Midazolam is a widely used short-acting benzodiazepine. However, midazolam is also criticized for its deliriogenic potential. Since delirium is associated with a malfunction of the neurotransmitter acetylcholine, midazolam appears to interfere with its proper metabolism, which can be triggered by epigenetic modifications. Consequently, we tested the hypothesis that midazolam indeed changes the expression and activity of cholinergic genes by acetylcholinesterase assay and qPCR. Furthermore, we investigated the occurrence of changes in the epigenetic landscape by methylation specific PCR, ChiP-Assay and histone ELISA. In an in-vitro model containing SH-SY5Y neuroblastoma cells, U343 glioblastoma cells, and human peripheral blood mononuclear cells, we found that midazolam altered the activity of acetylcholinesterase /buturylcholinesterase (AChE / BChE). Interestingly, the increased expression of the buturylcholinesterase evoked by midazolam was accompanied by a reduced methylation of the BCHE gene and the di-methylation of histone 3 lysine 4 and came along with an increased expression of the lysine specific demethylase KDM1A. Last, inflammatory cytokines were not induced by midazolam. In conclusion, we found a promising mechanistic link between midazolam treatment and delirium, due to a significant disruption in cholinesterase homeostasis. In addition, midazolam seems to provoke profound changes in the epigenetic landscape. Therefore, our results can contribute to a better understanding of the hitherto poorly understood interactions and risk factors of midazolam on delirium.
Midazolam is a widely used short-acting benzodiazepine. However, midazolam is also criticized for its deliriogenic potential. Since delirium is associated with a malfunction of the neurotransmitter acetylcholine, midazolam appears to interfere with its proper metabolism, which can be triggered by epigenetic modifications. Consequently, we tested the hypothesis that midazolam indeed changes the expression and activity of cholinergic genes by acetylcholinesterase assay and qPCR. Furthermore, we investigated the occurrence of changes in the epigenetic landscape by methylation specific PCR, ChiP-Assay and histone ELISA. In an in-vitro model containing SH-SY5Y neuroblastoma cells, U343 glioblastoma cells, and human peripheral blood mononuclear cells, we found that midazolam altered the activity of acetylcholinesterase /buturylcholinesterase (AChE / BChE). Interestingly, the increased expression of the buturylcholinesterase evoked by midazolam was accompanied by a reduced methylation of the BCHE gene and the di-methylation of histone 3 lysine 4 and came along with an increased expression of the lysine specific demethylase KDM1A. Last, inflammatory cytokines were not induced by midazolam. In conclusion, we found a promising mechanistic link between midazolam treatment and delirium, due to a significant disruption in cholinesterase homeostasis. In addition, midazolam seems to provoke profound changes in the epigenetic landscape. Therefore, our results can contribute to a better understanding of the hitherto poorly understood interactions and risk factors of midazolam on delirium.
Midazolam is the most abundantly used benzodiazepine in anesthesia and emergency medicine [1]. Due to its amnestic and anxiolytic effects, midazolam is considered as a favorable choice for premedication [2, 3]. However, the use of benzodiazepines especially midazolam is associated with postoperative complications such as cognitive impairment and delirium [4].Currently, it is discussed whether anesthetics cause an alteration of the epigenetic landscape of the cell, which might induce a long-lasting cognitive impairment [5]. One common postoperative complication in elderly critically ill patients is the postoperative delirium (POD) that is also associated with a worse outcome, longer stay on the intensive care unit and higher health-care related costs [6]. In addition, delirium is also linked to an increased risk of long term cognitive impairments that recover with high inter-individual differences from days to months [7]. Especially the use of benzodiazepine is, in addition to blood transfusion, one of the only modifiable factors with strong evidence for an association with delirium after surgery [8]. Within the group of benzodiazepines midazolam shows highest incidence of POD [9].Although there are some theories that could explain the positive correlation between midazolam administration and the high incidence of POD, such as the degree of sedation [8] and the function of midazolam as a GABAergic agent [10], the underlying molecular mechanisms and the pathogenesis of POD still remain elusive.Currently, a pathogenesis is discussed involving a reduced concentration of the neurotransmitter acetylcholine [11], neuroinflammation [12, 13] or decreased antiinflammation [14]. The hydrolysis of acetylcholine is mainly mediated by acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) that can be found in the brain, red blood cells, and central nervous system [15]. Especially an altered activity and concentration of BChE seems to impact pathogenesis of POD [16-18] and BChE activity also shows high prognostic capability for POD [19].Recently, we could demonstrate that the GABAergic agent propofol changes the epigenome [20]. In context with POD and anesthesia, the expression of lysine-specific demethylase (KDM1A) seems of special interest as it is associated with cognitive function [21] and demethylates histone 3 lysine 4 [22]. Hence long-lasting effects on the central nervous system and cognitive abilities caused by the GABAergic midazolam could be caused by changing the epigenetic landscape of the cells [23-25]. Since it is currently unknown whether and how midazolam influences the activity of the ACHE or BCHE gene. However, we speculate that one possible mechanism is the alteration of the expression of cholinergic genes by changing the epigenetic profile of the cells.Therefore, in this study we investigated whether the expression, activity and methylation profile of cholinesterases are changed by midazolam. Furthermore, we study whether midazolam changes the epigenetic landscape of the cell by altering KDM1A expression.
