Literature DB >> 35797274

Bombyx mori Vps13d is a key gene affecting silk yield.

Luochao Zhao1, Xia Sun1,2, Xueyang Wang1,2, Sheng Qin1,2, Yunhui Kong1,2, Muwang Li1,2.   

Abstract

Bombyx mori is an important economic insect, its economic value mainly reflected in the silk yield. The major functional genes affecting the silk yield of B. mori have not been determined yet. Bombyx mori vacuolar protein sorting-associated protein 13d (BmVps13d) has been identified, but its function is not reported. In this study, BmVps13d protein shared 30.84% and 34.35% identity with that of in Drosophila melanogaster and Homo. sapiens, respectively. The expressions of BmVps13d were significantly higher in the midgut and silk gland of JS (high silk yield) than in that of L10 (low silk yield). An insertion of 9 bp nucleotides and two deficiencies of adenine ribonucleotides in the putative promoter region of BmVps13d gene in L10 resulted in the decline of promoter activity was confirmed using dual luciferase assay. Finally, the functions of BmVps13d in B. mori were studied using the CRISPR/Cas9 system, and the mutation of BmVps13d resulted in a 24.7% decline in weight of larvae, as well as a 27.1% (female) decline and a 11.8% (male) decline in the silk yield. This study provides a foundation for studying the molecular mechanism of silk yield and breeding the silkworm with high silk yield.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35797274      PMCID: PMC9262180          DOI: 10.1371/journal.pone.0270840

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

High silk yield is one of the most important parameters in silkworm breeding. The silk yield is controlled by multiple genes and is among the quantitative traits [1]. Therefore, it is very necessary to study the functional genes that affect the silk yield in B. mori. It has been reported that the functional genes in B. mori affecting the silk yield have been studied in the level of genes expression preliminarily. In 2015, compared to Bombyx mandarina, 16 up-regulated genes related to protein secretion, tissue development, and energy metabolism were identified in the silk gland transcriptome of B. mori at the third day of fifth instar larval stage [2]. BGIBMGA003330 and BGIBMGA005780 encoding uridine nucleosidase and small heat shock protein respectively were significantly related to cocoon shell weight by comparing the transcriptome of silkworm varieties with different silk yields, which suggested that they played a role in silkworm silk gland development and silk protein synthesis [3]. Recently, Fang et al. confirmed that KWMTBOMO04917 encoding 5-aminolevulinate synthase (BmALAS) and KWMTBOMO12906 encoding DNA polymerase epsilon (Pol ε) subunit 4 (POLE4) in B. mori were highly expressed by quantitative real-time polymerase chain reaction (RT-qPCR) and were positively related to synthesis of silk proteins [4]. Although many studies have provided some insights into the genetic basis of the silk yield, the major functional genes have not been determined yet, and the mechanism of affecting cocoon characters is still unclear. Silk protein is synthesized in silk gland and consists of fibroin and sericin proteins in B. mori [5]. The synthesis of silk protein is associated with the expression of the genes related to bioenergy metabolism, ribosome, and protein transport [1]. It has been studied that vacuolar protein sorting (VPS) proteins belong to the endosomal sorting complex required for transport (ESCRT) and have the functions of protein transport and sorting [6]. They are necessary for sorting ubiquitinated membrane proteins into the multivesicular body (MVB) by deforming them inward and then breaking them to release the newly formed vesicles [7,8]. BmVps13d was identified from the whole genome sequencing of 137 representative silkworm strains with different cocoon characters [9]. It has been reported that Vps13d plays an extremely important role of mild intellectual development and energy metabolism. Cognitive impairment ranging from mild intellectual disability to developmental delay when the function of Vps13d is discorded in humans [10]. Vps13d is an essential gene that is necessary for energy metabolism, growth and development in D. melanogaster, and the loss of this gene affects normal development and even leads it to death. [11]. In HeLa cells, Vps13d-KO exhibits abnormal mitochondrial morphology and leads to either partial or complete peroxisome loss in several transformed cell lines and fibroblasts [12]. In this study, to figure out the functions of BmVps13d in B. mori, the sequence differences and expression levels of BmVps13d in JS and L10 were analyzed first, and then the BmVps13d promoter activity was confirmed. Finally, the BmVps13d mutant B. mori strain was constructed. The results provide some new insights into the mechanism for the improvement of silkworm strains by molecular means and promote superior silkworm strain breeding.

