| Literature DB >> 35814008 |
Qiang Guo1, Chen-Yang Liu1, Ling-Jie Zheng1, Shang-He Zheng1, Ya-Xing Zhang1, Su-Ying Zhao1,2, Hui-Dong Zheng1,2, Li-Hai Fan1,2, Xiao-Cheng Lin1.
Abstract
D-Allulose is an ultra-low calorie sweetener with broad market prospects. As an alternative to Izumoring, phosphorylation-dephosphorylation is a promising method for D-allulose synthesis due to its high conversion of substrate, which has been preliminarily attempted in enzymatic systems. However, in vitro phosphorylation-dephosphorylation requires polyphosphate as a phosphate donor and cannot completely deplete the substrate, which may limit its application in industry. Here, we designed and constructed a metabolic pathway in Escherichia coli for producing D-allulose from D-fructose via in vivo phosphorylation-dephosphorylation. PtsG-F and Mak were used to replace the fructose phosphotransferase systems (PTS) for uptake and phosphorylation of D-fructose to fructose-6-phosphate, which was then converted to D-allulose by AlsE and A6PP. The D-allulose titer reached 0.35 g/L and the yield was 0.16 g/g. Further block of the carbon flux into the Embden-Meyerhof-Parnas (EMP) pathway and introduction of an ATP regeneration system obviously improved fermentation performance, increasing the titer and yield of D-allulose to 1.23 g/L and 0.68 g/g, respectively. The E. coli cell factory cultured in M9 medium with glycerol as a carbon source achieved a D-allulose titer of ≈1.59 g/L and a yield of ≈0.72 g/g on D-fructose.Entities:
Keywords: D-allulose; Escherichia coli; cell factory; fermentation; metabolic engineering
Year: 2022 PMID: 35814008 PMCID: PMC9257026 DOI: 10.3389/fbioe.2022.947469
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
FIGURE 1Metabolic pathways in E. coli cell factory for production of D-allulose from D-fructose via phosphorylation-dephosphorylation.
The strains and plasmids used in this study.
| Name | Relevant characteristics | References |
|---|---|---|
| Strains | ||
| | F−
| Trans gen biotech |
| |
| BeNa culture collection |
| |
| This study |
| |
| This study |
| |
| This study |
| |
| This study |
| |
| This study |
| |
| This study |
| |
| This study |
| |
| This study |
| |
| This study |
| |
| This study |
| |
| This study |
| Plasmids | ||
| pRSFDuet-1 | Vector for protein expression under control of T7 promoter, kanR | Novagen |
| pETDuet-1 | Vector for protein expression under control of T7 promoter, AmpR | Novagen |
| pRSFDuet- | pRSFDuet-1 carrying | This study |
| pRSFDuet- | pRSFDuet-1 carrying | This study |
| pRSFDuet- | pRSFDuet-1 carrying | This study |
| pRSFDuet- | pRSFDuet-1 carrying | This study |
| pETDuet- | pETDuet-1 carrying | This study |
| pRSFDuet- | pRSFDuet-1 carrying | This study |
| pKD46, pKD13, pCP20 | λ red recombination system |
|
The primers used in this study.