2. Materials and methods
2.1. Cell culture
Human neuroblastoma cells SH-SY5Y and the glioblastoma cell line U343 (origin: Cell Lines Service, CLS, Eppelheim Germany, SH-SY5Y item number: 300154 and U343 item number: 300365) were cultured in Dulbecco’s modified Eagle medium (DMEM; Gibco, Darmstadt, Germany) at 37°C and 5% CO2 with 10% fetal calf serum (FCS; Gibco, Darmstadt, Germany) and 1% penicillin/streptomycin (Penstrep; Gibco, Darmstadt, Germany). Cells were maintained every three to four days by adding 5 ml of Trypsin-EDTA 0.25% (Gibco, Darmstadt, Germany) after medium removal to dissolve adhesive cells. Furthermore, peripheral blood mononuclear cells (PBMCs) were examined, after the Ethics Committee’s approval (Ethics Committee of the Ruhr-University Bochum, Bochum, Germany; ref: 17-5964-BR), registration at the German Clinical Trials Register (ref: DRKS00012961, https://www.drks.de/drks_web/navigate.do?navigationId=trial.HTML&TRIAL_ID=DRKS00012961) and written informed consent. 80 ml EDTA blood was taken from eight healthy donors (5 female and 3 male) and PBMCs were isolated, using density gradient centrifugation with Ficoll-Paque (GE Healthcare, Chalfont, UK).
2.2. Quantitative reverse transcription PCR
q-RT-PCR on SH-SY5Y cells, U343 and PBMCs was performed as described previously [26]. Briefly, cells were cultured in 6-well culture plates and incubated with 250 ng/ml, 1 μg/ml or 50 μg/ml midazolam (midazolam hydrochloride injection solution, B. Braun Melsungen) for 2, 4 and 24 h, 10 μg/ml and 50 μg/ml flumazenil or were left untreated (control). Flumazenil incubation was performed two hours after starting midazolam incubation. For incubation, the highest concentration of midazolam (SH-SY5Y 50 μg/ml; U343 250 ng/ml; BV-2 10 μg/ml) and flumazenil was used, which did not reduce cell viability in different cell lines in previous experiments. Cells were incubated at 37°C and 5% CO2. After RNA isolation and cDNA synthesis of 1 μg RNA using the QuantiTect Reverse Transcription kit (Qiagen, Hilden, Germany), we utilized 2.5 μl of cDNA together with specific primers (Table 1) and GoTaq qPCR master mix (Promega, Madison, WI, USA) for a standard qPCR reaction protocol.
Table 1
Primer pairs for PCR.
Primer name
Sequence (5’ to 3’)
Product size (bp)
BCHE_M1_SE
ATTTAGGTTAAAACGGTGAAATTTC
172
BCHE_M1_AS
AAACTAAAATACCGTAACGCGAT
BCHE_U1_SE
TTAGGTTAAAATGGTGAAATTTTGG
173
BCHE_U1_AS
CTCAAACTAAAATACCATAACACAAT
ACHE_M_SE1
AAT TTT ATT AGT TTC GAG CGA GAT C
189
ACHE_M_AS1
GAC CCA AAA ACC TAC AAC GAC
ACHE_U_SE1
TTT TAT TAG TTT TGA GTG AGA TTG A
188
ACHE_U_AS1
CAA CCC AAA AAC CTA CAA CAA C
ACTB_SE
CTGGAACGGTGAAGGTGACA
140
ACTB_AS
AAGGGACTTCCTGTAACAATGCA
KDM1A_RT_SE
GCCCACTTTATGAAGCCAACG
161
KDM1A_RT_AS
GCCAAGGGACACAGGCTTAT
ACHE_mRNA_SE
GCT TCA GCA AAG ACA ACG AG
115
ACHE_mRNA_AS
GTG TAA TGC AGG ACC ACA GC
BCHE_mRNA_SE
ATCCTGCATTTCCCCGAAGT
239
BCHE_mRNA_AS
CCGTGCCACCAAAAACTGTC
BCHE_Prom_SE
GCATGTGCACTGCAAGTTGA
90
AACTCTCGCGAGCTTTGTCA
BCHE_Prom_AS
CCCTGCAGGCAGTCATACAT
CTGCTGCTCCAGCCTGTAAA
2.3. Cholinesterase activity after incubation with midazolam
Cholinesterase activity in SH-SY5Y cells was measured after stimulation with midazolam.For this purpose, 5 x 105 SH-SY5Y cells were seeded in 4 ml of growth medium containing 10% FBS. Cells were incubated for 24 h at 37°C and incubated for 2, 4 and 24 h with 50 μg/ml midazolam or were left untreated.The proteins were isolated as previously described [20] after washing the cells with PBS. After the lysates were collected from all experiments, protein quantification was performed using the Rotiquant universal kit (Roth, Karlsruhe, Germany). The lysates were used for detection of cholinesterase activity using an acetylcholinesterase assay kit (fluorometric red) (Abcam, Cambridge, UK) according to the manufacturer’s instructions.
2.4. Methylation and expression of BCHE gene after incubation with midazolam
The DNA methylation of BCHE gene was quantified using methylation-specific PCR after bisulphite conversion in SH-SY5Y cells, before and after incubation. For this purpose, 5 x 105 SH-SY5Y cells per 4 ml were seeded in 6-well culture plates and incubated for 24 h at 37° C and 5% CO2. The cells were incubated with 50 μg/ml or 250 ng/ml midazolam depending on cell type for 2, 4 and 24h. Subsequently, the DNA was isolated using the QIAamp DNA blood mini kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. Bisulphite conversion was performed with the EZ DNA methylation-gold kit (Zymo Research, Irvine, CA, USA). All DNA samples were diluted to 10 ng /μl qPCR was performed to detect methylation, as previously described [27], with the GoTaq qPCR master mix (Promega, Madison, WI, USA) and specific primers (Table 1).The percentage of methylation was analyzed as previously described [27, 28].