Materials and methods

Silkworm culture and sample preparation

Three silkworm strains, Nistari, JS, and L10 used in this study were provided by the National Sericulture Resources Conservation Center, Chinese Academy of Agricultural Sciences. The Cas9 transgenic silkworms with green fluorescence were retained in our laboratory. The larvae were fed with fresh mulberry leaves at 25°C relative humidity of 72–78%, and cultured under 12 h light and 12 h dark conditions. Midgut, silk gland, and fat body samples were dissected from JS and L10 at the third day of fifth instar larval stage. Larva samples were collected at the beginning and end of each instar respectively. The pupae were taken every 48 h from the first day to the eighth day after pupation. All samples were frozen in liquid nitrogen and stored at -80°C. 30 silkworms were used per biological sample, and three biological replicates were prepared and analyzed. The BmN cell line originating from the B. mori ovary was used [13]. The cells were maintained in TC-100 medium (AppliChem, Gatersleben, Germany) containing 10% fetal bovine serum in 6 cm2 Petri dishes at 27°C.

Bioinformatics analysis

To predict the functions of BmVps13d in B. mori, the amino acid sequences of Vps13d proteins in different species were searched using the BLASTP tool of the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/). Conserved motifs were predicted using the InterPro server (https://www.ebi.ac.uk/interpro/). The amino acid sequences of B. mori, D. melanogaster, and H. sapiens Vps13d proteins were aligned using the GeneDoc software.

RNA isolation and complementary DNA (cDNA) synthesis

The RNA was extracted from each sample using RNAiso Plus (TaKaRa, Dalian, China) according to the manufacturer’s instructions and subsequently was treated with DNase I (Invitrogen, USA) to remove genomic DNA. The integrity and purity of the RNA were determined using gel electrophoresis and ultraviolet spectrophotometry. To synthesize cDNA, one microgram of total RNA was reverse transcribed using an All-in-One™miRNA First-Strand cDNA Synthesis Kit (Gene Copoeia, USA) according to the manufacturer’s instructions.

RT-qPCR analysis

The expression levels of target genes in JS and L10 were detected by RT-qPCR. The cDNA synthesized by total RNA of the midgut, silk gland, and fat body at the third day of fifth instar larval stage in JS and L10 was used as the template. The program of PCR was incubation at 95°C for 5 min, 40 cycles of 95°C for 5 s, and 60°C for 31 s, and a final dissociation. The RT-qPCR was performed in a 10 μL reaction volume that contained 1 μL template, 5 μL 2×NovoStart® SYBR qPCR SuperMix Plus (Novoprotein), 0.2 μL ROX Reference Dye II (ROX II; Novoprotein), and 0.5 μL specific primers (10 μM). Bombyx mori glyceraldehyde-3-phosphate dehydrogenase (Bm GAPDH) was used as the reference gene. The relative expression level of our target gene was calculated by using the cycle threshold value (Ct) by the method of 2-ΔCt, where ΔCt = Cttarget gene−CtBmGAPDH. The comparisons between expressions of these genes were performed with a two-tailed t-test: * P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001. The primers are listed in Table 1.
Table 1

Primers used for RT-qPCR experiment.

Primer nameSequence (5’~3’)Tm (°C)
Bm GAPDH For TTCATGCCACAACTGCTACA 60°C
Bm GAPDH Rev AGTCAGCTTGCCATTAAGAG 60°C
BmVps13d q For TTCTATTGCACTTGGCCGCT 60°C
BmVps13d q Rev AATTCCACACGATCGGTCACT 60°C

