| Literature DB >> 35814238 |
Siwen Zheng1,2, Housheng Zheng1,2, Rui Zhang1,2, Xiangmin Piao1,2, Junnan Hu2, Yanzhu Zhu3,4, Yingping Wang1,2.
Abstract
Ginsenoside Rb2 (Rb2), a fundamental saponin produced and isolated from ginseng (Panax ginseng C.A. Meyer), has a wide range of biological actions. The objective of this investigation was to see if ginsenoside Rb2 has any immunomodulatory properties against cyclophosphamide (CTX)-induced immunosuppression. For the positive control group, levamisole hydrochloride (LD) was used. We discovered that intraperitoneal injection of Rb2 (5, 10, 20 mg/kg) could relieve CTX-induced immunosuppression by enhanced immune organ index, reduced the pathological characteristics of immunosuppression, promoted natural killer (NK) cells viability, improved cell-mediated immune response, boosted the IFN-γ (Interferon-gamma), TNF-α (Tumor necrosis factor-alpha), IL-2 (Interleukin-2), and IgG (Immunoglobulin G), as well as macrophage activity like carbon clearance and phagocytic index. Rb2 significantly elevated the mRNA expression of IL-4 (Interleukin-4), SYK (Tyrosine-protein kinase-SYK), IL-2, TNF-α, and IL-6 (Interleukin-6) in the spleen of CTX-injected animals. Molecular docking results showed that Rb2 had excellent binding properties with IL-4, SYK, IL-2, TNF, and IL-6, indicating the target protein might be strongly correlated with the immunomodulatory effect of Rb2. Taken together, ginsenoside Rb2 can improve the immune function that is declined in CTX-induced immunosuppressed mice, the efficacy maybe due to the regulation of related cytokine and mRNA expression.Entities:
Keywords: cyclophosphamide; ginsenoside Rb2; immune regulation; immunosuppression; side effect
Year: 2022 PMID: 35814238 PMCID: PMC9263391 DOI: 10.3389/fphar.2022.927087
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
Primer sequences (5′–3′) used for qRT-PCR.
| Gene | Forward sequence | Reverse sequence |
|---|---|---|
| IL-2 | TACAGCGGAAGCACAGCAG | CGCAGAGGTCCAAGTTCATC |
| IL-4 | AACGAGGTCACAGGAGAAGG | TGGAAGCCCTACAGACAAGC |
| IL-6 | CGGAGAGGAGACTTCACAGAG | CATTTCCACGATTTCCCAGA |
| SYK | CAGCTGGAGGATCGGAGAAC | CCATGGAACCAGGGCATCTT |
Effect of ginsenoside Rb2 on body weight and spleen indices in mice (mean ± S.D., n = 10).
| Group | Dose (mg/kg) | Initial body weight (g) | Final body weight (g) | Spleen index (mg/g) |
|---|---|---|---|---|
| Normal | - | 26.77 ± 1.64 | 28.95 ± 1.16 | 5.53 ± 0.91 |
| Model | - | 27.00 ± 1.67 | 23.81 ± 2.66## | 2.14 ± 0.31## |
| Positive | 100 (LD) | 27.92 ± 1.10 | 26.89 ± 1.50* | 3.46 ± 0.89** |
| Low-Rb2 | 5 | 26.58 ± 1.57 | 23.99 ± 2.20 | 3.00 ± 0.89* |
| Middle-Rb2 | 10 | 26.84 ± 1.93 | 26.92 ± 1.49* | 3.57 ± 0.66** |
| High-Rb2 | 20 | 27.38 ± 1.98 | 26.12 ± 2.43 | 3.86 ± 0.50** |
FIGURE 1Histopathology observation of spleen. (A) ×100, (B) ×100, (C) ×400.
FIGURE 2Effect of ginsenoside Rb2 on ConA- and LPS- induced splenocyte proliferation, on NK cells activity, carbon clearance capacityin and the cytokines in CTX induced immunosuppressive mice. (A), ConA-induced splenocyte proliferation; (B), LPS-induced splenocyte proliferation; (C), NK cells activity; (D,E), carbon clearance capacityin; (F), IFN-γ; (G), TNF-α; (H), IgG; (I), IL-2. The data was expressed as mean ± S. D (n = 20). ##p < 0.01, compared to Normal. *p < 0.05; **p < 0.01, compared to Model.
FIGURE 3The relative gene expression of cytokines in spleen. (A), IL-2; (B), IL-4; (C), IL-6; (D), SYK; (E), TNF-α. ##p < 0.01, compared to Normal. **p < 0.01, compared to Model. (F) Docking of Rb2 (yellow) into the binding site of mouse IL-2 (PDB code: 4yue, green); (G) Docking of Rb2 (yellow) into the binding site of mouse IL-4 (PDB code: 2b8u, green); (H) Docking of Rb2 (yellow) into the binding site of mouse IL-6 (PDB code: 2l3y, green); (I) Docking of Rb2 (yellow) into the binding site of mouse SYK (PDB code: 2mc1, green); (J) Docking of Rb2 (yellow) into the binding site of mouse TNF (PDB code: 2tnf, green).