2.5. Analysis of histone modifications
Furthermore, histone modifications of histone 3 after incubation were analyzed. SH-SY5Y cells and U343 were seeded, as previously described, and incubated with 250 ng / ml of midazolam or left untreated (control) for 24 h exactly as previously described [20].Histone concentration was quantified by the Rotiquant universal kit (Roth, Karlsruhe, Germany) and histone modification was quantified by ELISA using 50 ng protein for the PathScan® Di-Methyl-Histone H3 (Lys4) Sandwich ELISA kit (Cell Signaling Technology, Cambridge, UK).
A ChIP assay was used to analyze if the promoter of the cholinergic gene BCHE binds to histone H3 lysine K4., 1 x 106 SH-SY5Y were used for the Pierce agarose Chip kit (Thermo Fisher Scientific, Waltham, MA, USA). The H3K4me2 polyclonal antibody (EpiGentek, Farmingdale, NY, USA) was used as a specific antibody. As a positive control, an antibody against RNA polymerase II in combination with specific primers against GAPDH was used, while Rabbit IgG in combination with our primers against BCHE gene regions was used as a negative control. After DNA isolation, PCR (One Taq Master Mix, New England Biolabs, Frankfurt am Main, Germany) was carried out with, BCHE_prom primers (Table 1), and the PCR products were analyzed on agarose gel (Peqlab, Erlangen, Germany).
2.7. LegendPlex assay for the quantification of cytokines (TNFα and IL6)
To measure cytokine release from glial cells, BV2 cells (kind gift from Veselin Grozdanov Department of Neurology, Ulm University, Ulm, Germany) were used. Cell culture supernatant was utilized after midazolam and LPS treatment for quantification of TNFα, IL6 with the Legend Plex InflammationPanel (BioLegend, San Diego, CA), according to manufacturer’s recommendations. Briefly, cells were treated with 1 μg/mL midazolam 100 ng/ml LPS or left untreated and incubated for 2, 4 and 24 h in complete growth medium. Cell supernatant was collected and stored at -80°C until use for cytokine quantification. Measurement was performed using FACS Canto II (Becton Dickinson GmbH, Heidelberg, Germany) according to the manufacturer’s instructions and analysis was performed using LEGENDplex v8.0 software.
2.8. Statistics
All experiments were performed in duplicate and repeated at least three times. Results are presented as mean ± standard deviation. If not otherwise stated, all datasets were analyzed using an unpaired t-Test or one-way ANOVA for multiple comparisons with a Dunnett’s multiple comparisons test for specific comparisons. A p-value ≤ 0.05 was considered statistically significant. For multiple comparisons, specific comparisons were only analyzed if the one-way ANOVA showed a statistically significant difference between the groups. All statistical analyses were performed using GraphPad Prism 8 (San Diego, CA, USA).
3. Results
3.1. The activity and expression of AChE and BChE are altered after incubation with midazolam
Cholinesterase activity in SH-SY5Y cells was gradually reduced after incubation with midazolam, without reaching statistical significance (control: mean + SD 90.7 +5.5; 2 hours mean + SD 42.51 + 28.7; p = n.s.; Fig 1A) but the intracellular AChE and BChE activity (p = 0.01; Fig 1A) and ACHE (p< 0.01) and BCHE (p = 0.03) mRNA expression increased after 24 h by about 80% (Fig 1B and 1C).
Fig 1
Activity and mRNA expression of AChE and BChE after incubation with midazolam A) the intracellular cholinesterase activity increased 24 h after midazolam exposure (n = 4; p = 0.01) and was measured by fluorometric assay B) ACHE mRNA quantified by qPCR expression was increased 24 hours after midazolam exposure in SH-SY5Y cells (n = 3; p<0.01) C) BCHE mRNA quantified by qPCR expression was increased 24 hours after midazolam exposure in SH-SY5Y cells (n = 3; p = 0.03). Data are presented as mean ± standard deviation. The reported p-value refers to the Dunnett’s post-hoc test, comparing the underlying columns at the ends of each bar.
Activity and mRNA expression of AChE and BChE after incubation with midazolam A) the intracellular cholinesterase activity increased 24 h after midazolam exposure (n = 4; p = 0.01) and was measured by fluorometric assay B) ACHE mRNA quantified by qPCR expression was increased 24 hours after midazolam exposure in SH-SY5Y cells (n = 3; p<0.01) C) BCHE mRNA quantified by qPCR expression was increased 24 hours after midazolam exposure in SH-SY5Y cells (n = 3; p = 0.03). Data are presented as mean ± standard deviation. The reported p-value refers to the Dunnett’s post-hoc test, comparing the underlying columns at the ends of each bar.
3.2. Application of the midazolam antagonist flumazenil reverses midazolam induced effects on BCHE expression
In order to elucidate if midazolam antagonist flumazenil is capable to reduce midazolam induced effects on ACHE and BCHE expression, SH-SY5Y cells were incubated with flumazenil two hours after midazolam exposure. Here, we show a gradual increasing abolition of the midazolam effect (increased BCHE expression) under increasing doses of the antagonist flumazenil (Fig 2B). After the addition of 10μg/mL flumazenil the increased expression associated with midazolam of BCHE was reduced (p<0.05; Fig 2B). Interestingly, this effect was not observed on ACHE expression (Fig 2A).
Fig 2
SH-SY5Y cells were incubated with midazolam for 24 h and with flumazenil (starting 2 h after midazolam exposure) for 22 hours.
ACHE and BCHE mRNA expression relative to β-Actin mRNA expression were quantified by qPCR. Incubation with flumazenil A) did not alter ACHE expression (n = 6; p = n.s.) and reduced B) BCHE (n = 6; p = 0.046) expression. Data are presented as mean ± standard deviation. The reported p-value refers to the Dunnett’s post-hoc test, comparing the underlying columns at the ends of each bar.