Dual luciferase assay

The dual luciferase assay system (Promega) was used to analyze the promoter activities of BmVps13d. By comparing BmVps13d sequence with that of D. melanogaster, the online prediction software Berkeley Drosophila Genome Project was used (http://www.fruitfly.org/seq_tools/promoter.html) to predict putative promoter sequences of BmVps13d and location. Different genomic fragments of BmVps13d containing putative promoter sequences of 2.0 kb from JS and L10 were separately subcloned into a pGL3-basic plasmid between the firefly luciferase open reading frame (ORF) and SV40 poly(A). 5 ng of the pGL3 reporter plasmid, 5 ng of the pRL-TK control plasmid mixed with 0.5μL Lipofectamine 2000 Transfection Reagent (Gibco) were transfected into the BmN cells in each well of a 96-well plate. pRL-TK vector was used to indicate transfection efficiency and used as a positive control. Equal pGL3-Basic plasmid was transfected as negative control. Cells were collected 48 h after transfection, and the relative luciferase activity was measured by normalizing the firefly luciferase level to the Renilla luciferase level. The experiments were performed in triplicate with three technical repeats. Subsequently, the relative luciferase activity (firefly luciferase/renilla luciferase) was measured using a microplate reader (Synergy H1, BioTek).

BmVps13d knockout by CRISPR/Cas9

Two single guide RNAs (sgRNA) were designed for BmVps13d. The sgRNA sites were screened according to the 5ʹ-GG-N18-NGG-3ʹ rule [14]. The sgRNA sequences were predicted for potential off-target binding using CRISPR direct (http://crispr.dbcls.jp/) by performing global searches against silkworm genomic sequences [15]. All sgRNAs and oligonucleotide primer sequences for the single guide RNA (sgRNA) transgenic plasmid construction are listed in Table 2. The sgRNA sequences containing the targets were amplified, using the transgenic vector pXL[IE1-DsRed] as the initial plasmid, and then the sgRNA sequences were connected to the initial plasmid by homologous recombination to obtain the target plasmid. The single guide RNA (sgRNA) transgenic plasmid is expressed by the U6 promoter; it contains the DsRed protein gene and is initiated by IE1 to express the red fluorescent reporter gene. Plasmid map of CRISPR/Cas9 system was showed in S1 Fig. The recombinant plasmid construction was verified by PCR and sequencing. The plasmid was extracted using the QIAGEN Plasmid Midi Kit (QIAGEN GmbH, Germany), and the plasmid concentration was determined by the Nanodrop 1000 Concentration Analyzer (Thermo Fisher, USA).
Table 2

Primers used for RT-qPCR experiment.

Primer nameSequence (5’~3’)Tm (°C)
Target site 1 For TATCGTGCTCTACAAGTGAAAGATGCTCTGCGTCACTGTTTTAGAGCTAGAAATAG 58°C
Target site 1 Rev CTTATCGATACCGTCGAAAAAAAAAGCACCGACTCGGTGCC 58°C
Target site 2 For TATCGTGCTCTACAAGTGCGGACGCGCTTTCGCATGCGTTTTAGAGCTAGAAATAG 58°C
Target site 2 Rev GTTATAGATATCAGCTAGAAAAAAAAGCACCGACTCGGTGCC 58°C
Check-F GTGGAGCTCCAGCTTTTGTT 55°C
Check-R GTGAGTCAAAATGACGCATG 55°C

Screening of double fluorescence

The U6-sgRNA plasmid was mixed with a piggyBac helper plasmid [16] and then microinjected separately into fertilized eggs at the preblastoderm stage. G0 adults were inbred, and the resulting G1 progenies were screened for the single fluorescence using RFP filters (Nikon AZ100). Then the G1 individuals with DsRed fluorescence were mated with Cas9 transgenic silkworms with EGFP fluorescence, and the resulting G2 progenies were screened for double fluorescence to obtain the ΔBmVps13d mutants shown in S2 Fig.

Genomic DNA extraction and mutagenesis analysis

Genomic PCR, followed by sequencing, was used to identify the ΔBmVps13d mutant individuals induced by CRISPR/Cas9 system. Genomic DNA was extracted from heterozygotes with DNA extraction buffer (1:1:2:2.5 ratio of 10% SDS to 5 mol/L NaCl to 100 mmol/L ethylenediaminetetraacetic acid to 500 mmol/L Tris-HCl, pH 8), incubated with proteinase K. Genomic DNA extraction and mutagenesis analysis and purified via a standard phenol: chloroform and isopropanol precipitation extraction, followed by RNaseA treatment. The PCR primers were listed in Table 2. The PCR products covering two target sites were cloned into the pMD19-T (TaKaRa, Dalian, China) vector and directly sequenced.

