocodazole (200 nM) for 24 hours to induce a G2 cell cycle arrest. For flow cytometry, the cells were harvested, fixed and stained with DAPI. For CLSM, the coverslips were embedded in ProLong Anti-Fade mountant containing DAPI. Images were analyzed as described in the section cell cycle analysis based on 4`,6-diamidino-2-phenylindole (DAPI) staining. Both methods, flow cytometry and CLSM, showed a significant decrease of the number of cells within G1 cell cycle phase and a significant increase of cells in G2 cell cycle phase upon nocodazole treatment (S10 Fig), indicating that the adapted protocol is suitable for image-based cell cycle staging. Next, the fibrillarin staining was correlated to the cell cycle profile of the mock-infected and wtAAV2 infected NHF cells. Fig 7 shows that the ratios of dense to dispersed nucleoli decrease during cell cycle progression in both mock-infected and AAV2 infected cells. Overall, the data imply that the observed morphological changes of the nucleoli indeed coincide with cell cycle progression and were not due to AAV2-induced stress response (see also S8 Fig).
Fig 7
Nucleolar reorganization during cell cycle progression.
Image-based analysis of the ratios of dense to dispersed nucleoli of 100 individual mock- or AAV2 infected cells in different cell cycle phases (G1, S and G2). p-values were calculated using an unpaired Student`s t-test (*—p ≤ 0.05, **—p ≤ 0.01, ***—p ≤ 0.001, ****—p ≤ 0.0001).
Nucleolar reorganization during cell cycle progression.
Image-based analysis of the ratios of dense to dispersed nucleoli of 100 individual mock- or AAV2 infected cells in different cell cycle phases (G1, S and G2). p-values were calculated using an unpaired Student`s t-test (*—p ≤ 0.05, **—p ≤ 0.01, ***—p ≤ 0.001, ****—p ≤ 0.0001).
G1 cell cycle phase obstructs complete AAV2 uncoating in nucleoli
Since we observed a decrease in the ratio of dense versus dispersed nucleolar structures (Figs 7 and S11) during cell cycle progression and a stronger intensity of AAV2 capsid signals in dense nucleoli than in dispersed nucleoli (Fig 4C), we next addressed the question whether cell cycle progression is important for complete AAV2 uncoating. For this, NHF cells were arrested in the G1 phase by a double thymidine treatment before and during infection with wtAAV2 (MOI 20`000). As control, the cells were released 8 h prior to infection by washing out the thymidine. At 24 h after infection, there was a robust difference in the cell cycle profile between G1-arrested cells (approx. 83% in G1) and released cells (approx. 47% in G1), confirming the efficient G1 arrest (Fig 8A). Image-based cell cycle analysis showed that the rate of complete uncoating (AAV2 capsid-DNA+/AAV2 capsid+DNA+) in nucleoli was approximately 4-fold lower in the G1-arrested cells compared to the released cells (Fig 8B). The double thymidine block did not per se influence the rate of complete uncoating in nucleoli, as the ratios of AAV2 capsid-DNA+/AAV2 capsid+DNA+ signals in G1 cells were comparable in presence or absence of thymidine (Fig 8C). Moreover, neither the blocking with nor the release from thymidine influenced the total area of the nucleoli during cell cycle progression (Fig 8D).
Fig 8
G1 cell cycle arrest obstructs complete uncoating in nucleoli.
NHF cells were arrested in G1 cell cycle phase by a double thymidine block before and during infection with wtAAV2 (MOI 20`000). As control, the cells were released 8 h prior to infection by washing out the thymidine. At 24 hpi, the cells were fixed and processed for multicolor IF analysis combined with FISH, CLSM and image-based analysis of (A) the cell cycle profile after continuous thymidine block or release, respectively. (B) Quantification of the total uncoating rate in nucleoli. (C) Image-based quantification of the uncoating rate in nucleoli in G1 cell cycle phase. (D) Image-based quantification of the nucleolar area after continuous thymidine block or release, respectively. p-values were calculated using an unpaired Student`s t-test (*—p ≤ 0.05, **—p ≤ 0.01, ***—p ≤ 0.001, ****—p ≤ 0.0001).
G1 cell cycle arrest obstructs complete uncoating in nucleoli.
NHF cells were arrested in G1 cell cycle phase by a double thymidine block before and during infection with wtAAV2 (MOI 20`000). As control, the cells were released 8 h prior to infection by washing out the thymidine. At 24 hpi, the cells were fixed and processed for multicolor IF analysis combined with FISH, CLSM and image-based analysis of (A) the cell cycle profile after continuous thymidine block or release, respectively. (B) Quantification of the total uncoating rate in nucleoli. (C) Image-based quantification of the uncoating rate in nucleoli in G1 cell cycle phase. (D) Image-based quantification of the nucleolar area after continuous thymidine block or release, respectively. p-values were calculated using an unpaired Student`s t-test (*—p ≤ 0.05, **—p ≤ 0.01, ***—p ≤ 0.001, ****—p ≤ 0.0001).Similar to the effect of the thymidine treatment, contact inhibited NHF cells showed a defect in the rate of complete uncoating (AAV2 capsid-DNA+/AAV2 capsid+DNA+) in nucleoli compared to cycling cells (S12A Fig). Of note, in the cycling cells the numbers of cells with nucleolar AAV2 capsid-positive and DNA-positive (AAV2 capsid+DNA+) signal increased from 0–10 hpi (likely due to accumulation of incoming capsids) and then decreased from 10–48 hpi (S12B Fig), while the number of cells in which the nucleolar AAV2 DNA accumulated together AAV2 capsid proteins VP1, VP2 and VP3 (AAV2 VP1/2/3+DNA+) increased from 0–48 hpi (S12C Fig).
Induction of nucleolar disruption overcomes thymidine-mediated obstruction of AAV2 uncoating
NHF cells were arrested in the G1 phase of the cell cycle by a double thymidine block before and during infection with wtAAV2 (MOI 20`000). At 24 hpi, the cells were treated with actinomycin D (50 nM) for 1 h in order to induce nucleolar disruption and nucleolar cap formation (reviewed in [37]), fixed and processed for multicolor IF-FISH and CLSM (Fig 9A). Analysis of the cell cycle profile confirmed the cell cycle arrest upon thymidine and actinomycin D treatment (60% of cells in G1). The actinomycin D mediated nucleolar disruption in thymidine-treated cells led to a considerable decrease of capsid signals in the nucleoli and nucleoplasm and an increase of AAV2 genome signals in the nucleoplasm (Fig 9A and 9B). This shows that complete uncoating in nucleoli can be induced by changes in the nucleolar structure (disruption) even when cells are in G1 phase where normally no efficient complete uncoating is observed (Fig 8).
Fig 9
Actinomycin D treatment overcomes thymidine-mediated obstruction of AAV2 uncoating.
NHF cells were arrested in G1 cell cycle phase by a double thymidine block before and during infection with wtAAV2 (MOI 20`000). At 24 hpi, the cells were treated with actinomycin D for 1 h, fixed and processed for multicolor IF analysis combined with FISH and CLSM. (A) Nucleoli (Nuc) were visualized using an antibody against fibrillarin (yellow). Intact capsids were stained using an antibody that detects a conformational capsid epitope (green). AAV2 DNA (red) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. (B) Image-based quantification of 50 individual cells per condition for nucleolar capsid, total nuclear capsid or total nuclear AAV2 genome signals. p-values were calculated using an unpaired Student`s t-test (*—p ≤ 0.05, **—p ≤ 0.01, ***—p ≤ 0.001, ****—p ≤ 0.0001).
Actinomycin D treatment overcomes thymidine-mediated obstruction of AAV2 uncoating.
NHF cells were arrested in G1 cell cycle phase by a double thymidine block before and during infection with wtAAV2 (MOI 20`000). At 24 hpi, the cells were treated with actinomycin D for 1 h, fixed and processed for multicolor IF analysis combined with FISH and CLSM. (A) Nucleoli (Nuc) were visualized using an antibody against fibrillarin (yellow). Intact capsids were stained using an antibody that detects a conformational capsid epitope (green). AAV2 DNA (red) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. (B) Image-based quantification of 50 individual cells per condition for nucleolar capsid, total nuclear capsid or total nuclear AAV2 genome signals. p-values were calculated using an unpaired Student`s t-test (*—p ≤ 0.05, **—p ≤ 0.01, ***—p ≤ 0.001, ****—p ≤ 0.0001).
Capsid disassembly coincides with cell cycle progression
To further assess whether capsid disassembly overlaps with cell cycle progression, NHF cells were either mock-infected or infected with wtAAV2 (MOI 20`000). 24 h later, the cells were fixed and processed for IF-FISH, CLSM and image-based cell cycle analysis and quantification. Specifically, we used the DAPI integrated intensity protocol to determine the cell cycle phase and the IF-FISH protocol to detect intact AAV2 capsids, the disassembled AAV2 VP1/2/3 capsid proteins, and the AAV2 DNA (Fig 10). In 55% of the cells in G1 cell cycle phase but only in 29% of the cells in S/G2 we observed the accumulation of AAV2 DNA together with AAV2 capsids (genome accessibility, pattern I). In contrast, the number of cells in which the AAV2 DNA did not accumulate together with AAV2 capsids (pattern III) but rather with AAV2 capsid proteins VP1, VP2 and VP3 (complete uncoating) increased from 50% in G1 to 80% in S/G2. The same observation held true for neonatal human dermal fibroblasts (HDFn) cells infected with wtAAV2 (S13 Fig). Overall, our data strongly indicate that capsid disassembly coincides with cell cycle progression and nucleolar alterations.
