| Literature DB >> 35814257 |
Dongcheng Liu1,2,3,4, Hongguang Liu5, Jiadi Gan6, Shinuan Zeng3, Fuhua Zhong3, Bin Zhang3, Zhe Zhang3, Siyu Zhang3, Lu Jiang3, Guangsuo Wang7, Yixin Chen8, Feng-Ming Spring Kong9, Wenfeng Fang6, Lingwei Wang1.
Abstract
Non-small cell lung carcinoma (NSCLC) patients who initially received tyrosine kinase inhibitor (TKI) therapy often acquired resistance via multiple complex mechanisms. The amplification of FGF3/4/19/CCND1 on chromosome 11q13 was found in many cancers with TKI resistance. However, the role of these amplifications in TKI-resistant NSCLC remains uncovered. Here, we generated the FGF3/4/19/CCND1 amplification model in the NSCLC cell lines PC-9 and HCC827. Upregulation of FGF3/4/19/CCND1 strongly promoted cell proliferation and gefitinib resistance in NSCLC cells. To find out the potential therapeutic strategies, we screened the combination of inhibitors against the FGF/FGFR signaling pathway and the CCND1/CDK4 complex and revealed that gefitinib combined with LY2874455 and abemaciclib exhibited the most effective inhibition of resistance in vitro and in vivo. Mechanistically, FGFs/CCND1 activated the MAPK pathway, which was abolished by the combination drugs. Our study provides a rationale for clinical testing of dual targeting FGFR and CCND1 with LY2874455 and abemaciclib in NSCLC patients who harbored FGF3/4/19/CCND1 amplification.Entities:
Keywords: FGF3/4/19/CCND1 amplification; LY2874455; NSCLC; abemaciclib; gefitinib resistance
Year: 2022 PMID: 35814257 PMCID: PMC9260114 DOI: 10.3389/fphar.2022.918317
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
Clinicopathological characteristics of patients with FGF3/4/19/CCND1 amplification among 285 TKI-resistance patients
| No. of patients (%) | |||
|---|---|---|---|
| First- or second-generation EGFR-TKIs resistance | Third-generation EGFR-TKIs resistance | Total | |
| Age (years) | |||
| ≥60 | 5 (62.5%) | 2 (40.0%) | 7 (53.8%) |
| <60 | 3 (37.5%) | 3 (60.0%) | 6 (46.2%) |
| Gender | |||
| Male | 3 (37.5%) | 1 (20.0%) | 4 (30.8%) |
| Female | 5 (62.5%) | 4 (80.0%) | 9 (69.2%) |
| Smoking | |||
| Smoker | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) |
| Non-smoker | 8 (100.0%) | 5 (100.0%) | 13 (100.0%) |
| Sample type | |||
| Tumor tissue | 3 (37.5%) | 1 (20.0%) | 4 (30.8%) |
| ctDNA | 1 (12.5%) | 3 (60.0%) | 4 (30.8%) |
| Others* | 4 (50.0%) | 1 (20.0%) | 5 (38.5%) |
| TNM stage | |||
| M1a/b | 4 (50.0%) | 1 (20.0%) | 5 (38.5%) |
| M1c | 4 (50.0%) | 4 (80.0%) | 8 (61.5%) |
| Total |
|
|
|
*Pleural effusion or cerebrospinal fluid or NA.
Primers used for real-time quantitative PCR.