Investigation of the ΔBmVps13d mutant phenotypes

The whole life cycle of the ΔBmVps13d mutants was observed, and abnormal developmental characteristics were recorded, including the weights of larvae and cocoon characters. 300 silkworms of the ΔBmVps13d mutants and Nistari were divided into ten groups respectively, and each group was weighed every day from the first to the sixth day of fifth instar larval stage. In addition, to investigate the weights of cocoons, pupae, and cocoon shells, 120 male and female ΔBmVps13d mutants and Nistari were divided into 4 groups, and were weighed on the third day after cocooning. The data were statistically analyzed by using a two-tailed t-test.

Results

Characterization of BmVps13d

To study the functions of BmVps13d (SilkDB ID: BGIBMGA002843), the sequence characterizations of Vps13d proteins were obtained and compared in B. mori, D. melanogaster, and H. sapiens (Fig 1). Vps13d proteins in the three species all contained five domains: Chorein_N, VPS13, VPS_mid_pt, SHR-BD, and VPS13_C. Among them, Chorein_N showed mitochondrial localization. SHR-BD was a regulator of cell growth and asymmetric division. The exact functions of other domains were unknown. Besides, BmVps13d protein shared 30.84% and 34.35% identity with that of D. melanogaster and H. sapiens, respectively, which suggested that the Vps13d protein was evolutionarily conserved and might share similar biological functions in different species.
Fig 1

Homology comparison of Vps13d proteins and the domains analysis of Vps13d proteins in B. mori, D. melanogaster, and H. sapiens.

The blue rectangle represents the Chorein_N domain. The red rectangle represents the VPS domain. The yellow rectangle represents the VPS_mid_pt domain. The green rectangle represents the SHR-BD domain. The purple rectangle represents the VPS13_C domain.

Homology comparison of Vps13d proteins and the domains analysis of Vps13d proteins in B. mori, D. melanogaster, and H. sapiens.

The blue rectangle represents the Chorein_N domain. The red rectangle represents the VPS domain. The yellow rectangle represents the VPS_mid_pt domain. The green rectangle represents the SHR-BD domain. The purple rectangle represents the VPS13_C domain.

The expression analysis of BmVps13d

To analyze the functions of BmVps13d in B. mori preliminarily, the expression differences of BmVps13d was detected in the midgut, silk gland, and fat body between JS and L10 at the third day of fifth instar larval stage by using RT-qPCR. The results showed that the expression of BmVps13d were significantly higher in the midgut and silk gland of JS than in that of L10 at the third day of fifth instar larval stage (Fig 2), indicating that the expression difference in the midgut might be related to absorption of nutrients, and the expression difference in silk gland might be related to silk protein.
Fig 2

BmVps13d expression in midgut, silk gland, and fat body of JS and L10 by RT-qPCR.

The histograms show the relative transcript levels of BmVps13d. MG, midgut; SG, silk gland; FAT, fat body. All data are representative of three independent experiments and are expressed as the mean ± standard error of the mean (SEM). A two-tailed t-test is used to evaluate gene expression difference in midgut, silk gland, and fat body between JS and L10 at the third day of fifth instar larval stage. P-values are described as follows: *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001.

BmVps13d expression in midgut, silk gland, and fat body of JS and L10 by RT-qPCR.

The histograms show the relative transcript levels of BmVps13d. MG, midgut; SG, silk gland; FAT, fat body. All data are representative of three independent experiments and are expressed as the mean ± standard error of the mean (SEM). A two-tailed t-test is used to evaluate gene expression difference in midgut, silk gland, and fat body between JS and L10 at the third day of fifth instar larval stage. P-values are described as follows: *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001.

