| Literature DB >> 35813201 |
Giulia Ricci1, Florian Guillou2, Angela Catizone3, Vincenza Grazia Mele1, Martina Moggio1, Teresa Chioccarelli1, Nadia Diano1, Rosaria Meccariello4, Riccardo Pierantoni1, Silvia Fasano1, Gilda Cobellis1, Rosanna Chianese1, Francesco Manfrevola1.
Abstract
Kisspeptins are involved in the regulation of hypothalamic-pituitary-gonadal axis, Leydig cell functions, and testosterone secretion, acting as endogenous ligands of the KISS1 receptor. ANKRD31 protein participates in male fertility, regulating meiotic progression, and epididymal sperm maturation. Here, we show that in Leydig cells, KISS1 receptor and ANKRD31 proteins physically interact; the formation of this protein complex is enhanced by Kisspeptin-10 that also modulates F-actin synthesis, favoring histone acetylation in chromatin and gene expression via the cytoskeletal-nucleoskeletal pathway. Kp/KISS1R system deregulation, expression impairment of cytoskeletal-nucleoskeletal mediators, Leydig gene targets, and the decreased testosterone secretion in Ankrd31 -/- testis strongly supported our hypothesis. Furthermore, cytochalasin D treatment subverted the gene expression induction dependent on Kisspeptin-10 action. In conclusion, the current work highlights a novel role for the Kisspeptin-10 in the induction of the cytoskeletal-nucleoskeletal route, downstream a physical interaction between KISS1 receptor and ANKRD31, with gene expression activation as final effect, in Leydig cells.Entities:
Keywords: KISS1R; Leydig cells; actin; ankyrins; cytoskeletal–nucleoskeletal pathway; kisspeptin; male fertility
Year: 2022 PMID: 35813201 PMCID: PMC9260857 DOI: 10.3389/fcell.2022.877270
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
Primer sequences and annealing temperatures.
| Gene primers | Sequences 5′–3′ | Tm (°C) |
|---|---|---|
|
| CATATATGCTAATGGTACCCTACCA | 53 |
|
| CCTTGTAATTAGTAATTTGCCACAG | |
|
| GCCACAGACGTCACTTTCCTAC | 55 |
|
| CGGGAACACAGTCACATACCA | |
|
| ACTTGGAGCAGGTTGAGGTG | 57 |
|
| TGCACTTCCTCTGCCATCAG | |
|
| CGAGCTGGAAGCTCTGAAGT | 58 |
|
| ATGGAGTCTATTTTGGAGTTCTGTG | |
|
| CACTCGCTACTCTCAGGATGATAA | 52 |
|
| TAGGACTCTCGAACCACAGACTC | |
|
| GGCCACACATTTTGGGGAGA | 56 |
|
| GGCGAACTCTATCTGGGTCTG | |
|
| GGGCTGGAGTCCATTCAGAC | 58 |
|
| CACAGCAGTGGCTAGGGTAG | |
|
| GTGTACCAAGTGTGGAGGGG | 55 |
|
| CACAGATGCAGGGACAGGAG | |
|
| TGTGCATTAAGGCCCATGTTT | 52 |
|
| TTGAGGGCCGTAATTATTGTGTT | |
|
| GGCTGTATTCCCCTCCATCG | 55 |
|
| CCAGTTGGTAACAATGCCATGT | |
|
| GAGACTCTGGATGCTAACTAG | 56 |
|
| GGACATCTAAGGGCATCACAG |
Primary antibodies, protein amounts, antibody dilution, and secondary antibodies used for Western blot analysis.