SH-SY5Y cells were incubated with midazolam for 24 h and with flumazenil (starting 2 h after midazolam exposure) for 22 hours.
ACHE and BCHE mRNA expression relative to β-Actin mRNA expression were quantified by qPCR. Incubation with flumazenil A) did not alter ACHE expression (n = 6; p = n.s.) and reduced B) BCHE (n = 6; p = 0.046) expression. Data are presented as mean ± standard deviation. The reported p-value refers to the Dunnett’s post-hoc test, comparing the underlying columns at the ends of each bar.
3.3. Midazolam induces epigenetic changes in the BCHE gene of neuronal cells
Midazolam induced a decrease in BCHE intron 2 DNA methylation (p = 0.01; Fig 3A) and in the di-methylation of H3K4 (p = 0.02; Fig 3B), where BCHE promoter binds (Fig 3C). ACHE DNA methylation was not altered by incubation with 50 μg/ml midazolam (Fig 3D).
Fig 3
Methylation of BCHE in neuronal SH-SY5Y and U343 cells after midazolam incubation A) BCHE intron 2 methylation reduced after midazolam (50 μg/ml) exposure of SH-SY5Y cells (n = 3; p = 0.01) analyzed by methylation specific PCR. B) ELISA showed that histone H3 lysine 4 di-methylation (H3K4me2) decreased in U343 cells after incubation with 250 ng/ml midazolam (n = 3; p = 0.02) C) Chip-Assay confirmed binding of BCHE promoter region (90 bp) to H3K4me2; a 100 bp DNA Ladder was utilized; lanes 1, 7 show incubation with H3K27 antibody; lanes 2 and 6 show incubation with H3K4 antibody; lane 4 shows negative control without antibody and lane 5 shows positive control with RNA-polymerase II antibody (two experiments out of three are shown; n = 3). D) ACHE -571-/-670 promoter methylation was not affected by midazolam (50 μg/ml) exposure of SH-SY5Y cells (n = 3; p = n.s.) analyzed by methylation specific PCR. Data are presented as mean ± standard deviation.
Methylation of BCHE in neuronal SH-SY5Y and U343 cells after midazolam incubation A) BCHE intron 2 methylation reduced after midazolam (50 μg/ml) exposure of SH-SY5Y cells (n = 3; p = 0.01) analyzed by methylation specific PCR. B) ELISA showed that histone H3 lysine 4 di-methylation (H3K4me2) decreased in U343 cells after incubation with 250 ng/ml midazolam (n = 3; p = 0.02) C) Chip-Assay confirmed binding of BCHE promoter region (90 bp) to H3K4me2; a 100 bp DNA Ladder was utilized; lanes 1, 7 show incubation with H3K27 antibody; lanes 2 and 6 show incubation with H3K4 antibody; lane 4 shows negative control without antibody and lane 5 shows positive control with RNA-polymerase II antibody (two experiments out of three are shown; n = 3). D) ACHE -571-/-670 promoter methylation was not affected by midazolam (50 μg/ml) exposure of SH-SY5Y cells (n = 3; p = n.s.) analyzed by methylation specific PCR. Data are presented as mean ± standard deviation.
3.4. Midazolam increases the expression of lysine specific demethylase KDM1A
To explore the underlying mechanisms for the decrease in H3K4me2, we analyzed the expression of lysine specific demethylase KDM1A after exposure to midazolam. KDM1A mRNA expression was increased in, in U343 by about 50% (p <0.01; Fig 4A), in PBMCs by more than 100% (p<0.01; Fig 4B) and in SH-SY5Y by about 50% (p = 0.0038; Fig 4C). Incubation with flumazenil reduced midazolam induced effects in a visible dose dependent manner in SH-SY5Y cells, while incubation with midazolam alone led to increased expression of KDM1A (p < 0.001; Fig 4D) expression.
Fig 4
KDM1A mRNA expression was quantified relative to β-Actin mRNA expression by qPCR.
Increased expression of lysine specific demethylase (KDM1A) in different cells after midazolam [50 μg/ml] exposure for 24 hours analyzed by qPCR. KDM1A expression increased in U343 (n = 3; A, in peripheral blood mononuclear cells (PBMCs) (n = 8; B) and in SH-SY5Y (n = 3; C). Flumazenil did not reduce KDM1A expression (n = 6, D). Data are presented as mean ± standard deviation. The reported p-value refers to the Dunnett’s post-hoc test, comparing the underlying columns at the ends of each bar.
KDM1A mRNA expression was quantified relative to β-Actin mRNA expression by qPCR.
Increased expression of lysine specific demethylase (KDM1A) in different cells after midazolam [50 μg/ml] exposure for 24 hours analyzed by qPCR. KDM1A expression increased in U343 (n = 3; A, in peripheral blood mononuclear cells (PBMCs) (n = 8; B) and in SH-SY5Y (n = 3; C). Flumazenil did not reduce KDM1A expression (n = 6, D). Data are presented as mean ± standard deviation. The reported p-value refers to the Dunnett’s post-hoc test, comparing the underlying columns at the ends of each bar.
3.5. Midazolam does not induce the release of cytokines from BV-2 glial cells
Since postoperative delirium is strongly associated with neuroinflammation, we finally investigated whether midazolam itself evoked cytokine secretion in neural glial cells (BV-2, RRID:CVCL_0182). Midazolam did not induce any change in cytokine secretion in BV-2 cells (p = ns), compared to untreated cells. Cells incubated with lipopolysaccharide (LPS) as positive control had higher TNF-α cytokine levels (p = 0.01; Fig 5A) and higher IL-6 levels (p = 0.02; Fig 5B) compared to cells incubated with midazolam for 24 hours.