Fig 10
Capsid disassembly coincides with cell cycle progression.
NHF cells were infected with wtAAV2 (MOI 20`000). At 24 hpi, the cells were fixed and processed for multicolor IF analysis combined with FISH and CLSM. (A) Intact capsids (green) or capsid proteins (yellow) were detected using either an antibody against intact AAV2 capsids (conformational capsid epitope) or an antibody (linear epitope) against VP1, VP2 and VP3. AAV2 DNA (magenta) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. Nuclei were counterstained with DAPI and illustrated as white lines. The cells shown were assigned as pattern I and III according to the intensity of the capsid staining and following a similar classification as defined in Fig 4. (B) Quantification of at least 70 nuclei positive for intact AAV2 capsids or capsid proteins during cell cycle progression.
Capsid disassembly coincides with cell cycle progression.
NHF cells were infected with wtAAV2 (MOI 20`000). At 24 hpi, the cells were fixed and processed for multicolor IF analysis combined with FISH and CLSM. (A) Intact capsids (green) or capsid proteins (yellow) were detected using either an antibody against intact AAV2 capsids (conformational capsid epitope) or an antibody (linear epitope) against VP1, VP2 and VP3. AAV2 DNA (magenta) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. Nuclei were counterstained with DAPI and illustrated as white lines. The cells shown were assigned as pattern I and III according to the intensity of the capsid staining and following a similar classification as defined in Fig 4. (B) Quantification of at least 70 nuclei positive for intact AAV2 capsids or capsid proteins during cell cycle progression.
Discussion
Nucleoli are membrane-less and dynamic subnuclear structures, which were mainly known for their role in ribosome biosynthesis. However, nucleoli have a function in numerous other cellular processes as well, such as cell cycle regulation, stress response and apoptosis (reviewed in [17-20]). Proteomic approaches led to the identification of roughly 4`500 nucleolar associated proteins of which only a third is linked to ribosome biogenesis [38,39].Many different viruses can exploit the nucleolus or nucleolar proteins to drive different steps of their life cycle including replication, transcription, and assembly (reviewed in [21,22,40,41]). For example, HSV-1 induces the redistribution of nucleolin from the nucleolus into HSV-1 replication compartments in a ICP4-dependent manner, thereby leading to enhanced HSV-1 replication and disruption of the nucleolar structure [42]. Similarly, nucleolar upstream binding factor (UBF) and nucleophosmin (B23.1) are recruited to adenovirus replication compartments to promote viral DNA replication [43-45]. The autonomous parvovirus minute virus of mice has been shown to replicate its DNA in the nucleoli of mouse fibroblasts [46,47] Additionally, borna disease virus transcription and replication take place in the nucleoli as well [48]. Moreover, specific mRNAs and proteins of many different viruses, including HIV-1, Japanese encephalitis virus, and Semliki Forest virus traffic through the nucleolus for processing, and the inhibition of such trafficking affects virus replication [49-51].Helper virus-supported AAV2 DNA replication occurs in nuclear replication compartments that are distinctly separate from nucleoli (S14 Fig). However, AAV2 interacts with nucleoli at both early and late stages of the replication cycle, cell entry and assembly. Upon nuclear entry AAV2 capsids have been shown to accumulate in the nucleoli [14]. Later in infection, intact AAV2 capsids were detected also in the nucleoplasm. Treatment of cells with hydroxyurea or proteasome inhibitors, both of which are known to improve AAV2 transduction efficiency, increased either nucleolar accumulation of AAV2 capsids or their relocalization into the nucleoplasm. Moreover, the post-transcriptional silencing of nucleophosmin enhanced nucleolar accumulation and increased transduction comparable to the proteasome inhibitor treatment, while the siRNA-mediated silencing of nucleolin mobilized capsids to the nucleoplasm and enhanced transduction similar to the treatment with hydroxyurea. These observations led to the hypothesis that AAV2 uncoating takes place in the nucleoplasm [14]. However, in the aforementioned study and all other studies, viral capsids and viral genomes were not directly correlated on the single cell level but rather analyzed by quantitative (q)PCR, Western blot and immunofluorescence [14,24-30].By employing combined immunofluorescence analysis with fluorescence in situ hybridization (IF-FISH) and confocal laser scanning microscopy, we monitored the spatial and temporal distribution of AAV2 capsids and genomes on the single cell level and observed that AAV2 DNA accumulates together with AAV2 capsids in the nucleoli of AAV2 infected cells, thereby confirming previous findings that the nucleolus acts as a sink for incoming AAV2 particles. In addition, our IF-FISH assay provides evidence for the stepwise uncoating of the AAV2 particle. Step 1 occurs in the cytoplasm, probably within endocytic vesicles of this compartment, and leads to AAV2 genome accessibility where the viral capsid is still recognized by an antibody that binds to a conformational capsid epitope and co-localizes with AAV2 DNA. Step 2 takes place within the nucleoli and results in the complete disassembly of the AAV2 capsids and the accumulation of AAV2 DNA and AAV2 capsid proteins.The exact mechanism that drives step 1 of the AAV2 uncoating process and how it fits into current AAV2 trafficking models remains to be investigated. However, our data show that it is enhanced by acidification, as co-detection of AAV2 capsids and AAV2 DNA in the cytoplasm was reduced in cells treated with bafilomycin A1, a vacuolar H+-ATPase inhibitor. The interaction of importin β and the N-terminal end of VP1 [24] as well as the pH-dependent structural reorganization of the AAV2 capsid leading to the extrusion of the nuclear localization signals located in VP1u and VP1/VP2 N-termini [13,52,53] have been shown to be relevant for efficient nuclear entry of the AAV2 capsid. Whether or not the accessibility of the AAV2 genome for the AAV2 DNA specific FISH probe in AAV2 capsids that are still recognized by a conformational capsid antibody is due to pH-dependent structural rearrangements of the capsid or rather due to the protrusion of the AAV2 DNA from an almost intact AAV2 capsid, as it has been shown for thermally induced AAV2 genome release [54], requires further investigation. Similarly, whether or not AAV2 particles with FISH-probe accessible genomes can indeed enter the nucleus and establish viral replication compartment also requires further investigation. The accessibility of the AAV2 genome, however, might provide further evidence for the Toll-like receptor 9 (TLR9) mediated antiviral activation state in AAV2 infected untransformed cells [55].Our image-based analysis of the nucleolar structure as well as AAV2 DNA, AAV2 capsids, and AAV2 capsid proteins, relative to the cell cycle profile provides strong evidence that step 2 of the uncoating process, the complete disassembly of the capsid, occurs in the nucleolus. Most interestingly, we provide also evidence that AAV2 second-strand synthesis may occur in the nucleoli, as we identified replication form monomers, the products of second-strand synthesis, in nucleolar fractions as early as 24 hpi, while no such products were identified in the nucleoplasmic fraction by 48 hpi. In principle, double-stranded AAV2 DNA may also be generated by the annealing of DNA strands with opposite orientation. However, this could be expected to occur also in the nucleoplasmic fraction, where it was not observed by 48 hpi, although the intensity of the single-stranded DNA band was comparable to that observed in the nucleolar fraction. The finding that rAAV DNA isolated from nucleoli is transcritptionally active further supports the hypothesis that second-strand synthesis can indeed take place in nucleoli. Nevertheless, we cannot exclude the possibility that AAV2 DNA uncoating and genome processing can occur also in other nuclear compartments.The data also support the hypothesis that the complete disassembly of AAV2 capsids is induced by the structural reorganization of the nucleolus in a cell cycle-dependent manner. While it is common for viruses to take advantage of the cell cycle or to undermine it in order to drive different stages of their life cycle (reviewed in [56]), little is known about viruses availing the cell cycle to drive their uncoating process. A recent study demonstrated that the HIV-1 is unable to uncoat its core in quiescent CD4+ lymphocytes and that the uncoating activity requires transition from G0/G1a to G1b stage, arguing for the demand of cell cycle-dependent specific factors for HIV-1 uncoating [57]. For foamy virus (FV), capsid uncoating and the formation of the preintegration complex starts with the onset of mitosis. As the microtubule organizing center and the associated centrosomes, both being relevant for the life cycle of the virus, are highly linked to cell cycle regulation, it is likely that cell cycle regulatory proteins might contribute to FV capsid uncoating [58].Nucleolar proteins such as nucleolin can bind to AAV2 capsids and seem to play a major role in the AAV2 replication cycle. Several studies demonstrated that nucleolin is barely detectable in resting cells; in contrast, nucleolin represents the major nucleolar protein in cycling eukaryotic cells [23,59]. This observation provides evidence for a link between AAV2 capsids, cell cycle progression and nucleolar proteins.The interaction of some virus proteins with the nucleoli has been shown to be regulated by the cell cycle as well. For example, the human cytomegalovirus UL83 protein and the coronavirus nucleocapsid protein have been shown to localize to the nucleolus preferentially in the G1 and the G2 phase of the cell cycle, respectively. Most interestingly, we have previously reported that AAV2 gene expression and DNA replication occur primarily in the G2 phase of the cell cycle [60]. This cell cycle-dependence was not due to inefficient second-strand synthesis in cells in G1 nor to cell cycle-dependent DNA damage responses, as gene expression from a double-stranded self-complementary AAV2 vector was also reliant on cells in the G2 phase of the cell cycle and the inhibition of specific kinases in DNA damage signaling did not result in a shift of gene expression to cells in G1.Based on our new finding that the accumulation of AAV2 DNA together with disassembled AAV2 capsid proteins in dispersed nucleoli coincides with the G2 phase of the cell cycle, it is tempting to speculate that cell cycle-dependent AAV2 gene expression and DNA replication is controlled by cell cycle-dependent reorganization of the nucleolar structure that enables AAV2 uncoating. This hypothesis is further supported by the observation that perturbations that lead to changes in the nucleolar architecture such as actinomycin D treatment (this study), helper virus infection, or post-transcriptional silencing of nucleolin, enhance AAV2 transduction. However, the exact mechanism of the disassembly of the AAV2 capsid by nucleolar reorganization during cell cycle progression remains to be further investigated.AAV infects proliferating and non-dividing or quiescent cells, and this feature is considered an advantage in gene transfer and gene therapy approaches employing AAV vectors [61]. Particularly, long-term stable transgene expression mediating therapeutic efficacy in human clinical trials such as those focusing on liver [62]. Nevertheless, when comparing efficacy, transduction efficiency was shown to be lower in quiescent cells compared to proliferating cells [61] an observation that our here reported findings might help to explain. Besides, our data do not exclude the possibility that uncoating may take place in the nucleoplasm by mechanisms that do not involve the cell cycle.We here focused our study on wild-type AAV2 and showed compelling evidence that the same steps towards uncoating are also employed by recombinant AAV2 vectors. Albeit it remains to be proven experimentally, but given the similarities between various serotypes regarding the main steps of cell transduction (despite differences in receptor usage, capsid stability and efficacy of episome formation), we assume that also serotypes other than AAV2 undergo a partial uncoating (evidence by the reported TLR9 mediated sensing of vector genomes [63] in the endosomal compartment as well as structural biology studies reported by [64,65]) that is completed in the nucleolus and supported by alterations of the nucleolar structures.