| Primary antibody | µg of protein | Antibody dilution | Secondary antibody |
|---|---|---|---|
| KISS1R (Boster Bio, A01364-1) | 50 | 1:500 | HRP-conjugated rabbit IgG (Dako Corp., Milan, Italy) |
| ANKRD31 | 60 | 1:500 | HRP-conjugated rabbit IgG (Dako Corp., Milan, Italy) |
| NESPRIN2 (Invitrogen, PA5-78438) | 50 | 1:500 | HRP-conjugated rabbit IgG (Dako Corp., Milan, Italy) |
| SUN2 (Santa Cruz, sc-377459) | 50 | 1:500 | HRP-conjugated mouse IgG (Dako Corp., Milan, Italy) |
| SPECTRIN (Santa Cruz, sc-53444) | 60 | 1:500 | HRP-conjugated mouse IgG (Dako Corp., Milan, Italy) |
| HDAC1 (Santa Cruz, sc-8410) | 60 | 1:500 | HRP-conjugated mouse IgG (Dako Corp., Milan, Italy) |
| HDAC2 (Santa Cruz, sc-9959) | 60 | 1:500 | HRP-conjugated mouse IgG (Dako Corp., Milan, Italy) |
| HDAC4 (Santa Cruz, sc-46672) | 60 | 1:500 | HRP-conjugated mouse IgG (Dako Corp., Milan, Italy) |
| H3K14ac (Invitrogen, 703894) | 50 | 1:500 | HRP-conjugated rabbit IgG (Dako Corp., Milan, Italy) |
| β-actin (Invitrogen, PA1-183) | 50 | 1:500 | HRP-conjugated rabbit IgG (Dako Corp., Milan, Italy) |
| F-actin (Invitrogen, MA1-80729) | 50 | 1:500 | HRP-conjugated mouse IgG (Dako Corp., Milan, Italy) |
| LHR (Santa Cruz, sc-293165) | 50 | 1:500 | HRP-conjugated mouse IgG (Dako Corp., Milan, Italy) |
| HSD3β (Santa Cruz, sc-515120) | 50 | 1:500 | HRP-conjugated mouse IgG (Dako Corp., Milan, Italy) |
| SF1 (Santa Cruz, sc-393592) | 50 | 1:500 | HRP-conjugated mouse IgG (Dako Corp., Milan, Italy) |
| STAR (Santa Cruz, sc-166821) | 50 | 1:500 | HRP-conjugated mouse IgG (Dako Corp., Milan, Italy) |
| CYP19 [Invitrogen, PA1-21398)] | 60 | 1:500 | HRP-conjugated mouse IgG (Dako Corp., Milan, Italy) |
FIGURE 1(A) Immunocytochemistry of KISS1 and KISS1R in Bouin’s fixed C57BL/6 testis sections (7 μm). The KISS1 and KISS1R protein localization in Leydig cells was indicated by black and white arrowheads, respectively. Scale bar: 50 μm. (B–G) Differential expression analysis of KissR and cytoskeletal–nucleoskeletal pathway mediator mRNAs in mice testes in vitro treated with different doses of Kp-10 (0.01 µM, 0.1 µM, and 1 µM), by qRT-PCR. (B) Kiss1R, (C) Ankrd31, (D) Spectrin, (E) β-Actin, (F) Nesprin2, and (G) Sun2 expression levels were normalized using Rp18S as a housekeeping gene and expressed as normalized fold expression (n.f.e.), relatively to the CTRL group. All data are reported as mean value ± S.E.M; *p < 0.05; **p < 0.01. Western blot analysis of (H) KISS1R, (I) ANKRD31, (J) SPECTRIN-α-II, (K) β-actin, (L) F-actin, (M) NESPRIN2, and (N) SUN2 proteins levels in mice testes in vitro treated with different doses of Kp-10 (0.01 µM, 0.1 µM, and 1 µM). Signals were quantified by the densitometry analysis and normalized to Ponceau Red (Pon.S). Data are expressed in O.D. values as fold change (O.D. fc), relatively to the CTRL group, and reported as mean ± SEM; *p < 0.05; **p < 0.01.
FIGURE 2(A–D) Differential expression analysis of Leydig cell genes in mice testes in vitro treated with different doses of Kp-10 (0.01 µM, 0.1 µM, and 1 µM), by qRT-PCR. (A) Lhr, (B) Hsd3b, (C) Star, and (D) Sf1 expression levels were normalized using Rp18S as a housekeeping gene and expressed as normalized fold expression (n.f.e.), relatively to the CTRL group. All data are reported as mean value ± S.E.M; **p < 0.01. Western blot analysis of (E) H3K14ac, (F) HDAC1, (G) HDAC2, and (H) HDAC4 protein levels in mice testes in vitro treated with different doses of Kp-10 (0.01 µM, 0.1 µM, and 1 µM). Signals were quantified by the densitometry analysis and normalized to Ponceau Red (Pon.S). Data are expressed in O.D. values as fold change (O.D. fc), relatively to the CTRL group, and reported as mean ± SEM; **p < 0.01.