The comparison of BmVps13d putative promoter sequences

No difference was detected in coding sequence of BmVps13d between JS and L10. However, relative expression of BmVps13d showed significant down-regulation in L10 (Fig 2), indicating that cis-regulatory elements might be responsible for BmVps13d down-regulation. To verify it, PCR-amplified 2.0 kb putative promoter sequences of BmVps13d in JS and L10, respectively. Compared to putative promoter sequences of BmVps13d in JS, 9 consecutive nucleotides (ATCAGAAAA) were inserted into putative promoter sequences of BmVps13d in L10, which was 787 bp away from the ATG. Besides, there were two deficiencies of adenine ribonucleotides in putative promoter sequences of BmVps13d in L10 (Fig 3). These results revealed that the differences of putative promoter sequences resulted in the different activity of BmVps13d promoter between JS and L10, and further affected the different expression levels of BmVps13d in both strains.
Fig 3

Cloning and sequence comparison of putative promoters of BmVps13d in JS and L10 genomes.

The sequence alignment of the BmVps13d putative promoters-2.0 kb (2.0 kb) between JS and L10 genomes. JS BmVps13d promoter, the sequence of the BmVps13d putative promoter-2.0 kb (2.0 kb) in JS strain; L10 BmVps13d promoter, the sequence of the BmVps13d putative promoter-2.0 kb (2.0 kb) in L10 strain;---indicates that the sequence is lacking.

Cloning and sequence comparison of putative promoters of BmVps13d in JS and L10 genomes.

The sequence alignment of the BmVps13d putative promoters-2.0 kb (2.0 kb) between JS and L10 genomes. JS BmVps13d promoter, the sequence of the BmVps13d putative promoter-2.0 kb (2.0 kb) in JS strain; L10 BmVps13d promoter, the sequence of the BmVps13d putative promoter-2.0 kb (2.0 kb) in L10 strain;---indicates that the sequence is lacking.

Detection of BmVps13d promoter activity in BmN cells

To verify the differences of the BmVps13d promoter activity resulted from the differences of BmVps13d putative promoter sequences, two plasmids with different BmVps13d putative promoters-2.0 kb of JS and L10 were constructed respectively and transfected into dual-luciferase reporter system in BmN cells. Cells were collected for luciferase activity analysis 48 h after transfection. The pGL3-Basic plasmid was used as a control. The result showed that the activity of BmVps13d promoter in JS was remarkably higher than that of L10 and the control transfected with pGL3-Basic plasmid in BmN cells (Fig 4).
Fig 4

BmVps13d promoter activity of JS is stronger than that of L10 in BmN cells.

The effect of relative luciferase activity driven by BmVps13d promoters of JS and L10. Ctrl., pGL3-Basic-transfected cells; L10_BmVps13d promoter and JS_BmVps13d promoter, cells transfected with BmVps13d promoter-2.0 kb (2.0 kb) in JS and L10 strains, respectively. All data are representative of three independent experiments. A two-tailed t-test is used to evaluate the difference between L10_BmVps13d promoter, JS_BmVps13d promoter, and ctrl. activity. P-value annotations see Fig 2.

BmVps13d promoter activity of JS is stronger than that of L10 in BmN cells.

The effect of relative luciferase activity driven by BmVps13d promoters of JS and L10. Ctrl., pGL3-Basic-transfected cells; L10_BmVps13d promoter and JS_BmVps13d promoter, cells transfected with BmVps13d promoter-2.0 kb (2.0 kb) in JS and L10 strains, respectively. All data are representative of three independent experiments. A two-tailed t-test is used to evaluate the difference between L10_BmVps13d promoter, JS_BmVps13d promoter, and ctrl. activity. P-value annotations see Fig 2.