Materials and methods
Cells and viruses
Normal human fibroblast (NHF) cells were kindly provided by X.O. Breakefield (Massachusetts General Hospital, Charlestown, MA, USA). NHF cells, neonatal human dermal fibroblast cell line HDFn (ATCC PCS-201-010, American Type Culture Collection, Rockville, Md, USA), human hepatocellular carcinoma cell line Hep G2 (ATCC HB-8065, American Type Culture Collection, Rockville, Md, USA), lung epithelial cells A549 (ATCC CCL-185, American Type Culture Collection, Rockville, Md, USA) and African green monkey kidney cells (Vero cells, ATCC, American Type Culture Collection, Rockville, Md, USA) were maintained in growth medium containing Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin G, 100 μg/ml streptomycin, and 0.25 μg/ml amphotericin B (1% AB) at 37°C in a 95% air-5% CO2 atmosphere. Wild-type (wt) AAV2 was produced by H. Buening (University of Hannover, Hannover, Germany) and the Viral Vector Facility (VVF) of the Neuroscience Center Zurich (ZNZ). The recombinant vector of AAV serotype 2 (rAAVGFP) was produced by the VVF of the ZNZ. Besides, rAAVCFPRep (serotype 2) was produced by transient transfection of 293T cells with pDG [66] and pAAVCFPRep [60], and purified by an iodixanol density gradient. Titers of genome-containing particles were determined as described previously [67].The VP1 AAV2 mutant (76HD/AN) was constructed according to Girod et al. [32] and produced by the VVF. Briefly, the 76HD/AN mutant construct was generated by mutating two key residues 76HD to 76AN using K-76HD/AN (5`GCGGCCCTCGAGGCCAACAAAGCCTACGACCGG 3`), L-76HD/AN (5`CCGGTCGTAGGCTTTGTTGGCCTCGAGGGCCGC 3`), psub-201 [68] containing the full-length AAV2 genome as template and the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies). HSV-1 delta ICP27 (HSV-1ΔICP27) mutants were provided from R. Everett (University of Glasgow).
Antibodies
The following primary antibodies were used: anti-AAV2 intact particle (A20, ProGen; dilution for Immunofluorescence [IF] 1:50), anti-AAV VP1/VP2/VP3 (VP51, ProGen, dilution for IF 1:10), anti-AAV VP1/VP2 (A69, ProGen, dilution for IF 1:10), anti-AAV2 Rep (Fitzgerald Industries, 10R-A111A, dilution for IF 1:10), anti-fibrillarin (Abcam ab5821; dilution for IF 1:200; dilution for Western blotting [WB] 1:650), anti-cyclin A (Santa Cruz sc-751, dilution for IF 1:500), anti-α-tubulin (Sigma-Aldrich, T5168, dilution for WB 1:1’000), anti-NPM (Abcam ab10530, dilution for WB 1:2000), anti-NCL (Abcam ab22758, dilution for WB 1:1000), anti-vimentin (Santa Cruz sc-5565, dilution for WB 1:400) The following secondary antibodies were used: Alexa Fluor 594 goat anti-rabbit IgG (Life Technologies A11037, dilution for IF 1:500), Alexa Fluor 488 goat anti-mouse IgG (Invitrogen A11001, dilution for IF 1:500), Goat anti-mouse IgG (H+L) 680RD: LI-COR (926–68070), dilution for WB 1:10’000, Goat anti-rabbit IgG (H+L) 680RD: LI-COR (926–68071), dilution for WB 1:10’000.
Viral infection and treatments
NHF, HDFn, Hep G2, A549 or Vero cells were seeded onto coverslips (12-mm diameter; Glaswarenfabrik Karl Hecht GmbH & Co. KG, Sondheim, Germany) in 24-well tissue culture plates at a density of 3x104 cells per well. Cycling or contact inhibited NHF cells were seeded at a density of 2x104 or 1x105, respectively. The next day, the cells were washed with PBS and either mock-infected, infected with either wtAAV2 at a multiplicity of infection (MOI) of 2`000 or 20`000 genome containing particles (gcp) per cell or rAAVGFP (MOI of 20`000) in 250 μl of DMEM (0% FBS, 1% AB) pre-cooled to 4°C. The plates were first incubated for 30 min at 4°C to synchronize viral uptake and then incubated at 37°C in a humidified 95% air-5% CO2 incubator for the indicated time period. For acidification experiments NHF cells were treated with bafilomycine A1 (50 or 200 nM) or DMSO in DMEM (10% FBS, 1% AB) 1 h prior to infection with wtAAV2. G1 cell cycle phase arrest prior to infection was induced by a double thymidine block. For this, cells were seeded in 10 cm tissue culture dishes (5x105 cells per dish) and 12 h later the growth medium was replaced with medium (DMEM, 10% FBS, 1% AB) containing 3 mM thymidine. After 12 h of incubation, the cells were washed with PBS, trypsinized and split at a density of 6x104 cells per well into 6-well tissue culture plates containing coverslips. In order to complete the double thymidine block, the growth medium was replaced 12 hours later by medium containing 3 mM thymidine. After 12 hours, the cells were either released from the block by washing out the thymidine with PBS or directly infected with wtAAV2 in the presence of thymidine. Nucleolar disruption was induced with actinomycin D (50 nM) in DMEM (2% FBS, 1% AB) for 1 h after 24 h of infection in presence of thymidine.
Cell cycle analysis based on 4`,6-diamidino-2-phenylindole (DAPI) staining
The workflow described is closely related and adapted from the protocol published by Roukos et al., 2015 [36]. Briefly, NHF cells were seeded onto coverslips (12-mm diameter; Glaswarenfabrik Karl Hecht GmbH & Co. KG, Sondheim, Germany) in 24-well tissue culture plates (3x104 cells per well). The next day, the cells were washed with PBS, processed as indicated in the results and the figure legends, counterstained with DAPI and imaged by confocal laser scanning microscopy (Leica SP8; Leica Microsystems, Wetzlar, Germany). An automated CellProfiler (V.2.2.0-V.4.0.7) pipeline measured the integrated intensity of DAPI. Next, the histograms of DAPI, corresponding to the DNA content, were plotted and visual thresholds for each cell cycle phase were selected. These thresholds were finally read back into a secondary CellProfiler pipeline, which lastly allowed tracking of individual cells and measurements.