Fig 5
Cytokine secretion in BV-2 glial cells after midazolam (1μg/ml) for 24 hours and LPS (100 ng/ml) for 4 hours (n = 3).
BV-2 cells were incubated with midazolam (1μg/ml) or lipopolysaccharide LPS (100 ng/ml) or left untreated. Cytokine expression was quantified using a bead-based immunoassay. Data are presented as mean ± standard deviation. The reported p-value refers to the Dunnett’s post-hoc test, comparing the underlying columns at the ends of each bar.
Cytokine secretion in BV-2 glial cells after midazolam (1μg/ml) for 24 hours and LPS (100 ng/ml) for 4 hours (n = 3).
BV-2 cells were incubated with midazolam (1μg/ml) or lipopolysaccharide LPS (100 ng/ml) or left untreated. Cytokine expression was quantified using a bead-based immunoassay. Data are presented as mean ± standard deviation. The reported p-value refers to the Dunnett’s post-hoc test, comparing the underlying columns at the ends of each bar.
4. Discussion
Midazolam is a widely used benzodiazepine although its application is associated with the occurrence of POD [9]. A potential mechanism for the development of delirium is impaired cholinergic transmission based on the deficiency of acetylcholine in the brain [29]. However, as the causal relationship between midazolam and the cholinergic system is unknown, we systematically analyzed the expression and epigenetic regulation of cholinergic genes in neuronal cells after midazolam exposure. As a different postoperative activity of the proteins AChE and BChE in patients is already described [16, 30, 31] it seems of special interest, how their gene expression is regulated after midazolam exposure.First, we could detect a visibly early decrease in cholinesterase activity and a slight decrease in the expression of BCHE mRNA, but a late increase in the activity and the expression of ACHE and BCHE mRNA. Our results regarding AChE and BChE activity and expression are in line with other studies analyzing AChE and BChE activities in peripheral blood from preoperative and postoperative patients [16, 19, 30]. AChE and BChE concentrations in blood and cerebrospinal fluid were altered in patients undergoing total hip/knee replacement, and BChE concentration showed the highest prognostic value for the development of POD [19]. Thus, increased gene expression, especially BChE, could represent an important mechanism, as it could be found in the brain of patients with Alzheimer’s disease [32] and several studies explored the therapeutic implication of cholinesterase inhibitors in alleviating postoperative delirium [33].Second, we tested the methylation of a BCHE gene region and a histon, with BCHE binding affinity. Methylation of the BCHE gene region (Intron 2) and the H3K4 di-methylation decreased after midazolam incubation. Thus, it seems appropriate to suggest that the region of the BCHE gene we investigated has activating effects on the transcription of this gene. However, it must be mentioned that the reduction in methylation was only about 10%. This seems to be questionable for a more than doubled amount of mRNA expression. In fact, other studies have already shown that a small change in DNA methylation of approximately 5% can have a great impact on gene expression [34]. Therefore, it seems possible that this small change in methylation state may cause this effect on mRNA expression.Third: Since midazolam changed the di-methylation of H3K4, and we could detect binding of BCHE to this histone, it seems appropriate that midazolam might change the epigenome of the cell by influencing histon-modifying enzymes. H3K4me2 has been shown to mark actively transcribing genes [35]. In our analyzed neuronal cell line di-methylation was nearly 100 percent and midazolam could decrease the methylation slightly. A reduction of the di-methylation of H3K4 could therefore mean an overall increase in BChE expression. The demethylation of H3K4 is facilitated by KDM1A and is a well-established mechanism underlying transcriptional gene repression, but recently its role in gene activation could be shown [36]. The KDM1A demethylation of H3K4me2 in GR-targeted enhancers was shown to be important for GC-mediated gene transcription, facilitating a molecular mechanism for the demethylation of H3K4me2 in gene activation [36]. Since changes in the methylation of histone 3 is facilitated by KDM1A, we analyzed the expression of KDM1A in our cell lines, and because POD is also associated with an altered cholinesterase activity in blood samples [16], we additionally investigated the expression of these enzymes in PBMCs. Strikingly, KDM1A showed a significant increased expression after midazolam treatment in all investigated cell lines (including PBMCs). Thus, our results provide first evidence that midazolam indeed rewrites the epigenetic landscape of the cell. Interestingly, the application of KDM1A inhibitors is associated with positive effects on memory. Recently it could be demonstrated that inhibition of KDM1A corrects memory deficit and behavior alterations in a mouse model of Alzheimer’s Disease [21]. Another KDM1A inhibitor T-448 improved learning function in mice suffering from neuronal glutamate receptor hypofunction [37]. Thus, it seems tempting to speculate that KDM1A inhibitors might represent a therapeutic approach against POD. However, this crude thesis needs to be evaluated in upcoming studies.Fourth: As increased expression of BCHE seems to be critical mechanisms after midazolam exposure. In this context, we analyzed if the midazolam antagonist flumazenil could inhibit midazolam induced effects. Indeed, we could show that flumazenil application reduced midazolam-induced expression in a dose-dependent manner. Regarding the effects of flumazenil application after midazolam anesthesia on brain function, we can only speculate. However, it is known that cognitive abnormalities can significantly be ameliorated after benzodiazepine use by slow subcutaneous infusion of flumazenil [38] and that flumazenil administration attenuates cognitive impairment [38]. Therefore, flumazenil use might be effective in reducing POD.Lastly, since POD is related to neuroinflammation [39], we analyzed if there is a link between midazolam treatment for neuroinflammation. We could demonstrate that in our positive control, the incubation of glial cells with LPS TNF-alpha and IL-6 were significantly upregulated. However, midazolam treatment had no influence on the expression of these cytokines. IL-6 seems to be of particular interest as it seems to be a consistent predictor of delirium in surgical samples [40]. Therefore, we can conclude that midazolam does not strongly contribute to pro-inflammatory signaling, being discussed as additional factors in the development of POD [12-14].We have to discuss the limitations of our study. Direct transfer to the bedside is inappropriate because we worked with cell lines as a model for the human brain. However, for instance we chose the neuronal cell line SH-SY5Y, because these represent an established cell line used to study brain disorders such as Alzheimer’s disease or Parkinson [41, 42]. In addition, the extraction of neuronal cells from healthy volunteers or patients with POD is ethically not feasible [43]. Despite great efforts made to achieve the highest possible degree of standardization, variance in effect sizes or observed effects can occur within the individual experiments, which limits the statistical or mathematical accuracy of our experiments. However, this had no or only a negligible effect on the interpretation of our data. Therefore, considering the limitations of immortalized cell lines, we are confident that it is appropriate to perform our investigations in our selected cell lines. In addition, direct measurement of acetylcholine would be interesting but is not suitable as it is extremely unstable [44]. Thus, we mainly refer to the central effectors and regulators of acetylcholine concentration.