The construction of the ΔBmVps13d mutants using CRISPR/Cas9

To determine the functions of BmVps13d in B. mori at the individual level, the sgRNA sites were designed on exon 2 and exon 4 of BmVps13d (Fig 5A and 5B). The target vector pXL[IE1-DsRed-U6-Vps13d-sgRNA] was constructed by homologous recombination, which was verified preliminarily by PCR and finally confirmed by sequencing (Fig 4C and 4D). Among injected embryos of Nistari, 52% (n = 250) hatched and 85% of these individuals survived to the adult stage. The efficiency of sgRNA transgenic silkworm screened with red fluorescence was 15–25%. Finally, after the cross of BmVps13d sgRNA and Cas9 transgenic silkworms, the percentage of progenies with double fluorescence was 25%. To evaluate if BmVps13d knockout successfully, genomic DNA was extracted from two randomly-selected larvae with double fluorescence and the DNA fragment containing the target was sequenced. The result showed that we were able to generate a series of different ΔBmVps13d mutants (Fig 6), which could be used the individuals with double fluorescence as mutants for next experiments.
Fig 5

Cas9/sgRNA mediated gene editing of BmVps13d.

(A) Schematic diagram of the sgRNA-target sites in BmVps13d. The purple boxes represent exons, and the black lines represent the gene locus. S1 and S2 are sgRNA sites shared in exon 2 and exon 4, respectively. The sgRNA target sequences are shown in black, and the protospacer adjacent motif (PAM) sequences are in red. (B) PCR amplification of sequences containing the sgRNA-target sites (137 bp). (C) Identification of the recombinant clones by PCR. Lane1, recombinant clone1 (1,337 bp) with sgRNA1 and sgRNA2; Lane5, recombinant clone2 (1,200 bp) with sgRNA1; Lane2-4, the failed recombinant clones. (D) Sequencing to verify the construction of the recombinant vector; the figure shows the partial sequence, the sgRNA target sites are highlighted in black.

Fig 6

CRISPR/Cas9 induces ΔBmVps13d mutation in B. mori.

Nistari is control group; ko1 is a randomly selected mutant silkworm; ko2 is another one randomly selected mutant silkworm; the target site sequence is highlighted in red;---indicates that the sequence knockout.

Cas9/sgRNA mediated gene editing of BmVps13d.

(A) Schematic diagram of the sgRNA-target sites in BmVps13d. The purple boxes represent exons, and the black lines represent the gene locus. S1 and S2 are sgRNA sites shared in exon 2 and exon 4, respectively. The sgRNA target sequences are shown in black, and the protospacer adjacent motif (PAM) sequences are in red. (B) PCR amplification of sequences containing the sgRNA-target sites (137 bp). (C) Identification of the recombinant clones by PCR. Lane1, recombinant clone1 (1,337 bp) with sgRNA1 and sgRNA2; Lane5, recombinant clone2 (1,200 bp) with sgRNA1; Lane2-4, the failed recombinant clones. (D) Sequencing to verify the construction of the recombinant vector; the figure shows the partial sequence, the sgRNA target sites are highlighted in black.

CRISPR/Cas9 induces ΔBmVps13d mutation in B. mori.

Nistari is control group; ko1 is a randomly selected mutant silkworm; ko2 is another one randomly selected mutant silkworm; the target site sequence is highlighted in red;---indicates that the sequence knockout.

Effect of ΔBmVps13d mutation on the body weight and silk yield

ΔBmVps13d silkworms had normal life cycles from embryo to moth. To figure out the influences on absorption of nutrients and cocoon characters, the body weights of ΔBmVps13d and Nistari were investigated from day 1 to 4 of the fifth instar larval stage, as well as cocoon characteristics including the weights of cocoons, pupae, and cocoon shells of the ΔBmVps13d mutants and Nistari on the third day after cocooning. The body weights of the ΔBmVps13d mutants showed a 24.7% decline than that of Nistari at the third day of fifth instar larval stage (Fig 7A). ΔBmVps13d females showed 27.3%, 24.5%, and 24.8% declines in the weights of cocoons, pupae, and cocoon shells respectively; ΔBmVps13d males showed 11.9%, 4.3%, and 5.4% declines in the weights of cocoons, pupae, and cocoon shells respectively; females and males of ΔBmVps13d showed 2.4% and 2.9% declines in the cocoon layer ratio respectively (Fig 7B).
Fig 7

Body weight and cocoon characteristic evaluation of the ΔBmVps13d mutants.