Comparison of cell cycle classification using flow cytometry and the DAPI integrated intensity protocol
To validate the DAPI integrated intensity protocol, NHF cells were synchronized using a double thymidine block (as described above). After the release, the cells were either mock-treated or treated with nocodazole (200 nM) for 24 hours. For flow cytometry, the cells were harvested by exposing them to 0.05% Trypsin-EDTA solution for 10 min, centrifuged and washed with PBS, fixed in 2.5 ml ice-cold 100% ethanol, centrifuged, washed once again with PBS and stained with a freshly made solution containing 1 μg/mL DAPI, 0.05% Triton X-100 and 0.1 mg/mL ribonuclease A (RNase A) in PBS. All samples were incubated for 45 min at 37°C in the dark. After incubation, the cells were washed twice with PBS and then resuspended in 200 μl PBS prior to analysis (SONY SP6800 Spectral Analyzer). For confocal laser scanning microscopy, the coverslips were embedded in ProLong Anti-Fade mountant with DAPI (Molecular Probes, Eugene, OR, USA) and imaged using a 63x oil immersion objective (Leica SP8; Leica Microsystems, Wetzlar, Germany). Images were analyzed as described in the section cell cycle analysis based on 4`,6-diamidino-2-phenylindole (DAPI) staining.
Combined multicolor immunofluorescence analysis and fluorescence in situ hybridization (FISH)
FISH was performed essentially as described previously by Lux et al. [27]. Briefly, a 3.9-kb DNA fragment containing either the wtAAV2 genome or the rAAVGFP genome without the inverted terminal repeats was amplified by PCR from plasmid pDG using forward (5`-CGGGGTTTTACGAGATTGTG-3`) and reverse (5`-GGCTCTGAATACACGCCATT-3`) primers or from pAAVGFP (provided by M. Linden, King’s College London School of Medicine, London, UK) using forward (5`- ATGGTGAGCAAGGGCGAGGA-3`) and reverse (5`-CTTGTACAGCTCGTCCATGC-3`) primers and the following conditions: 30 s at 95°C; 35 cycles of 10 s at 98°C, 15 s at 58°C, and 75 s at 72°C; and 10 min at 72°C. The PCR sample was then digested with DpnI to cut the residual template DNA and purified with the Pure Link PCR purification kit (Qiagen, Hilden, Germany). The DNA fragment was labeled with 5-(3-aminoallyl)dUTP by nick translation according to the manufacturer’s protocol (Ares DNA labeling kit, Molecular Probes, Eugene, OR, USA), and the incorporated dUTPs were labeled with amino-reactive Alexa Fluor 647 dye by using the same Ares DNA labeling kit. NHF cells were plated onto glass coverslips in 24-well tissue culture plates at a density of 3x104 cells per well and 24 h later mock-infected or infected with wtAAV2 (MOI of 20`000). 24 hours after infection, the cells were washed with PBS, fixed for 30 min at room temperature (RT) with 2% PFA (in PBS), and washed again with PBS. The cells were then quenched for 10 min with 50 mM NH4Cl (in PBS), washed with PBS, permeabilized for 10 min with 0.2% Triton X-100 (in PBS), blocked for 10 min with 0.2% gelatin (in PBS) followed by two washing steps with PBS before blocking for 30 min in PBST (0.05% Tween 20 in PBS) supplemented with 3% BSA at 4°C. After antibody staining in PBST-BSA (3%, 25 μl/coverslip) for 1h at RT in the dark in a humidified chamber, the cells were washed three times for 5 min with PBST (0.1%), post-fixed with 2% PFA and blocked with 50 mM glycine in PBS for 5 min at RT.Hybridization solution (20 μl per coverslip) containing 1 ng/ml of the labeled DNA probe, 50% formamide, 7.3% (w/v) dextran sulfate, 15 ng/ml salmon sperm DNA, and 0.74x SSC (1x SSC is 0.15 M NaCl and 0.015 M sodium citrate) was denatured for 3 min at 95°C and shock-cooled on ice. The coverslips with the fixed and permeabilized cells facing down were placed onto a drop (20 ml) of the denatured hybridization solution and incubated overnight at 37°C in a humidified chamber (note that the cells were not denatured, as the AAV2 genome is present as ssDNA). The next day, the coverslips were washed three times with 2x SSC at 37°C, three times with 0.1x SSC at 60°C, and twice with PBS at RT. To confirm the FISH signal, some samples (as stated in the results) were treated with DNase I (1U/ μl) for 1 h at 37°C followed by inactivation in 30% formamide, 0,1% Triton-X 100 and 2x SSC for 10 min at RT.The cells were then embedded in ProLong Anti-Fade mountant with or without DAPI (Molecular Probes, Eugene, OR, USA) and imaged as midsections if not stated otherwise by confocal laser scanning microscopy (Leica SP8; Leica Microsystems, Wetzlar, Germany). To prevent cross talk between the channels for the different fluorochromes, all channels were recorded separately, and fluorochromes with longer wavelengths were recorded first. The resulting images were processed using Imaris V.7.7.2-V.9.6.0 (Bitplane, Oxford Instruments, Biplane AG, Zurich, Switzerland).
Isolation of nucleoli from AAV2 infected cells
NHF cells were seeded in T150 cell culture flasks at a density of 3x106 cells per flask. The next day, the cells were washed with PBS and either mock-infected or infected with wtAAV2 or rAAVCFPRep at a MOI of 20`000 gcp per cell in 5 ml of DMEM (0% FBS, 1% AB) pre-cooled to 4°C. The flasks were first incubated for 30 min at 4°C to synchronize viral uptake and then incubated at 37°C in a humidified 95% air-5% CO2 incubator for the indicated time period.Isolation of nucleoli was performed according to Hacot et al [69]. Briefly, cells were washed with ice-cold PBS and detached using Trypsin-EDTA (0.05%) at the indicated time points. The cells were pelleted, and the volume was visually determined. The cell pellet was resuspended in 2 volumes of nucleolar standard buffer (NSB, 10 mM Tris-HCl, 10 mM NaCl, 1 mM MgCl2) and the reference volume (RV) was calculated (measured volume–volume NSB added). After adjusting the volume to 15 times the RV with NSB, the cell suspension was incubated on ice for 30 min. The cells were lysed by adding 10% NP-40 to a final concentration of 0.3% and then centrifuged at 1200 g for 5 min at 4°C. The supernatant containing the cytoplasmic fraction was collected. To purify the nuclei, the pellet was resuspended in 10 RV of 250 mM sucrose containing 10 mM MgCl2. After carefully adding 10 RV of 880 mM sucrose solution containing 5 mM MgCl2, the suspension was centrifuged for 10 min at 4°C and 1200 g. The purified nuclei were resuspended in 10 RV of 340 mM sucrose solution containing 5 mM MgCl2 and sonicated (20% amplitude, QSonica, Q800R3, CT, USA) at 4°C for three pulses of 30 s in 30 s intervals to break the nuclei. 10 RV of 880 mM sucrose solution was added on the bottom of the tube containing the sonicated nuclei, and the suspension was centrifuged for 20 min at 4°C and 2000 g. The supernatant, containing the nucleoplasmic fraction was collected, and the pelleted nucleoli were resuspended in 50 μl TBS (50 mM Tris-HCl, 150 mM NaCl, pH 7.5). Cell fractionation was controlled by Western blot and IF-FISH analyses.
Isolation of fully uncoated DNA
After freeze thawing the isolated nucleoli three times, 1 vol AMPure XP beads (Beckman&Coulter, A63880, IN, USA) were added, and the samples were incubated for 5 minutes at RT while rotating the tube. The beads were collected using a magnetic rack, and the supernatant was set aside (containing unopened capsids and nucleolar debris). The beads were washed twice with freshly prepared 70% ethanol (without removing the tube from the magnetic rack) and left to dry for approx. 30 s (but not to the point of cracking). The DNA was eluted in DNase free water for 2 min at RT. The beads were collected using a magnetic rack and then discarded. The supernatant containing the DNA was further purified by phenol/chloroform extraction and ethanol precipitation as described below.
Hirt DNA extraction
Extraction of extrachromosomal DNA was performed according to the Hirt protocol [70]. In short, cells were washed with PBS and detached using Trypsin-EDTA (0.05%). The cells were pelleted and resuspended in 50 μl TBS (50 mM Tris-HCl, 150 mM NaCl, pH 7.5). After adding 500 μl Hirt Buffer (0.6%SDS, 10mMTris-HCl, 10mMEDTA, pH7.5) the cell suspension was incubated for 1h at room temperature. After adding 120 μl 5 M NaCl solution, the sample was incubated for at least 12 h at 4°C. For phenol/chloroform extraction of the DNA, the sample was centrifuged for 10 min at 4°C and 15’500 g. The supernatant was transferred to a fresh tube, and 1 volume of phenol:chloroform:isoamylalcohol (25,24:1, v/v, 15593031, Invitrogen, USA) was added. The sample was centrifuged for 5 min at 4°C and 15’500 g. The supernatant was transferred into a fresh tube, and 1 volume chloroform was added. The sample was centrifuged for 1 min at 4°C and 15’500 g, and the supernatant was transferred into a fresh tube. 2.5 volumes of EtOH (pure) and 0.1 volume of 3 M NaAc pH 5.5 were added to the sample. To precipitate the DNA the suspension was incubated for at least 20 min at -80°C. The sample was centrifuged for 10 min at 4°C and 18’000 g, and the supernatant was discarded. The DNA pellet was washed with 70% EtOH and centrifuged for 10 min at 4° and 18’000 g. The supernatant was removed, and the DNA pellet was left to dry for at least 20 min at room temperature. After drying, the pellet was resuspended in Tris-HCl pH 8.5 and incubated for 10 min at 37°C.