| Gene | Sequences (5′ → 3′) (forward) | Sequences (5′ → 3′) (reverse) | GenBank accession number |
|---|---|---|---|
| FGF3 | GGCGTCTACGAGCACCTTG | CACCTCCACTGCCGTTATCTC | NM_005247.4 |
| FGF4 | GGGCGTGGTGAGCATCTT | TTGTAGGACTCGTAGGCGTTG | NM_002007.4 |
| FGF19 | TCTCCCTGAGCAGTGCCAAAC | TCCGGTGACAAGCCCAAAT | NM_005117.3 |
| CCND1 | GGTGGCAAGAGTGTGGAG | CCTGGAAGTCAACGGTAGC | NM_053056 |
| GAPDH | TGACTTCAACAGCGACACCCA | CACCCTGTTGCTGTAGCCAAA | NM_001256799.3 |
FIGURE 1FGF3/4/19/CCND1 promotes gefitinib resistance. (A,B) PC-9 cells were transduced with FGF3/4/19/CCND1(4X) or empty vector (negative control, NC) by lentivirus transduction. The gene expressions were confirmed by qRT-PCR (A) and Western blot (B). Error bars indicated standard deviation (SD), n = 3. (C) Cell viability assay. PC-9 cells were seeded in 96-well plates (2,000 cells/well). CCK8 assay was applied to measure the cell viability (p values reflected comparison to the control samples of indicated time points.*p < 0.05. **p < 0.01). (D,E) HCC827 cells were transduced with FGF3/4/19/CCND1(4X) or empty vector (negative control, NC) by lentivirus transduction. The gene expressions were confirmed by qRT-PCR (D) and Western blot (E). Error bars indicated SD, n = 3. (F) Cell viability assay. HCC827 cells were seeded in 96-well plates (2,000 cells/well). CCK8 assay applied in indicated time to measure the cell viability (p values reflect comparison to the control samples of indicated time points.*p < 0.05. **p < 0.01). (G) The inhibition rate of gefitinib in PC-9 cells was measured by CCK8 assay following gefitinib treatment for 72 h. Each experiment was performed in triplicate. (H) Colony formation assay. Cells were treated with DMSO or gefitinib for 14 days. The remaining cells were stained with 0.1% crystal violet and photographed. Each experiment was performed in triplicate. Representative wells were shown. (I) Colonies of remaining cells were counted. Error bars indicated SD. (J) Inhibition rate of gefitinib in HCC827 cells was measured by CCK8 following gefitinib treatment for 72 h. Each experiment was performed in triplicate. (K) Colony formation assay. Cells were treated with DMSO or gefitinib for 14 days. The remaining cells were stained with 0.1% crystal violet and photographed. Each experiment was performed in triplicate. Representative wells were shown. (L) Colonies of remaining cells were counted. Error bars indicated SD (***p < 0.001, student’s t-test).
FIGURE 2Screening of FGFR inhibitors for overcoming gefitinib resistance induced by FGFs/CCND1. (A) The structural formulae of FGFR inhibitors. (B,C) PC-9-4X and HCC827-4X cells were treated with gefitinib combined with each FGFR inhibitor for 72 h. The inhibition rate was detected by the CCK8 assay. Error bars indicate SD.
FIGURE 3The combination of gefitinib/LY2874455/abemaciclib reverses the gefitinib resistance induced by FGFs/CCND1 in vitro. (A) The structural formulae of inhibitors target to CDK4/CCND1 complex. (B) PC-9-4X Cells were treated with LY2874455 and gefitinib in combination with different CDK4 inhibitors for 72 h to measure the inhibition rate by CCK8. Error bars represented SD. (C) HCC827-4X cells were treated with LY2874455 and gefitinib in combination with different CDK4 inhibitors for 72 h to measure inhibition rate by CCK8. Error bars represented SD. (D) Crystal violet staining of PC-9-4X or HCC827-4X cell lines after treatment with DMSO or the indicated drugs for 14 days. (E) The number of stained cells in crystal violet staining in (D). Error bars represented SD (p-values reflected comparison to the control samples. *p < 0.05. **p < 0.01. ***p < 0.001, one-way ANOVA, with Tukey’s test).
FIGURE 4The activity of the EGFR, mTOR, and MAPK in response to gefitinib (10 nM) and/or combined treatment with LY287445 (10 nM) and/or abemaciclib (10 nM) in PC-9-NC and PC-9-4X cells. The cells were treated for 24 h before the Western blot analysis. GAPDH was used as a loading control.
FIGURE 5The combination of gefitinib/LY2874455/abemaciclib reverses the gefitinib resistance induced by FGFs/CCND1 in vivo. (A) Mice bearing PC-9-4X were injected twice a week with gefitinib (100 mg/kg) combined with LY2874455 (3 mg/kg) or abemaciclib (50 mg/kg) or PBS by oral administration, and tumor growth was monitored for 2 weeks during treatments (*** p < 0.001, two-way ANOVA, with Tukey’s test). Profiles of tumor growth during the drug treatment are shown. For each treatment group, data are presented as mean tumor volume (mm3) ± SD, n = 6. (B) Tumors resected from each group with indicated treatment at the end of experiments are shown n = 6. (C) Tumor volume was measured using calipers. Mean ± SD tumor volumes on day 12 are shown. Each group contained 6 mice (ns, p > 0.05. ***p < 0.001, one-way ANOVA, with Tukey’s test). (D) Immunohistochemical staining with Ki-67 antibodies in xenograft tumors from each group. Scale bar, 50 mm.