5. Conclusions
In summary, we found that midazolam upregulates intracellular BCHE expression. This upregulation in expression might be caused by demethylation of BCHE gene and H3K4 me2 demethylation and be facilitated by KDM1A. Thus, our results underpin the thesis, that overexpression of BCHE might aggravate postoperative delirium, due to an increased hydrolysis of acetyl-choline. Although POD is closely related to neuroinflammation, midazolam appears to be a separate trigger, independent of inflammation. Further studies should validate our promising results and mechanistic implications in the clinical context regarding feasibility and transferability.(JPG)Click here for additional data file.2 Jun 2022
PONE-D-22-13550
Midazolam impacts acetyl- and butyrylcholinesterase genes: An epigenetic explanation for postoperative delirium?
PLOS ONE
Dear Dr. Rump,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.
In your revised manuscript please address the comments of both reviewers as fully as possible.
Please submit your revised manuscript by Jul 17 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Israel SilmanAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2.3. Thank you for stating the following financial disclosure:"NO"At this time, please address the following queries:a) Please clarify the sources of funding (financial or material support) for your study. List the grants or organizations that supported your study, including funding received from your institution.b) State what role the funders took in the study. If the funders had no role in your study, please state: “The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.”c) If any authors received a salary from any of your funders, please state which authors and which funders.d) If you did not receive any funding for this study, please state: “The authors received no specific funding for this work.”Please include your amended statements within your cover letter; we will change the online submission form on your behalf.4. PLOS ONE now requires that submissions reporting blots or gels include original, uncropped blot/gel image data as a supplement or in a public repository. This is in addition to complying with our image preparation guidelines described at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements. These requirements apply both to the main figures and to cropped blot/gel images included in Supporting Information. If the manuscript is positively reviewed, we will ask the authors to provide any missing raw image data for blot/gel results when they submit their first revision. As part of your review, please ensure that figures reporting blot or gel images comply with the journal’s image preparation guidelines and that the original data are provided following the journal’s request. If you have any questions or concerns about blot/gel figures or data for this submission, please email us at plosone@plos.org before issuing a decision letter.5. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.6. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please move it to the Methods section and delete it from any other section. Please ensure that your ethics statement is included in your manuscript, as the ethics statement entered into the online submission form will not be published alongside your manuscript.Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: YesReviewer #2: Partly********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: YesReviewer #2: Yes********** 3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: YesReviewer #2: Yes********** 4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: YesReviewer #2: Yes********** 5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Summary: Midazolam is given to patients before surgery. Midazolam is responsible for the delirium experienced by some patients in the days after surgery. Based on previous reports that cholinesterase activity levels are altered in patients who experience delirium, the present work hypothesized that midazolam affects the cholinesterase genes. Stable cell lines and peripheral blood mononuclear cells were assayed for the effect of midazolam on cholinesterase activity and mRNA levels, methylation of cholinesterase genes, demethylation enzyme activity, binding of the BCHE promoter to Histone and neuroinflammation. It was concluded that BCHE gene overexpression may aggravate postoperative delirium.1. Abstract. Please mention that your studies used human SH-SY5Y neuroblastoma cells, U343 glioblastoma cells, and human peripheral blood mononuclear cells.2. Abstract. Please list the methods used in your study.3. You find that midazolam increased the level of BChE activity. However, references 16 and 18 report decreased BChE activity in the blood of patients treated with midazolam, on day 1 after surgery. Perhaps the abstract refers to increased BCHE mRNA rather than BChE activity.4. Page 4 of 20, line 80. Typing error: 2.5% should be 0.25% Trypsin-EDTA5. Page 4 of 20. Did you wash the cells with phosphate buffer saline before adding Trypsin-EDTA? This question is relevant to your assay of AChE activity because fetal bovine serum has substantial AChE activity. If you did not wash the cells, bovine AChE activity may be included in the AChE activity reported for cell lysates.6. Please state the source of midazolam. Which midazolam salt did you use? What solvent was used to dissolve midazolam?7. Page 4 of 20, line 94. Please define the abbreviation BV-2.8. The word “stimulated” is used throughout the text when describing treatment with midazolam. What observation explains your choice of the word “stimulated”. Perhaps the cells proliferated more rapidly in the presence of midazolam?9. Figure 1A. The y axis is labeled AChE/BChE activity, indicating AChE activity was divided by BChE activity. However, the assay measured total AChE and BChE activity because both enzymes hydrolyze the same substrate. Please change the y axis to Cholinesterase activity.10. Figures 1B and 1C. The label on the y axis gives no clue that the assay measures mRNA level. Please modify the label on the y axis to AChE mRNA and BChE mRNA11. The