Southern analysis
For Southern analysis extrachromosomal DNA was extracted using the Hirt protocol as described above. Prior to Southern blotting the samples were denatured for 5 min at 95°C, shock-cooled on ice, and then separated on a 0.8% agarose gel (100 V, 3.5h) and transferred onto nylon membranes (Hybond-N+, RPN119B, Amersham, Little Chalfont, UK). A DIG-labeled marker was used as reference (DNA molecular weight marker III, 11218602910, Roche). AAV2 sequences were detected using a DIG-labeled AAV2 rep-specific probe, which was visualized using an anti-DIG antibody conjugated with alkaline phosphatase and activation with the chemiluminescence substrate CDP Star (Roche) according to the manufacturer’s protocol. The DIG-labeled probe was synthesized using the PCR DIG probe synthesis kit (11636090910, Roche, Switzerland) and following primers: 5’-gaacgcgatatcgcagccgccatgccggg-3’ and 5’-ggatccgaattcactgcttctccgaggtaatc-3’. For chemiluminescence visualization the LI-COR imaging system Odyssey FC (LI-COR Biosciences, Lincoln, NE, USA) was used.
Transfection of nucleolar AAV2 DNA
NHF cells were plated onto glass coverslips in 24-well tissue culture plates at a density of 3x104 cells per well and 24 h later transfected with nucleolar uncoated (bead-purified) rAAVCFPRep DNA by using Lipofectamine LTX according to the manufacturer’s instructions (Life Technologies). At 24 hours after transfection, the cells were mock-infected or infected with HSV-1ΔICP27. At 48 hpi the cells were monitored by epifluorescence microscopy.
Negative contrast stain
For the examination of AAV2 capsid disintegration a negative contrast staining was performed. For this, 10 μl of the wtAAV2 stock were placed onto a parafilm strip and adsorbed to carbon coated parlodion films mounted on 300 mesh/inch copper grids by placing upside-down on the drop and incubated for 10 min at RT. Washing was done by transferring the grid to a H2O drop. Subsequently the grid was placed onto a drop of phosphotungstic acid (PTA, pH 7.0) for 60 seconds. Remaining liquid was removed by tipping the edge of the grid on a filter paper. The samples were analyzed in a Philips CM 12 transmission electron microscope (Eindhoven, the Netherlands) equipped with a charge-coupled device (CCD) camera (Ultrascan 1000, Gatan, Pleasanton, CA, USA) at an acceleration voltage of 100 kV.
Image-based quantification and data analysis
For image-based quantification and data analysis, at least 50 individual cells per sample or condition were recorded and analyzed using different CellProfiler (V.2.2.0-V.4.0.7) pipelines. The output csv-files were further analyzed using Matlab (R2017a) and GraphPad Prism 6 to 9. Depending on distribution frequency and standard deviation (SD), statistical analysis of individual cells was either performed by unpaired Student`s t-test or an unpaired t-test with Welch`s correction (not assuming equal SDs). If not stated otherwise, each graph illustrates one representative experiment.
Nucleolar accumulation of AAV2 capsids and genomes at different MOIs.
(A) NHF or (B) A549 cells were either mock-infected of infected with wtAAV2 at a MOI of 20`000 or 2`000. At 24 hpi, the samples were processed for IF-FISH and CLSM. Intact capsids were stained using an antibody that detects a conformational capsid epitope (green). Nucleoli (Nuc) were visualized using an antibody against fibrillarin (yellow). AAV2 DNA (red) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. Nuclei were counterstained with DAPI (blue).(TIF)Click here for additional data file.
Transduction efficiency correlates with uncoating efficiency.
NHF, A549 or Hep G2 cells were either mock-infected or infected with a recombinant AAV2 vector (rAAVGFP) at a MOI of 20`000. At 24 hpi, the samples were processed for IF-FISH and CLSM. (A) Intact capsids were stained using an antibody that detects a conformational capsid epitope (green). Nucleoli (Nuc) were visualized using an antibody against fibrillarin (yellow). AAV2 DNA (red) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. Nuclei were counterstained with DAPI (blue). (B) Comparison of transduction efficiency (% GFP positive cells) and uncoating efficiency (% rAAV capsid-negative DNA-positive nucleoli) of at least 50 cells.(TIFF)Click here for additional data file.
Endosomal escape is relevant for nucleolar accumulation.
NHF cells were either mock-infected or infected with wtAAV2 or a VP1 AAV2 mutant (76HD/AN) at a MOI of 20`000. At 5 hpi, the samples were processed for IF-FISH and CLSM. Intact capsids were stained using an antibody that detects a conformational capsid epitope (green). AAV2 DNA (red) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. Nuclei were counterstained with DAPI (blue) or illustrated as white lines.(TIF)Click here for additional data file.
DNase I treatment eliminates the AAV2 genome signal in IF-FISH assays.
(A) NHF or (B) A549 cells were infected with wtAAV2 (MOI 20`000). At 24 hpi, the cells were either treated with DNase I (1 U/μl) for 1 h at 37°C, RNase A (0.5 mg/ml) for 1 h at 37°C, or a combination of both. DNase or RNase inactivation was achieved by washing the cells twice for at least 10 min with either DNase inactivation buffer (30% Formamide, 0.1% Triton X-100, 2X SSC) or RNase inactivation buffer (0.5X SSC, 0.1 SDS), respectively. Afterwards the samples were fixed and processed for multicolor IF analysis combined with FISH and CLSM. Intact capsids were stained using an antibody that detects a conformational capsid epitope (green). Nucleoli (Nuc) were visualized using an antibody against fibrillarin (yellow). AAV2 DNA (red) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. Nuclei were counterstained with DAPI.(TIF)Click here for additional data file.
Verification of cell fractionation by IF-FISH and Western blot.
NHF cells were either mock-infected or infected with wtAAV2 at an MOI of 20`000. At 24 hpi, the cells were fractionated and isolated nuclei (A) or nucleoli (B) were applied to fibronectin coated coverslips and processed for IF-FISH and CLSM for morphological assessment of the two fractions. Intact capsids were stained using an antibody that detects a conformational capsid epitope (green). Nucleoli (Nuc) were visualized using an antibody against fibrillarin (yellow). AAV2 DNA (red) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. Nuclei were counterstained with DAPI (blue). (C) Western analysis revealed the absence of α-tubulin (cytoplasmic marker) and presence of fibrillarin (nuclear and nucleolar marker) in the nuclear and nucleolar fractions (105 cell equivalents per lane were loaded).(TIF)Click here for additional data file.
Functionality of nucleolar AAV2 DNA.
NHF cells were infected with rAAVCFPRep (MOI 20’000), and nucleolar fractions were prepared 24 h later. Bead-purified (uncoated) nucleolar DNA was transfected into NHF cells and, after 24 h, the cells were mock-infected or infected with HSV-1ΔICP27. At 48 hpi, the cultures were monitored for CFP-fluorescence using an epifluorescence microscope.(TIFF)Click here for additional data file.
Co-detection of AAV2 DNA with AAV2 capsids and AAV2 capsid proteins in Vero cells.
Vero cells were mock-infected or infected with wtAAV2 (MOI 20`000; two individual cells are shown). At 24 hpi, the cells were fixed and processed for multicolor IF analysis combined with FISH and CLSM. Intact capsids (green) or capsid proteins (yellow) were detected using either an antibody against intact AAV2 capsids (conformational capsid epitope) or an antibody (linear epitope) against VP1, VP2 and VP3. AAV2 DNA (red) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. Nuclei were counterstained with DAPI (blue).(TIF)Click here for additional data file.
AAV2 infection does not alter the ratio of dense to dispersed nucleoli.
NHF cells were mock-infected or infected with wtAAV2 (MOI 20`000) and 24 h later processed for combined IF-FISH, CLSM and quantification of the nucleolar structure of 100 individual nuclei in mock- or AAV2 infected cells. p-values were calculated using an unpaired Student`s t-test (*—p ≤ 0.05, **—p ≤ 0.01, ***—p ≤ 0.001, ****—p ≤ 0.0001).(TIF)Click here for additional data file.
Schematic representation of the cell cycle staging by cyclin A staining and the integrated intensity of DAPI.
(1) The background of each image was subtracted. (2) Nuclei and cyclin A stainings were identified as primary objects in CellProfiler. (3) The stainings were related to each other and (4) the DAPI integrated intensity of each nucleus was measured. (5) Histograms of the DAPI integrated intensities were plotted using an automated script in Matlab and visual thresholds were set. (6) Cells were classified in CellProfiler using the visual thresholds obtained in step 5. (7) The classification of each nucleus into G1, S or G2 was overlayed on the original DAPI image to track individual cells.(TIF)Click here for additional data file.
Cell cycle staging of DAPI stained cells using flow cytometry analysis and confocal laser scanning microscopy.