| Name | Primer sequence (5′→3′) | Description |
|---|---|---|
| Plasmid construction | ||
| | CGGGATCCGATGTTTAAGAATGCATTTGCTAAC | Clone and insert |
| | CCCAAGCTTTTAGTGGTTACGGATGTACTC | |
| | GGAATTCCATATGGTGCGTATAGGTATCG | Clone and insert |
| | GGGGTACCTTACTCTTGTGGCCATAACCACGC | |
| | GGAATTCCATATGAAATACACCGTTTACCTGTTCG | Clone and insert |
| | GGGGTACCTTACAGCGGGCAACCAGATTTATCTTC | |
| | CATGCCATGGGCATGAAAATCTCCCCCTC | Clone and insert |
| | CCCAAGCTTTTATGCTGTTTTTGCATGAG | |
| | CCGCTCGAGCCTGTAGAAATAATTTTGTTTAACTTTAATAAGGAGATATACCATGAGCTTATCTGAAAG | Clone and insert |
| | CCGCCTAGGTTATAACTGTGGACCAGCC | |
| Gene deletion | ||
| | CTGACAGCAGGAGAGGCATAATGAAAACGCTGCTGATTATTGACGCTAATATTCCGGGGATCCGTCGACC | Delete |
| | GCCCTGTAACACACCTTTTATTACGCTGCTTTCGCTACTGCGTCCACTTCGTGTAGGCTGGAGCTGCTTCG | |
| | GTTCAGAGGTAGTCATGATTAAGAAAATCGGTGTGTTGACAAGCGGCGGTTGTGTAGGCTGGAGCTGCTTCG | Delete |
| | CGAAATCATTAATACAGTTTTTTCGCGCAGTCCAGCCAGTCACCTTTGAAATTCCGGGGATCCGTCGACC | |
| | CTGATTCGGTGCCAGACTGAAATCAGCCTATAGGAGGAAATGATGGTACGTATCTGTGTAGGCTGGAGCTGCTTCG | Delete |
| | GTTGGTGATGATTCCCCCAATGCTGGGGGAATGTTTTTGTTAGCGGGAAAGGATTCCGGGGATCCGTCGACC | |
FIGURE 2Expression and enzyme assay of A6PP and AlsE. (A) SDS-PAGE analysis. Marker (lane 1 and 4), E. coli (control) (lane 2 and 5), E. coli (a6PP) (lane 3), E. coli (alsE) (lane 6). (B) Conversion of D-fructose to D-allulose using crude A6PP or a mixture of crude A6PP and AlsE. The reaction was carried out in Tris-HCl buffer (pH 7.5, 50 mM) containing 2.60 g/L fructose-6-phosphate at 37°C for 30 min. Error bars, SD, n = 3. (C) HPLC analysis for confirming the generation of D-allulose by use of A6PP and AlsE mixture.
FIGURE 3Production of D-allulose by E. coli co-expressing AlsE and A6PP. E. coli (alsE, a6PP) was cultured in LB medium with 4.00 g/L D-fructose at 37°C. Error bars, SD, n = 3.
FIGURE 4Reprogramming of fructose transport pathways in E. coli to enhance D-allulose production. E. coli cells were cultured in LB medium with 4.00 g/L D-fructose at 37°C. (A) E. coli (alsE, a6PP, ΔfruA), (B) E. coli (alsE, a6PP, ptsG-F, mak, ΔfruA), (C) E. coli (alsE, a6PP, ptsG-F, mak, ΔfruA) with 100 mM potassium phosphate. Error bars, SD, n = 3.
FIGURE 5Elimination of the pathways phosphorylating fructose-6-phosphate. E. coli cells were cultured in LB medium with 4.00 g/L D-fructose and 100 mM potassium phosphate at 37°C. (A) E. coli (alsE, a6PP, ptsG-F, mak, ΔfruA, ΔpfkA), (B) E. coli (alsE, a6PP, ptsG-F, mak, ΔfruA, ΔpfkA, ΔpfkB). Error bars, SD, n = 3.
FIGURE 6Improvement of ATP supply in cell factory. (A) Intracellular ATP level, 1) E. coli (ΔfruA, ΔpfkA, ΔpfkB), 2) E. coli (pckA, ΔfruA, ΔpfkA, ΔpfkB), 3) E. coli (pckA, ΔfruA, ΔpfkA, ΔpfkB) under air-limited condition. (B) E. coli (alsE, a6PP, ptsG-F, mak, pckA, ΔfruA, ΔpfkA, ΔpfkB) cultured in buffered-LB medium with air-limitation condition at 37°C. Error bars, SD, n = 3.
FIGURE 7Production of D-allulose in minimal medium with air-limited condition. E. coli (alsE, a6PP, ptsG-F, mak, pckA, ΔfruA, ΔpfkA, ΔpfkB) was cultured in M9 minimal medium with 2.20 g/L D-fructose and 8.00 g/L glycerol at 37°C. Error bars, SD, n = 3.