abbreviation ACTB is on the y axis of Figures 1B, 1C, , 2A, 2B, 4A, 4B, 4C, and 4D. Please replace ACTB with a word that is easy to understand. Perhaps the ACTB label is intended to mean that the reported mRNA quantity is relative to the mRNA for beta actin. This should be explained in the figure legend.12. Page 8 of 20, line 178. It is suggested to write “the midazolam antagonist flumazenil reverses midazolam induced effects”13. Figure 2 is missing the letters A and B for panels A and B.14. Figure 2A please change the label on the y axis to AChE mRNA15. Figure 2B please change the label on the y axis to BChE mRNA16. Page 9 of 20. Line 186. Typing error Figure 1A should be Figure 2A.17. Page 9 of 20, lines 194 to 196. Typing error. Figures 2A, 2B, 2C should be Figures 3A, 3B, 3C.18. Figure 3 legend. The words lines and line should be lanes and lane.19. Figure 3C. Please add numbers for DNA sizes. Of special interest are the sizes of the bands in lanes 1 to 7.20. Page 10 of 20, lines 226-227. Typing error. Figures 4A and 4B should be 5A and 5B.21. Conclusion. Line 323. BChE activity is extremely low to almost undetectable in stable cell lines. Your assay measured total cholinesterase activity, which in effect is AChE activity. Please delete the word “activity” in line 323 because BChE activity was not measured.Reviewer #2: This interesting study pursued the epigenetic origin of delirium by focusing on methylation changes in the butyrylcholinesterase(BChE) promoter and seeking the corresponding methylase changes in blood cells from patients treated with Midazolam and in cultured human-originated neuroblastoma cells.The concept is a strength point of this study, but there are weakness points as well, as listed below.1. Why limit the search for methylation but avoid pursuit of microRNAs targeting the cholinesterase mRNA transcripts?2. What is the sex origin of the studied cells and what about the other sex? Pursuing a regulation process in half of humanity seems odd.3. Rather than presenting bar graphs, please shift the graphs into box plots displaying the variability.********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
21 Jun 2022Reviewer #1: Summary: Midazolam is given to patients before surgery. Midazolam is responsible for the delirium experienced by some patients in the days after surgery. Based on previous reports that cholinesterase activity levels are altered in patients who experience delirium, the present work hypothesized that midazolam affects the cholinesterase genes. Stable cell lines and peripheral blood mononuclear cells were assayed for the effect of midazolam on cholinesterase activity and mRNA levels, methylation of cholinesterase genes, demethylation enzyme activity, binding of the BCHE promoter to Histone and neuroinflammation. It was concluded that BCHE gene overexpression may aggravate postoperative delirium.In response: We are pleased that you consider our manuscript to address an important topic, and we are happy to discuss the concerns you raised. Please find below a point-by-point reply addressing your remarks.1. Abstract. Please mention that your studies used human SH-SY5Y neuroblastoma cells, U343 glioblastoma cells, and human peripheral blood mononuclear cells.In response: Thank you very much for this helpful comment. We now included into the abstract in lines 20 and 21:In an in-vitro model containing SH-SY5Y neuroblastoma cells, U343 glioblastoma cells, and human peripheral blood mononuclear cells, we found that midazolam altered the activity of acetylcholinesterase /buturylcholinesterase (AChE / BChE).2. Abstract. Please list the methods used in your study.In response: Thank you very much for this helpful comment. We now included into the abstract in lines 18 till 20:Consequently, we tested the hypothesis that midazolam indeed changes the expression and activity of cholinergic genes by acetylcholinesterase assay and qPCR. Furthermore, we investigated the occurrence of changes in the epigenetic landscape by methylation specific PCR, ChiP-Assay and histone ELISA.3. You find that midazolam increased the level of BChE activity. However, references 16 and 18 report decreased BChE activity in the blood of patients treated with midazolam, on day 1 after surgery. Perhaps the abstract refers to increased BCHE mRNA rather than BChE activity.In response: Thank you again for your valuable comment. Indeed, it is described in literature that BChE activity is decreased 48 hours after surgery, while AChE activity is not affected. In our study we could not differentiate between acetylcholesterase (AchE) or butyrylcholinesterase (BChE) activity as both enzymes can hydrolyze acetylcholine. However, we saw that BCHE mRNA expression slightly decreased after midazolam exposure, which was followed by an increase after 24 hours. Hence, this could depict a feedback mechanism for the initial decrease.4. Page 4 of 20, line 80. Typing error: 2.5% should be 0.25% Trypsin-EDTAIn response: We corrected this typing error.5. Page 4 of 20. Did you wash the cells with phosphate buffer saline before adding Trypsin-EDTA? This question is relevant to your assay of AChE activity because fetal bovine serum has substantial AChE activity. If you did not wash the cells, bovine AChE activity may be included in the AChE activity reported for cell lysates.In response: Thank you very much for this comment. Yes, cell lysate preparation for AChE/BChE activity assay contained a wash step with PBS. We now included in line 111:The proteins were isolated as previously described (20) after washing the cells with PBS.6. Please state the source of midazolam. Which midazolam salt did you use? What solvent was used to dissolve midazolam?In response: We utilized midazolam hydrochloride injection solution from B. Braun, Melsungen. It is dissolved in 10 % HCl and sterile water. We now included in line 94:Briefly, cells were cultured in 6-well culture plates and incubated with 250 ng/ml, 1 µg/ml or 50 µg/ml midazolam (midazolam hydrochloride injection solution, B. Braun Melsungen) for 2, 4 and 24 h, 10 µg/ml and 50 µg/ml flumazenil or were left unstimulated (control).7. Page 4 of 