NHF cells were synchronized using a double thymidine (3 mM) block. After the release, the cells were either mock-treated or treated with nocodazole (200 nM) for 24 hours to induce a G2 cell cycle phase arrest. Flow cytometry shows the mean value of three experiments, each replicate contains at least 5`000 scored events. CLSM analysis shows the mean value of three experiments, each replicate contains at least 100 individual analyzed cells. p-values were calculated using an unpaired Student`s t-test (*—p ≤ 0.05, **—p ≤ 0.01, ***—p ≤ 0.001, ****—p ≤ 0.0001).(TIFF)Click here for additional data file.Image-based analysis of the ratios of dense to dispersed nucleoli of 150 individual cells in different cell cycle phases (G1, S and G2). Statistical analysis was performed on three independent experiments and p-values were calculated using an unpaired Student`s t-test (*—p ≤ 0.05, **—p ≤ 0.01, ***—p ≤ 0.001, ****—p ≤ 0.0001).(TIF)Click here for additional data file.
AAV2 uncoating is inhibited in contact inhibited NHF cells.
NHF cells were seeded at 40% or 100% confluency, respectively. The cells were either mock-infected or infected with wtAAV2 (MOI 20’000) and, at various time points post infection, processed for combined IF-FISH and CLSM. (A) Image-based analysis of the total uncoating rate in nucleoli of 30 cells at 48 hpi at 40% and 100% confluency. Quantification of cells (30 cells per time point) with (B) AAV2 capsid-positive and DNA-positive (AAV2 capsid+DNA+) signal or (C) AAV2 capsid protein VP1, VP2 and VP3-positive and DNA-positive (AAV2 VP1/2/3+DNA+) signal in nucleoli.(TIFF)Click here for additional data file.
Capsid disassembly coincides with cell cycle progression in HDFn cells.
HDFn cells were infected with wtAAV2 (MOI 20`000). At 24 hpi, the cells were fixed and processed for multicolor IF analysis combined with FISH, CLSM. (A) Intact capsids (green) or capsid proteins (yellow) were detected using either an antibody against intact AAV2 capsids (conformational capsid epitope) or an antibody (linear epitope) against VP1, VP2 and VP3. AAV2 DNA (magenta) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. Nuclei were counterstained with DAPI and illustrated as white lines. The wtAAV2 infected cells shown were assigned as pattern I and II according to the intensity of the capsid staining and following a similar classification as defined in Fig 4. (B) Quantification of at least 50 nuclei positive for intact AAV2 capsids or capsid proteins during cell cycle progression.(TIFF)Click here for additional data file.
Helper virus-supported AAV2 DNA replication occurs in nuclear replication compartments that are distinctly separate from nucleoli.
NHF cells were mock-infected or infected with wtAAV2 (MOI 10`000), HSV-1 (MOI 0.5) or co-infected with wtAAV2 (MOI 5`000) and HSV-1 (MOI 0.5). At 12 hpi, the cells were fixed and processed for multicolor IF analysis combined with FISH and CLSM. Nucleoli (Nuc) were visualized using an antibody against fibrillarin (yellow). wtAAV2 replication compartments were stained using a primary antibody specific for the AAV2 Rep proteins (green). AAV2 DNA (red) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. Nuclei were counterstained with DAPI and illustrated as blue lines.(TIF)Click here for additional data file.
Maximum intensity projection of AAV2 genome positive nucleoli.
NHF cells were infected with wtAAV2 (MOI 20`000). At 24 hpi, the cells were fixed and processed for multicolor IF analysis combined with FISH and CLSM. Nucleoli were visualized using an antibody against fibrillarin (yellow). Intact capsids were stained using an antibody that detects a conformational capsid epitope (green). AAV2 DNA (red) was detected with an Alexa Fluor (AF) 647 labeled, amine-modified DNA probe that binds to the AAV2 genome. Reconstructions were generated using Imaris V.9.6.(MP4)Click here for additional data file.11 Jan 2022Dear Dr. Fraefel,Thank you very much for submitting your manuscript "Adeno-associated virus type 2 (AAV2) uncoating is a stepwise process and is linked to structural reorganization of the nucleolus" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.When you are ready to resubmit, please upload the following:[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).Important additional instructions are given below your reviewer comments.Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Matthew D Weitzman, Ph.D.Guest EditorPLOS PathogensKarl MüngerSection EditorPLOS PathogensKasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158XMichael MalimEditor-in-ChiefPLOS Pathogens
orcid.org/0000-0002-7699-2064
***********************Editors' comments: The reviewers appreciated the technical approach taken and the importance of the question being addressed. However, they raise technical concerns, and highlight the descriptive nature of the study that lacks functional links for virus infection and vector transduction. All comments raised by these thoughtful reviews should be addressed.Reviewer's Responses to QuestionsPart I - SummaryPlease use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.Reviewer #1: Since the first observations of the presence of AAV capsids within the nucleolus, several studies have shown this nuclear body interacts with AAV at both early and late steps of the viral life cycle, a notion reinforced by finding that AAV capsids interact with nucleolin and nucleophosmin (B23). However, while the nucleolus is believed to favor capsid assembly during the late stage of infection, its function during the early infectious steps is still unclear. In particular, previous studies conducted with recombinant AAV vectors have suggested that the nucleolus may sequester AAV capsids upon nuclear entry and that capsid disassembly and genome uncoating requires their translocation in the nucleoplasm.The aim of this study was to revisit this notion using immuno-FISH analyses to detect the release of the wt AAV2 genome together with the viral capsids and/or VP proteins upon infection of human primary fibroblasts. The results presented by Sutter and colleagues show that wt AAV2 single-stranded DNA can be detected in the nucleolus of the infected cells either associated to assembled AAV2 capsids or AAV2 VP proteins. Further, the authors show data that remodeling of the nucleolar structure, a phenomenon known to occur upon cell division, favors capsid disruption and release of AAV2 DNA. They conclude from these data that uncoating of AAV2 occurs in the nucleolus upon its structural reorganization during cell cycle.While the analyses performed by Immuno-FISH are well-conducted and informative, the whole study suffers from the lack of functional analyses to support the conclusion. In particular, the absence of information about the functionality of the viral DNA released into the nucleolus, in terms of capacity to establish as a stable episome and to initiate viral replication makes any conclusion about this process premature.Reviewer #2: Sutter et al., have provided a body of data supporting a stepwise manner of AAV uncoating and linked to structural reorganization of the nucleolus. Utilizing immunofluorescence analysis and in situ hybridization the authors attempt to tract and segregate the AAV capsid vs AAV DNA genome after infection in vitro. It is very well written, and reads like an unraveling detective story, where the authors are following the clues (data that emerged from one experiment) to inform additional experiments to refine and expand their hypothesis. The strength and the novelty of the studies reside in the author’s ability to follow the process of AAV2 infection and uncoating at a single cell resolution, therefore providing a unique glimpse into AAV2 biology. A potential weakness is the number of particles utilized in order to obtain a convincing signal for imaging. It would be prudent if the authors could compare the doses utilized to capture the data in their experiments with published data studying the infectious MOI required to obtain transduction. The potential risk of saturating pathways with virus particles in order to observe an image should be discussed. Regardless, the authors performed robust experiments, and provide conservative interpretation.One major missing piece is the lack of discussion on how those observations affect the utility of AAV vectors for gene therapy medicines. AAV vectors are used widely to develop gene therapy vectors for where drug potency is dependent on the ability of the vectors to transduce non-dividing cells in a host. One suggestion is to include a discussion on how these data may be relevant for our understanding of how gene therapy works/may be improved. This work was done using wild type AAV2. Are those observations specific only to wild type AAV2? The authors should comment on this point. Do the authors expect that recombinant AAV vectors may behave differently? Please address in discussion. Do the authors expect that different AAV serotypes will be similar to the wild type AAV2? If such discussion is included, this position the manuscript to be of broader interest.Minor concernReference 25 is repeated as ref 28. It appears the authors have inadvertently used the same ref with two different numbers, either remove and change the numbering or replace with correct reference.Reviewer #3: The study by Sutter et al is focused on dissecting capsid uncoating steps in the infectious pathway of adeno-associated virus serotype 2 in mammalian cells. This step is critical for subsequent events in the AAV life cycle such as second strand synthesis and transcription. The study is technically sound and the authors skillfully utilize fluorescence imaging techniques and quantitation to dissect subtle shifts in AAV biology under different pharmacologically manipulated host cell conditions. Review of the existing literature and data interpretation are woven together eloquently and the overall manuscript is well written. Major strengths lie in the technical execution and quality of the study. Significant weaknesses are identified with regard to study parameters and overall descriptive nature of the findings. No significant new mechanistic insight is gleaned from the data. Major concerns include:1. The use of fibroblasts as a benchmark for studying AAV biology is a concern. In the gene therapy context, it is well understood that most AAV serotypes suffer significant bottlenecks in the infectious pathway(s) pertinent to fibroblasts (e.g. inefficient endosomal trafficking pathways and proteasomal degradation). It is unlikely that the findings are pertinent to AAV capsid biology in general or