Molecular lesions in alleles of the Caenorhabditis elegans lin-11 gene.

The LIM homeodomain transcription factor LIN-11 is a key regulator of vulva, uterine, and neuron development in C. elegans. Multiple alleles of lin-11 are available, but none had been sequenced. We found that the reference allele, n389, is a 15900 bp deletion that also affects two other protein-coding genes, ZC247.1 and ZC247.2. The frequently used n566 allele is a 288bp deletion located in an intron and affecting the splice acceptor site. Copyright:

A) Schematic of the right arm of chromosome I in the region of lin-11 , approximately I:10,247,400-10,281,200. Arrows below indicate the location of primers used in sequencing. Deleted regions of both alleles represented with red boxes.

B) Sequence of the n389 allele with 500 bases displayed on each side of deletion and 50 bases flanking the deletion highlighted in yellow. Red highlight indicates position of deletion.

C) Sequence of the n566 allele, shown as in B.

 

Description

LIN-11 is a LIM homeodomain transcription factor (Freyd et al. 1990) expressed in the head muscle, the vulva, the uterus, and some neurons (Freyd, 1991; Hobert et al. 1998; Newman et al. 1999; Sarafi-Reinich et al 2001). Mutations in lin-11 were first identified by Ferguson and Horvitz (1985) in an EMS mutagenesis screen for defects in vulva development. They identified four alleles of lin-11 that are 100% egg-laying defective (Egl) as homozygotes: n382, n389, n566, and n672 . Additional lin-11 alleles ps1, sy251 and ty6 also have defects in the egg-laying apparatus (Nelms and Hanna-Rose 2006; Newman et al., 1999). The reference allele is n389 and considered a null. The n566 allele is used most often, having 71 appearances in Textpresso compared to 47 for n389 , possibly because it is the only one of the four original alleles with hermaphrodites that can mate. The additional alleles are not commonly used, with less than five Textpresso appearances each (Textpresso Central (Müller et al. 2018), “ C. elegans and Suppl ” corpus, accessed June 9, 2022). Freyd et al. (1990) had determined by Southern blot that n389 is lacking the entire probed sequence of ­ lin-11, n566 is a deletion of about 250bp, n672 is an insertion of about 5000bp, and that the mutation in n382 was not detectable by the blot. Despite the common use of n389 and n566 , the precise molecular lesions in these alleles had never been reported.

We PCR-amplified and sequenced the lin-11 genomic region in the n389 and n566 alleles. PCR from worm lysates was performed using Herculase Enhanced DNA Polymerase (Agilent, cat#600260). The n389 allele was amplified using primers oHFS15 and oHFS47 and sequenced using primer oHFS13. The n566 allele was amplified using primers oHFS17 and oHFS18 and sequenced using primer oHFS19. Sanger sequencing was performed by Penn Genomic Analysis Core DNA Sequencing Facility.

We found that n389 is a 15900 bp deletion that affects two additional genes. The left breakpoint is in exon 2 of lin-11 and the right breakpoint is between exons 10 and 11 of ZC247.1 (Fig. 1 A & B). The intervening gene, ZC247.2, is deleted entirely. ZC247.1 is a repeat-rich protein (SMART (Letunic et al., 2021), accessed June 1, 2022) expressed in many neurons, the distal tip cell, and muscle based on transcriptomic data (Kudlow et al., 2012; Li et al., 2020; Taylor et al., 2021). RNAi knockdown of this gene results in germline defects (Green et al., 2011). ZC247.2 is a coiled-coil protein (SMART (Letunic et al., 2021), accessed June 1, 2022) that is expressed in muscle and some neurons (Blazie et al., 2017; Fox et al., 2007; Li et al., 2020; Smith et al., 2010).

We found that n566 is a 288bp deletion in the fourth intron of lin-11 , deleting the C of the splice acceptor site CAG (Fig. 1 A & C). The resulting AAG splice acceptor sequence only occurs in 2% of C. elegans introns and binds less well to the U2AF splicing protein than CAG or UAG (Hollins et al., 2005). While we have not measured effects of this change on splicing or LIN-11 protein production, the 100% Egl yet mating competent phenotype of this allele indicates a significant but incomplete reduction in function.

We conclude that neither commonly used lin-11 allele is a simple knockout of lin-11. Phenotypes seen only in the n389 allele should be examined carefully for possible involvement of the other deleted genes. Future studies should examine more than one allele or use a clean deletion made by CRISPR/Cas9.

Reagents

Primers

Strains

I; V.

I.

Primer name	Sequence
oHFS13	TTCGTGGTCGTTCTTCTTCTTC
oHFS15	CAGAATTACAGAGCTTGCGAAG
oHFS17	CAAGTGAGCCTGAACACATGC
oHFS18	TGCTTTAATTGTCGTTCGAGGG
oHFS19	CTCTGAAGTAACACCGCCAGAC
oHFS47	ACTGTAGGCACACCGTTTGT

Strain	Genotype	Available from
N2	Caenorhabditis elegans, wild type	CGC
MT633	lin-11 ( n389 ) I; him-5 ( e1467 ) V.	CGC
BW837	unc-29 ( e1072 ) lin-11 ( n566 ) I.	CGC