FIGURE 3(A) H&E staining of Bouin’s fixed WT and Ankrd31 testes sections (7 μm). Leydig cells were indicated by black arrowheads. Scale bar: 50 μm. (B–F) Immunocytochemistry of (B) KISS1, (C) KISS1R, (D) F-actin, (E) H3K14ac, (F) STAR in Bouin’s fixed WT, and Ankrd31 testes sections (7 μm). The protein localization in Leydig cells was indicated by black arrowheads. Scale bar: 50 μm; scale bar inset: 50 μm. (G–K). Western blot analysis of (G) KISS1R, (H) LHR, (I) HSD3β, (J) STAR, and (K) SF1 in WT and Ankrd31 testes. Signals were quantified by the densitometry analysis and normalized to Ponceau Red (Pon.S). Data were expressed in O.D. values as fold change and reported as mean ± SEM; **p < 0.01. (L) Plasma testosterone (TT) levels, at basal condition and following hCG stimulation, in WT and Ankrd31 mice by EIA assay; data were reported as mean ± SEM; **p < 0.01.
FIGURE 4(A,B) IP in murine primary Leydig cells. Total proteins collected from murine primary Leydig cell cultures were immunoprecipitated using (A) KISS1R and (B) ANKRD31 antibodies, respectively. Protein interaction among KISS1R, ANKRD31, and F-actin was detected by Western blot analysis. (C) IP in murine primary Leydig cells in vitro treated with Kp-10 alone (0.1 µM) or in combination with the specific antagonist Kp-234 (1 µM) using KISS1R antibody. Protein interaction among KISS1R, ANKRD31, and F-actin was detected by Western blot analysis. (D) Immunofluorescence analysis of F-actin, using phalloidin staining (green) in murine primary Leydig cells in vitro treated with Kp-10 alone (0.1 µM) or in combination with the specific antagonist Kp-234 (1 µM). Nuclei were labeled with TO-PRO3 iodide (blue). Scale bar: 37.5 µm. (E) Quantitative immunofluorescence analysis: F-actin signals were normalized against nuclei number, expressed in SUM(I) values and reported as mean ± SEM; experimental groups with statistically significant differences (p < 0.01) were indicated with different letters; the experimental groups without statistically significant differences were indicated with the same letter. (F) Analysis of TT content (as ng/ml) in culture media of Leydig cells in vitro treated with Kp-10 alone (0.1 µM) or in combination with the specific antagonist Kp-234 (1 µM). All the data were reported as mean ± SEM; **p < 0.01. Experimental groups with statistically significant differences (p < 0.01) were indicated with different letters. (G) Western blot analysis of CYP19 in murine primary Leydig cells in vitro treated with Kp-10 alone (0.1 µM) or in combination with the specific antagonist Kp-234 (1 µM). Signals were quantified by the densitometry analysis and normalized to Ponceau Red (Pon.S). Data are expressed in O.D. values as fold change (O.D. fc), relatively to the CTRL group, and reported as mean ± SEM; experimental groups with statistically significant differences (p < 0.01) were indicated with different letters.
FIGURE 5(A) Immunofluorescence analysis of F-actin (green) and H3K14ac (red) in murine primary Leydig cells in vitro treated with Kp-10 (0.1 µM) and cytochalasin D (CYTO-D) (10 µM) alone or in combination with Kp-10 (Kp-10+CYTO-D). Nuclei were labeled with TO-PRO3 iodide (blue). Scale bar: 37.5 µm. (B,C) Quantitative immunofluorescence analysis of F-actin and H3K14ac signals. Data were normalized against nuclei number, expressed in SUM(I) values and reported as mean ± SEM; experimental groups with statistically significant differences (p < 0.01) were indicated with different letters; the experimental groups without statistically significant differences were indicated with the same letter. Western blot analysis of (D) F-actin, (E) NESPRIN2, (F) SUN2, and (G) H3K14ac proteins levels in murine primary Leydig cells in vitro treated with Kp-10 (0.1 µM) and cytochalasin D (CYTO-D) (10 µM) alone or in combination with Kp-10 (Kp-10 + CYTO-D). Signals were quantified by the densitometry analysis and normalized to Ponceau Red (Pon.S). Data are expressed in O.D. values as fold change (O.D. fc), relatively to the CTRL group, and reported as mean ± SEM; experimental groups with statistically significant differences (p < 0.01) were indicated with different letters; the experimental groups without statistically significant differences were indicated with the same letter. The differential expression analysis of Leydig cell genes in primary Leydig cells in vitro treated with Kp-10 (0.1 µM) and cytochalasin D (CYTO-D) (10 µM) alone or in combination with Kp-10 (Kp-10+CYTO-D), by qRT-PCR. (H) Lhr, (I) Hsd3b, (J) Star, and (K) Sf1 expression levels were normalized using Rp18S as a housekeeping gene and expressed as normalized fold expression (n.f.e.), relatively to the CTRL group. All data are reported as mean value ± S.E.M; experimental groups with statistically significant differences (p < 0.01) were indicated with different letters; the experimental groups without statistically significant differences were indicated with the same letter.