in the context of pertinent cells such as neurons, cardiomyocytes or hepatocytes as examples.2. The immunofluorescence based image analysis raises several significant concerns. First, the A20 antibody against the intact AAV2 capsid does not appear to recognize the capsid following conformational changes upon nuclear entry (e.g., multiple J Virol studies from Kleinschmidt, Asokan, Muzyczka and other groups). Thus the lack of A20 signal is not indicative of fully uncoated capsids. In addition, the A1/A69 antibodies against the VP1/2 domains exhibit high levels of background/cross-reactive staining in IF studies and are more reliable for western blot analysis. Thus, the use of fluorescently labeled AAV capsids is generally more reliable (e.g., Xiao and Samulski, Johnson and Samulski). In particular, the ability to recover fully infectious AAV particles purified from nucleoli post-infection has been reported (Johnson and Samulski, 2009).3. Several key steps identified such as the need for endosomal escape, effects of BafA1 on AAV2 infection have been extensively mapped by other groups, these findings do not provide any new/additional insight. Further, the impact of proteasomal inhibitors, hydroxyurea etc on the fate of AAV in the nucleus have been reported in significant detail (e.g., Johnson and Samulski). This is especially critical for the authors to consider since drugs such as Actinomycin D disrupt nucleolar organization, while proteasome inhibitors leave the nucleolus intact (both can be utilized to block transcription). Yet, both appear to result in increased infectivity/transduction. This dichotomy needs to be resolved.4. Lastly, while the findings related to cell cycle impact on AAV-host nucleus interactions are interesting, little mechanistic insight can be gleaned from these findings. Are there nucleolar factors that mediate AAV capsid uncoating? For instance, Nicolson and Samulski show the need for nuclear import factors, while Johnson and Samulski show that similar to effects observed with proteasome inhibition, siRNA-mediated knockdown of nucleophosmin potentiated nucleolar accumulation and increased transduction 5- to 15-fold. Parallel to effects from hydroxyurea, knockdown of nucleolin mobilized capsids to the nucleoplasm and increased transduction 10- to 30-fold. A somewhat related concern that follows is that since wtAAV is being utilized, the authors do not provide transduction data. This is a critical missing piece of mechanistic data, since it is unclear whether disrupting the nucleolus/cell cycle influences uncoating and consequently, infectivity/transduction. For instance, how would the authors deconvolute the interplay between Thymidine and ActD treatments influence infectivity/transduction given ActD mediates both nucleolar reorganization and blocks transcription?Reviewer #4: The manuscript by Sutter et al. addresses the question how Adeno-associated virus type 2 (AAV2) fully uncoat and liberate their genome in the nucleus of infected cells. This is an important and timely topic because AAVs are increasingly and successfully used as gene therapy vectors. Knowledge that improves our understanding of AAV transduction thus may influence vector development or application. In addition, how virus uncoating is achieved upon cell entry is still not very well known.The presented work uses quantitative single cell imaging analysis to investigate the subcellular distribution of intact AVV2 capsids, capsid proteins (for disassembled virions) and AVV2 genomes (using FISH analysis for free or partially exposed genomes) over time and under different physiological conditions. They find that AAV2 virions partially exposing the viral genome can be found in the cytosol and accumulate over time in the nucleolus. They further show that the nucleolus is also the place where AAV2 virions fully uncoat, probably in a manner that involves structural and/or functional reorganization of the nucleolus.This work is technically well executed and the data presentation is mostly clear. However, the conclusions that can be drawn are limited by the descriptive nature of the data and I struggle at times to follow the authors line of argument. The uncoating mechanism in the nucleolus is not addressed.I have the following comments;1- The quantification in Fig. 1B/C indicates that the ratio of partially uncoated particles (capsid+DNA+) increases in the cytosol as well as in the nucleus over time. How was this ratio determined as I find it hard to identify individual capsids/DNA signals especially in the nucleolus at later time points?2- The authors argue that their data show a partial disassembly step taking place in the cytosol (line 473-476), which requires acidification (Fig3). Is the bafilomycin treatment not rather affecting AAV2 uptake/endosome penetration/escape (bafilomycin treated cells seem to have less overall cell associated virions in the examples shown) ? I am also surprised to see that the endosome specific 76HD/AN mutant shows large scale partial disassembly (Fig. S1), which in my opinion argues more for an intra endosomal/endsome penetration associated partial disassembly. Could you please comment why you think this is a cytosolic step? Please provide experimental evidence for a cytosolic localization of the partial disassembled virions.3- How are the two observed virion pools (capsid+DNA+ vs. capsid+DNA-) in the two compartments (nucleus and cytosol) functionally connected? I wonder if the partially disassembled pool in the cytosol contributes to the nucleolar pool. If this is the case are the authors suggesting that both, partially disassembled virions (capsid+DNA+) and intact virions (capsid+DNA-) can be nuclear import substrates as both forms are present in the cytosol as well as in the nucleolus? Would this not imply that partial disassembly can also take place in the nucleolus, especially in light of their findings that all virions fully uncoat in the nucleolus ?4- The observation of some cells displaying nucleoli full of genomes but devoid of virions (Fig.4) and of cells with VP1/2/3 specific signals but absence of virion signals (Fig.5) is intriguing. Fig4 and 5 should be redone as time point experiment in cycling cells and the phenotypes should be quantified. One would expect that if the phenotypes I-III are consecutive steps that this is reflected over time and the number of capsids should diminish and the VP1/2/3 signal should increase. A similar kinetic in resting cells or contact inhibited cells should result in an uncoating defect.5- Fig. 8 Why is there so much more DNA in the cytosol when using ActD (Fig.8A) ? Would that also be the case in absence of the Thymidine block ? How was the nucleolar area determined if ActD treatment redistributes the marker ?**********Part II – Major Issues: Key Experiments Required for AcceptancePlease use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".Reviewer #1: -Fig.1: the observations by immuno-FISH should be correlated with a kinetic analysis of the accumulation of viral DNA (total and packaged) as well as the capsids in the cytoplasm/nucleoplasm and nucleolus after cell fractionation . It would be also important to know if any viral RNA can be detected. Indeed, even if wt AAV2 cannot replicate in the absence of helper virus, a low level of Rep RNA may be produced, at least at the onset of infection.- Fig.1: several AAV DNA-positive/capsid-negative spots are visible in the cytoplasm of the cells. Are these signals still visible after treatment of cells with nucleases (DNase or RNAse)? And how does this treatment affect the capsid-positive/DNA-positive signals?- Fig.4: does the capsid-negative/AAV DNA-positive signal increase over time?- Release of viral DNA could occur by a physiological uncoating process or following disruption of the capsids, both mechanisms not necessarily resulting in the same outcome in terms of viral establishment. Does the capsid-negative nucleolar AAV2 DNA signal correlate with the formation of double-stranded circular episomes?- Proteasome inhibitors have been shown to increase the accumulation of capsids in the nucleolus as well as transduction with rAAV vectors. What is the effect of this treatment on the FISH signals detected in the nucleolus?- Similarly, previous studies haves shown that siRNA against nucleolin and B23 alter the translocation of the capsids from the nucleolus to nucleoplasm and transduction with AAV vectors. How do these treatments affect the presence of capsid-negative AAV2 DNA in the nucleolus and the formation of double-stranded circular episomes?- Since the authors are using primary fibroblast, growth arrested cells should be used instead of artificially-arrested cells to examine the fate of the capsids/VP proteins and viral DNA in the nucleolus of non-dividing cells. This would also allow to keep the cells in culture for longer periods to perform kinetic analyses.Reviewer #2: No major issuesReviewer #3: N/AReviewer #4: - Please provide experimental evidence that partial disassembly of virions (capsid+DNA+) occurs in the cytosol or change the statement- Experiments in Fig4 and 5 should be redone as time point experiment in cycling cells and the phenotypes should be quantified.**********Part III – Minor Issues: Editorial and Data Presentation ModificationsPlease use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.Reviewer #1: - Lines 82/94/455 References to previous studies showing accumulation of AAV capsid in the nucleolus are not appropriate. The references cited by the authors (Ref.14 and 15) refer to studies showing the interaction of the capsid with nucleolin and B23. But several previous studies had documented the presence of capsid in the nucleolus.- Fig.3: why inhibition with Bafilomycin is not complete?- Fig.3C and line 199: nuclear or nucleolar AAV2 import or counts? Why counting only capsid-positive signals and not, as before capsid-positive/DNA-positive signals?- Fig8A: actinomycin D treatment seems to equally increase the AAV2 DNA signal in cytoplasm. How do the authors explain this? Actinomycin D can inhibit the intracellular transport of viral capsids as shown for Influenza virus. Could this explain the lower AAV2 capsid signal observed in the nucleolus?-Fig.8A: despite the low level of fibrillarin staining, nucleoli are still visible by DAPI staining. Please explain.- Line 473: uncoating or just remodeling? Extrusion of the VP1/2 N-ter may provide access to small DNA probes or simply labeled nucleotides.- FigS2 and line 250: a negative correlation between capsid (A20) signal and individual VP staining is not evident in this image. Please explain.