20, line 94. Please define the abbreviation BV-2.In response: I am sorry for not providing you an abbreviation for this cell line. However, the accession number was now included in the test on line 229: neural glial cells (BV-2, RRID:CVCL_0182 )8. The word “stimulated” is used throughout the text when describing treatment with midazolam. What observation explains your choice of the word “stimulated”. Perhaps the cells proliferated more rapidly in the presence of midazolam?In response: Thank you for this comment. I agree that “stimulate” is not neutral wording but implies a change in the cells biochemical processes. Indeed, we incubated the cells to examine putative stimulation. I changed my language and replaced the word “stimulated” by “incubated” or “treated” throughout the whole manuscript.9. Figure 1A. The y axis is labeled AChE/BChE activity, indicating AChE activity was divided by BChE activity. However, the assay measured total AChE and BChE activity because both enzymes hydrolyze the same substrate. Please change the y axis to Cholinesterase activity.Figure 1 has been changed.10. Figures 1B and 1C. The label on the y axis gives no clue that the assay measures mRNA level. Please modify the label on the y axis to AChE mRNA and BChE mRNAFigure 1 has been changed.11. The abbreviation ACTB is on the y axis of Figures 1B, 1C, , 2A, 2B, 4A, 4B, 4C, and 4D. Please replace ACTB with a word that is easy to understand. Perhaps the ACTB label is intended to mean that the reported mRNA quantity is relative to the mRNA for beta actin. This should be explained in the figure legend.The figures were changed and the legends of Figure 2 and 4 were modified.12. Page 8 of 20, line 178. It is suggested to write “the midazolam antagonist flumazenil reverses midazolam induced effects”This was changed.13. Figure 2 is missing the letters A and B for panels A and B.We changed this.14. Figure 2A please change the label on the y axis to AChE mRNA15. Figure 2B please change the label on the y axis to BChE mRNAWe changed this.16. Page 9 of 20. Line 186. Typing error Figure 1A should be Figure 2A.We changed this.17. Page 9 of 20, lines 194 to 196. Typing error. Figures 2A, 2B, 2C should be Figures 3A, 3B, 3C.We changed this.18. Figure 3 legend. The words lines and line should be lanes and lane.We changed this.19. Figure 3C. Please add numbers for DNA sizes. Of special interest are the sizes of the bands in lanes 1 to 7.We added the numbers for DNA size.20. Page 10 of 20, lines 226-227. Typing error. Figures 4A and 4B should be 5A and 5B.We changed this.21. Conclusion. Line 323. BChE activity is extremely low to almost undetectable in stable cell lines. Your assay measured total cholinesterase activity, which in effect is AChE activity. Please delete the word “activity” in line 323 because BChE activity was not measured.We changed this.Again, thank you very much for carefully reading the manuscript. All points you raised were considered and the errors were corrected.Reviewer #2: This interesting study pursued the epigenetic origin of delirium by focusing on methylation changes in the butyrylcholinesterase(BChE) promoter and seeking the corresponding methylase changes in blood cells from patients treated with Midazolam and in cultured human-originated neuroblastoma cells.The concept is a strength point of this study, but there are weakness points as well, as listed below.In response: We are pleased that you consider our manuscript to address an important topic, and we are happy to discuss the concerns you raised. Please find below a point-by-point reply addressing your remarks.1. Why limit the search for methylation but avoid pursuit of microRNAs targeting the cholinesterase mRNA transcripts?In response: Thank you very much for this outstanding comment. We agree that microRNA has a great potential to regulate cholinesterase mRNA expression. However, the search term “cholinesterase microRNA” yields 70 results in pub med. Hence, we conclude that it depicts a relatively good studied mechanism, while to our knowledge methylation of cholinergic genes was not studied at all. We therefore focused on DNA methylation analysis, but will include studying microRNA in our future studies regarding midazolam and cholinergic activity.2. What is the sex origin of the studied cells and what about the other sex? Pursuing a regulation process in half of humanity seems odd.In response: Thank you very much for this interesting comment. We mainly studied SH-SY5Y cells, which are from a female origin. In addition, U-343MG cells were studied, which are from a male origin. To completely circumvent gender specific effects, we utilized PBMCs from healthy controls (5 female and 3 male probands), where no gender dependent effect could be seen. We now included gender distribution into the methods section in line 88 on page 4.3. Rather than presenting bar graphs, please shift the graphs into box plots displaying the variability.In response: Thank you very much for this outstanding comment. We now changed all graphs.In addition, we have now added new data into figure 3 d, where in the previous version “data not shown” was stated.Submitted filename: response to reviewers.docxClick here for additional data file.24 Jun 2022Midazolam impacts acetyl- and butyrylcholinesterase genes: An epigenetic explanation for postoperative delirium?PONE-D-22-13550R1Dear Dr. Rump,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Israel SilmanAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:29 Jun 2022PONE-D-22-13550R1Midazolam impacts acetyl- and butyrylcholinesterase genes: An epigenetic explanation for postoperative delirium?Dear Dr. Rump:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofProf. Israel SilmanAcademic EditorPLOS ONE
Authors: W Lee Titsworth; Jeannette Hester; Tom Correia; Richard Reed; Peggy Guin; Lennox Archibald; A Joseph Layon; J Mocco Journal: J Neurosurg Date: 2012-03-30 Impact factor: 5.115
Authors: Caroline Holtkamp; Björn Koos; Matthias Unterberg; Tim Rahmel; Lars Bergmann; Zainab Bazzi; Maha Bazzi; Hassan Bukhari; Michael Adamzik; Katharina Rump Journal: PLoS One Date: 2019-05-29 Impact factor: 3.240