| Literature DB >> 35812341 |
Abdallah Tageldein Mansour1,2, Mohamed Ashour3, Eman M Abbas3, Ahmed Saud Alsaqufi1, Mahmoud S Kelany3, Mohamed A El-Sawy3, Zaki Z Sharawy3.
Abstract
The current study examines the effect of dietary supplementation of ethanolic extract of Arthrospira platensis NIOF17/003, which is mainly natural astaxanthins (97.50%), on the growth performance, feed utilization, bacterial abundance, and immune-related and antioxidant gene expressions of the Pacific white leg shrimp, Litopenaeus vannamei. A total of 360 healthy L. vannamei postlarvae (0.19 ± 0.003 g) were divided into four groups (0, 2, 4, and 6 g natural astaxanthins/kg diet) each in three replicates, at an initial density of 30 PLs per tank (40 L capacity). The shrimp were fed the tested diets three times a day at a rate of 10% of their total body weight for 90 days. Diets supplemented with different astaxanthin levels significantly improved shrimp growth performance and feed conversion ratio compared to the control diet. No significant differences were observed in survival rates among all experimental groups. The immune-related genes (prophenoloxidase, lysozyme, beta-glucan binding protein, transglutaminase, and crustin) mRNA levels were significantly upregulated in groups fed with different concentrations of the natural astaxanthins in a dose-dependent manner. The prophenoloxidase gene is the highest immune-upregulated gene (14.71-fold change) in response to astaxanthin supplementation. The superoxide dismutase mRNA level was significantly increased with increasing dietary astaxanthin supplementation. In addition, increasing astaxanthin supplementation levels significantly reduced the count of heterotrophic bacteria and Vibrio spp. in the culture water and shrimp intestine. Overall, the current results concluded that diet supplementation with natural astaxanthin, extracted from Arthrospira platensis, enhanced the growth performance, immune response, and antioxidant status of L. vannamei.Entities:
Keywords: antioxidant; astaxanthin; bacterial abundance; feed additives; immune response; marine shrimp
Year: 2022 PMID: 35812341 PMCID: PMC9259928 DOI: 10.3389/fphys.2022.874172
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
The proximate chemical analysis (% of dry matter) of experimented diets.
| Diets | Protein (%) | Fat (%) | Ash (%) | Fiber (%) |
|---|---|---|---|---|
| D1 | 40.59 | 11.31 | 9.19 | 3.51 |
| D2 | 39.69 | 12.60 | 8.89 | 4.14 |
| D3 | 39.88 | 12.28 | 9.21 | 3.48 |
| D4 | 40.51 | 12.62 | 9.40 | 3.41 |
Aller-Aqua, Giza Governorate, Egypt. D1, D2, D3, and D4 are the experimental diets that were supplemented with 0, 2, 4, and 6 g astaxanthins/kg diet, respectively, of the crude acetonic extract of Arthrospira platensis NIOF17/003.
Primer sequences for real-time PCR used for gene expression analysis.
| Gene | Primer sequence (5′-3′) | Accession no. | Size (bp) |
|---|---|---|---|
|
| F: GCCCATCTACGAGGGATA | AF300705 | 121 |
| R: GGTGGTCGTGAAGGTGTAA | |||
| Prophenoloxidase ( | F: CGGTGACAAAGTTCCTCTT | AY723296 | 122 |
| R: GCAGGTCGCCGTAGTAAG | |||
| Lysozyme ( | F: GGACTACGGCATCTTCCAGA | AY170126 | 97 |
| R: ATCGGACATCAGATCGGAAC | |||
| Beta-glucan binding protein ( | F: ACGAGAACGGACAAGAAGTG | AY249858 | 137 |
| R: TTCAGCATAGAAGCCATCAGG | |||
| Superoxide dismutase ( | F: TCATGCTTTGCCACCTCTC | AY486424 | 143 |
| R: CCGCTTCAACCAACTTCTTC | |||
| Transglutaminase ( | F: TTCACAAGCCTGACATCACC | BE188522 | 99 |
| R: GCAGCAGTGGGATAGGGTTA | |||
| Crustin ( | F: ACGAGGCAACCATGAAGG | AF430076 | 141 |
| R: AACCACCACCAACACCTAC |
Phytochemical profile investigated in crude extract of A. platensis NIOF17/003.