- Fig.S5: decrease of cells in G1 and/or increase in G2 upon nocodazole treatment is much less evident by flow cytometry than CLSM. Please explain.- line 529: The statement that AAV vectors do not efficiently transduce non-dividing cells is not correct. Transduction of non-dividing by AAV vectors can efficiently occurs even in vitro (provided that the receptor is present) but with a different kinetics than that observed on dividing cells.Reviewer #2: No minor issuesReviewer #3: N/AReviewer #4: - please note in each legend if the images are confocal midsections or if they are Z-projections. An outline of the nucleus in addition to the nucleolus might help. This is important to appreciate the localization of objects inside/on-top or below of the nucleus.- Please make sure that Figure numbers are mentioned in the text in the order they appear (e.g. Fig 1C, Fig.4C appear out of order)- Fig9 please label what is shown in top vs bottom line (same for FigS9), graph and graph legend don’t match (light color for VP, no light grey color in graph) (same for FigS9)**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: Yes: R Jude Samulski PhDReviewer #3: NoReviewer #4: NoFigure Files:While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at .Data Requirements:Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.Reproducibility:To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols9 May 2022Submitted filename: Rebuttal letter_final.docxClick here for additional data file.8 Jun 2022Dear Dr. Fraefel,We are pleased to inform you that your manuscript 'Adeno-associated virus type 2 (AAV2) uncoating is a stepwise process and is linked to structural reorganization of the nucleolus' has been provisionally accepted for publication in PLOS Pathogens.Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.Best regards,Matthew D Weitzman, Ph.D.Guest EditorPLOS PathogensKarl MüngerSection EditorPLOS PathogensKasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158XMichael MalimEditor-in-ChiefPLOS Pathogens
orcid.org/0000-0002-7699-2064
***********************************************************The reviewers all appreciated the attention and modifications incorporated into the revised manuscript. I encourage the authors to attend to the additional minor concerns raised by Reviewers 1 and 3 when they submit the final version of this manuscript in order to clarify even further the data and interpretations.Reviewer Comments (if any, and for reference):Reviewer's Responses to QuestionsPart I - SummaryPlease use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.Reviewer #1: Altogether, this work convincingly shows that AAV2 capsids massively accumulate in the nucleolus, where viral/vector DNA can be released and detected in high amounts, and that, in cycling cells, release of viral/vector DNA can be enhanced following disruption of the nucleolus occurring during cell division. What remain unclear is the fate of this nucleolar DNA and its links with the establishment of functional episomes. In other words, is unpackaged nucleolar AAV DNA solely responsible for the establishment of the infection, presumably after delocalization to the nucleoplasm, or are functional episomes produced by other less abundant uncoating events occurring outside of the nucleolus? The conclusion that “complete” uncoating of the AAV genome occurs exclusively in the nucleolus and that this process requires cell division completely disregards other possible interpretations and hypotheses that cannot be excluded in the absence of additional functional data (presence of circular episomes, RNA etc..).Reviewer #2: Authors addressed all comments.Reviewer #3: This revision provides compelling evidence of nucleolar reorganization correlating with AAV uncoating/genome release. The authors should be commended for the rigor and depth of experiments conducted to dissect the aforementioned phenomena. That being said, several gaps remain in tying the observations together. In particular, the authors could consider addressing the following. (1) the observed signals in endosome could simply arise from capsids being subjected to protease degradation and hence on a "dead end" path. Blocking with BafA1 also alters endosomal trafficking and cannot be necessarily be attributed to the beginning of uncoating in the endosome - overall the notion that uncoating begins in the endosome appears somewhat counterintuitive for a DNA virus that needs to deliver its genome to the nucleus. (2) the role of Golgi accumulation of AAV particles (MTOC) prior to nuclear entry is unaddressed. This has now been implicated as critical path for transduction by several groups and the connection or lack thereof to cell cycle/uncoating has not been discussed (one suggestion is that the manuscript might benefit by restricting the discussion to post-nuclear entry events rather than post-uptake) and (3) what are implications for non-dividing, terminally differentiated cells such as neurons? AAV clearly transduces these cell types with high efficiency in vivo - it is unclear how cell cycle mediated nucleolar reorganization might play a role in uncoating in these scenarios.Reviewer #4: The authors have done a careful revision addressing all my concerns and answered my questions. The new time course data (fig. S12) further strengthen their initial conclusions. The revised version reads very nice and the experiments are well executed. I have no further requests.**********Part II – Major Issues: Key Experiments Required for AcceptancePlease use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".Reviewer #1: Two points deserve to be clearly discussed:1. While it is evident that a massive accumulation of capsids and/or DNA occurs in the nucleolus, in several images, DNA+/capsid+or- signals are also visible in the nucleoplasm. For instance, in Fig.1, capsid+/DNA+ signals are visible in the nucleoplasm starting from 3 h pi followed by capsid-/DNA+ signal at 24h pi. Similar signals are visible in FigS2, FigS4, Fig.4 (panel I). The same observation can be made regarding the presence of non-assembled VP proteins and AAV DNA (Fig.6). The presence of these signals is never mentioned nor measured in the whole manuscript. While I understand that such low signals may be difficult to quantify, their presence suggests two possible hypotheses: either viral/vector DNA is uniquely uncoated in the nucleolus to subsequently move/leak into the nucleoplasm, or uncoating can also independently occur in the nucleoplasm, raising the fundamental question of which pathway (nucleolar our nucleoplasmic) leads to the formation of functional viral/vector episomes. The efforts made by the authors to show the functionality of the “nucleolar pool of DNA (Figure 5 and S6, respectively) does not, in my opinion, convincingly answer this question. For instance, the linear ds form observed at 48 pi by Southern blot (Fig.5) and following transfection (FigS6), could result either from second-strand synthesis (as claimed but not demonstrated by the authors) or simply from annealing of ssDNA genomes, a phenomenon that could be enhanced by the high concentration of ss genomes in the nucleolus and that can also “artificially” occur after isolation of ssAAV DNA. In addition, even if other forms than ssDNA are not visible in the DNA pool extracted from the nucleoplasm at 48h pi, this does not exclude that they may arise following a longer kinetics.2. The observation that capsid disassembly is enhanced following disruption of the nucleolus is certainly relevant for cycling cells but how does this explain the capacity of rAAV vectors to transduce terminally differentiated, and therefore growth arrested, cells? If nucleolar disassembly is absolutely required for transduction then AAV vectors should be unable to transduce cells such as neurons, myotubes, etc…Here again, an hypothesis could be that in such cells uncoating may also occur in the nucleoplasm with a different kinetics of release that does not depend on nucleolar disintegration.Reviewer #2: (No Response)Reviewer #3: No further experiments are required. The authors efforts to address this reviewer's concerns are deeply appreciated.Reviewer #4: NA**********Part III – Minor Issues: Editorial and Data Presentation ModificationsPlease use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.Reviewer #1: - The authors frequently use the term of “complete uncoating” (see for example lines 385 and 413) without specifying that most of the analyses concerns only the nucleolus.- Fig.2A were the virions processed exactly as cells (including the permeabilization step?)-Fig5. The Southern blot suggests the amount of sssDNA in the nucleolus and the nucleoplasm are similar at 48H pt. Is this also visible by FISH?- FigS5C. WB: Is this the nuclear or nucleoplasmic fraction? A marker specific of the nucleoplasmic fraction should be used to show the efficacy of nucleoli purification.- FigS12A: please provide evidence that the cells are growth-arrested.- Fig.8B and C, Fig.10B, FigS12B and C: please indicate on the graphs if these measures concern the whole nucleus or exclusively the nucleolusReviewer #2: (No Response)Reviewer #3: N/AReviewer #4: NA**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: NoReviewer #3: NoReviewer #4: No1 Jul 2022Dear Dr. Fraefel,We are delighted to inform you that your manuscript, "Adeno-associated virus type 2 (AAV2) uncoating is a stepwise process and is linked to structural reorganization of the nucleolus," has been formally accepted for publication in PLOS Pathogens.We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication.The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly.Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens.Best regards,Kasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158XMichael MalimEditor-in-ChiefPLOS Pathogensorcid.org/0000-0002-7699-2064
Authors: Amit C Nathwani; Ulreke M Reiss; Edward G D Tuddenham; Cecilia Rosales; Pratima Chowdary; Jenny McIntosh; Marco Della Peruta; Elsa Lheriteau; Nishal Patel; Deepak Raj; Anne Riddell; Jun Pie; Savita Rangarajan; David Bevan; Michael Recht; Yu-Min Shen; Kathleen G Halka; Etiena Basner-Tschakarjan; Federico Mingozzi; Katherine A High; James Allay; Mark A Kay; Catherine Y C Ng; Junfang Zhou; Maria Cancio; Christopher L Morton; John T Gray; Deokumar Srivastava; Arthur W Nienhuis; Andrew M Davidoff Journal: N Engl J Med Date: 2014-11-20 Impact factor: 176.079
Authors: Joseph M Kelich; Jiong Ma; Biao Dong; Qizhao Wang; Mario Chin; Connor M Magura; Weidong Xiao; Weidong Yang Journal: Mol Ther Methods Clin Dev Date: 2015-12-02 Impact factor: 6.698