| RT | PA% | Compound’s name | P% | CF | EMW |
|---|---|---|---|---|---|
| 19.610 | 98.50 | Astaxanthin | 21.40 | C40H52O4 | 596.38 |
| 19.739 | 0.85 | Cyano 5-{5-[5-(5-cyano-3,4-dimethylpyrrol-2-ylidenemethyl)-3,4-dimethyl-1H-pyrrol-2-ylmethylene]-4,4-dimethyl-4,5-dihydro-3H-pyrro-2-ylmethylene}-4,4-dimethylpyrrolidin-2-ylene-acetic acid, tert.-butyl ester | 7.07 | C35H42N6O2 | 578.33 |
| 14.937 | 0.65 | [5-(5-Chloro-3,4-dimethyl-1H-pyrrol-2-ylmethylene)-3,4-dimethyl-5H-pyrrol-2-yl]-[5-(5-cyano-4,4,5-trimethyl-4,5-dihydro-3H-pyrrol-2-ylmethylene)-4,4-dimethylpyrrolidin-2-ylene]-acetic acid, tert.-butyl ester | 6.60 | C34H44ClN5O2 | 589.31 |
RT, retention time; PA, peak area%; P%, Probability%; MF, molecular formula; and EMW, exact molecular weight.
FIGURE 1Mass spectra and chemical structure of the three phytochemical compounds identified in crude acetonic extract of Arthrospira platensis NIOF17/003. (A): Astaxanthin; (B) Cyano 5-{5-[5-(5-cyano-3,4-dimethylpyrrol-2-ylidenemethyl)-3,4-dimethyl-1H-pyrrol-2-ylmethylene]-4,4-dimethyl-4,5-dihydro-3H-pyrro-2-ylmethylene}-4,4-dimethylpyrrolidin-2-ylene-acetic acid, tert.-butyl ester; and (C): [5-(5-Chloro-3,4-dimethyl-1H-pyrrol-2-ylmethylene)-3,4-dimethyl-5H-pyrrol-2-yl]-[5-(5-cyano-4,4,5-trimethyl-4,5-dihydro-3H-pyrrol-2-ylmethylene)-4,4-dimethylpyrrolidin-2-ylene]-acetic acid, tert.-butyl ester.
Mean values of water quality parameters during the feeding trial.
| Water quality parameters | Experimental diets | |||
|---|---|---|---|---|
| D1 | D2 | D3 | D4 | |
| NH3 (mg L−1) | 0.119 ± 0.001 | 0.116 ± 0.010 | 0.115 ± 0.015 | 0.103 ± 0.014 |
| NO2 (mg L−1) | 0.119 ± 0.016a | 0.109 ± 0.001ab | 0.108 ± 0.003ab | 0.095 ± 0.015b |
| NO3 (mg L−1) | 0.222 ± 0.028 | 0.219 ± 0.003 | 0.225 ± 0.007 | 0.214 ± 0.023 |
| PO4 (mg L−1) | 0.485 ± 0.009 | 0.495 ± 0.039 | 0.517 ± 0.022 | 0.494 ± 0.004 |
| Alkalinity (mg L−1) | 7.700 ± 0.625 | 7.725 ± 0.225 | 7.987 ± 0.137 | 8.337 ± 0.212 |
| Temperature (°C) | 26.84 ± 0.20a | 26.55 ± 0.01b | 26.57 ± 0.07b | 26.65 ± 0.11ab |
| Salinity (ppt) | 32.25 ± 0.09b | 32.52 ± 0.02a | 32.41 ± 0.07ab | 32.52 ± 0.18a |
| pH | 7.79 ± 0.02 | 7.77 ± 0.01 | 7.76 ± 0.01 | 7.76 ± 0.02 |
D1, D2, D3, and D4 are the experimental diets that are supplemented with 0, 2, 4, and 6 g astaxanthins/kg diet, respectively, of the crude acetonic extract of Arthrospira platensis NIOF17/003.
Data are means ± SD and the n = 3. Different letters in the same row are significantly different (p < 0.05).
Growth performance and feed utilization of Pacific white leg shrimp, Litopenaeus vannamei, fed experimental diets for 90 days.
| Growth indicators | Experimental diets | |||
|---|---|---|---|---|
| D1 | D2 | D3 | D4 | |
| IBW (g) | 0.19 ± 0.003 | 0.19 ± 0.003 | 0.19 ± 0.003 | 0.19 ± 0.003 |
| FBW (g) | 21.87 ± 1.15c | 22.03 ± 1.33b | 24.61 ± 1.78a | 25.75 ± 1.42a |
| WG (g) | 21.68 ± 0.57c | 21.84 ± 0.93b | 24.42 ± 1.80a | 25.56 ± 0.92a |
| Survival (%) | 82.22 ± 3.85 | 76.67 ± 3.33 | 77.78 ± 1.92 | 74.44 ± 5.09 |
| SGR (%/day) | 5.27 ± 0.01 | 5.28 ± 0.038 | 5.40 ± 0.028 | 5.45 ± 0.06 |
| FCR | 1.53 ± 0.12a | 1.43 ± 0.06a | 1.25 ± 0.09c | 1.33 ± 0.11b |
D1, D2, D3, and D4 are the experimental diets that are supplemented with 0, 2, 4, and 6 g astaxanthins/kg diet, respectively, of the crude acetonic extract of Arthrospira platensis NIOF17/003.
Data are means ± SD and the n = 3. Different letters in the same row are significantly different (p < 0.05).
IBW, initial body weight (g); FBW, final body weight (g); WG, weight gain (g); SGR, specific growth rate (%/day); and FCR, feed conversion ratio.
FIGURE 2The appropriate regression models of the increasing inclusion levels of dietary astaxanthin supplementation for the (A) weight gain; (B) food conversion ratio of L. vannamei. D1, D2, D3, and D4 are the experimental diets that are supplemented with 0, 2, 4, and 6 g astaxanthin/kg diet, respectively, of the natural astaxanthins of the crude acetonic extract of Arthrospira platensis NIOF17/003. Data are means ± SD and the n = 3.
Proximate whole-body proximate analysis (% of wet weight) of Pacific white leg shrimp, Litopenaeus vannamei, fed experimental diets for 90 days.
| Proximate composition indicators | Experimental diets | |||
|---|---|---|---|---|
| D1 | D2 | D3 | D4 | |
| Dry matter (%) | 26.53 ± 0.10a | 25.04 ± 0.04b | 24.84 ± 0.12c | 25.58 ± 0.07b |
| Protein (%) | 23.12 ± 0.03a | 21.77 ± 0.04c | 21.56 ± 0.06d | 22.19 ± 0.02b |
| Fat (%) | 7.79 ± 0.01d | 9.99 ± 0.02c | 10.07 ± 0.04b | 10.87 ± 0.03a |
| Ash (%) | 1.60 ± 0.01d | 1.99 ± 0.02b | 1.92 ± 0.03c | 2.08 ± 0.03a |
D1, D2, D3, and D4 are the experimental diets that are supplemented with 0, 2, 4, and 6 g astaxanthins/kg diet, respectively, of the crude acetonic extract of Arthrospira platensis NIOF17/003.
Data are means ± SD and the n = 3. Different letters in the same column are significantly different (p < 0.05).
Bacterial abundance in the culture water and intestine of Pacific white leg shrimp, Litopenaeus vannamei, fed experimental diets for 90 days.
| Bacterial count | Experimental diets | |||
|---|---|---|---|---|
| D1 | D2 | D3 | D4 | |
| Water | ||||
| THB (cfu mL1 x104) | 95.90 ± 0.04d | 41.90 ± 0.03c | 26.50 ± 0.06b | 11.90 ± 0.66a |
| TVC (cfu mL1 x103) | 11.40 ± 0.05d | 6.80 ± 0.02c | 4.50 ± 0.03b | 0.5 ± 0.04a |
| Intestine | ||||
| THB (cfu g1 x104) | 399.90 ± 0.04d | 249.90 ± 0.03c | 119.90 ± 0.04b | 30.00 ± 0.03a |
| TVC (cfu g1 x103) | 111.20 ± 0.4d | 47.60 ± 0.40c | 28.20 ± 0.60b | 6.70 ± 0.30a |
D1, D2, D3, and D4 are the experimental diets that are supplemented with 0, 2, 4, and 6 g astaxanthins/kg diet, respectively, of the crude acetonic extract of Arthrospira platensis NIOF17/003.
Data are means ± SD and the n = 9. Different letters in the same row are significantly different (p < 0.05).
THB, total heterotrophic bacterial count; TVC, total Vibrio spp. count.
FIGURE 3Analysis of immune-related gene-expressions [Bgp (A), proPO (B), Lys (C), TGase (D), Crus (E), and SOD (F)] comparing to the expression of β-actin gene in the different inclusion levels of astaxanthin dietary supplementation. D1, D2, D3, and D4 are the experimental diets that are supplemented with 0, 2, 4, and 6 g astaxanthins/kg diet, respectively, of the crude acetonic extract of Arthrospira platensis NIOF17/003. The data are means ± SD and the n = 9. Different letters for the same gene indicated a significantly differences (p < 0.05).