(A) Body weight comparisons of individual silkworms. Samples were collected every 24h from day 1 to 4 of the fifth instar larval stage. (B) Cocoon characteristic comparisons, including the weights of cocoons, pupae, and cocoon shells, Samples: Nistari (black), ΔBmVps13d (grey). A two-tailed t-test is used to evaluate the differences between the Nistari and ΔBmVps13d. P-value annotations see Fig 2.

Body weight and cocoon characteristic evaluation of the ΔBmVps13d mutants.

(A) Body weight comparisons of individual silkworms. Samples were collected every 24h from day 1 to 4 of the fifth instar larval stage. (B) Cocoon characteristic comparisons, including the weights of cocoons, pupae, and cocoon shells, Samples: Nistari (black), ΔBmVps13d (grey). A two-tailed t-test is used to evaluate the differences between the Nistari and ΔBmVps13d. P-value annotations see Fig 2.

Effect of BmVps13d mutation on silk protein gene expression

To study the effect of BmVps13d on the expression level of silk protein genes in B. mori, RT-qPCR was used to detect the relative expression levels of Fib-H, Fib-L, P25 and Sericin-1 in silk gland of △BmVps13d mutant and Nistari at the third day of fifth instar larval stage respectively (Fig 8). The results showed that the mutation of BmVps13d resulted to a significant decrease in the expression of sericin-encoding gene Ser-1, suggesting that BmVps13d had an effect on the synthesis of sericin protein.
Fig 8

The relative expression levels of silk protein genes were detected by RT-qPCR in △BmVps13d mutant and Nistari strain.

The histograms show the relative transcript levels of silk protein genes. Nistari (black)、△BmVps13d (grey). All data are representative of three independent experiments and are expressed as the mean ± standard error of the mean (SEM). A two-tailed t-test is used to evaluate gene expression difference in midgut, silk gland, and fat body between JS and L10 at the third day of fifth instar larval stage. P-values are described as follows: *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001.

The relative expression levels of silk protein genes were detected by RT-qPCR in △BmVps13d mutant and Nistari strain.

The histograms show the relative transcript levels of silk protein genes. Nistari (black)、△BmVps13d (grey). All data are representative of three independent experiments and are expressed as the mean ± standard error of the mean (SEM). A two-tailed t-test is used to evaluate gene expression difference in midgut, silk gland, and fat body between JS and L10 at the third day of fifth instar larval stage. P-values are described as follows: *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001.

Discussion

The ESCRT signal pathway is composed of the peripheral membrane complexes, including ESCRT-0, -I, -II, -III, and Vps4-Vta1, and the ALIX homodimer [17]. Correlational research indicated that beyond MVB formation and endocytosis, ESCRT complexes have crucial functions in cytokinesis, and mitophagy [18-21]. Knocking down BmVps4 resulted in silkworm metamorphosis reduction, including inhibiting silk gland growth, shortening spinning time, prolonging pupation, reducing the pupal size, and weight [22]. According to results of the bioinformatics analysis, BmVps13d belongs to this signal pathway and may have a similar function with BmVps4 in B. mori. It has been reported that Vps13d plays an important role in the ESCRT signal pathway. Vps13d mediate the ESCRT-dependent remodeling of lipid droplet membranes to facilitate fatty acids transfer at mitochondria-LD contacts in mammalian cells [23]. Another study demonstrates that the ubiquitin-binding protein Vps13d functions downstream of the fission factor Drp1 to control the mitochondrial size and autophagic clearance in Drosophila midgut cells. Mitophagy maintains mitochondrial homeostasis and cell health [24]. Besides, Vps13d is an essential gene that is necessary for the development and energy metabolism in D. melanogaster [11]. Combining with the results of homology comparison of Vps13d proteins (Fig 1), we speculated that Vps13d might have similar functions. To preliminarily analyze the functions of BmVps13d in B. mori, we performed expression analysis. The result indicated that the expressions of BmVps13d were significantly higher in the midgut and silk gland of JS than in that of L10 at the third day of fifth instar larval stage (Fig 2). However, the reason for this was unclear. It’s been reported that the genome sequencing analysis of different silkworm strains and the dual luciferase assay revealed that a 10 bp insertion in the putative promoter region of the Bm-app gene in minute wing mutant strain, which decreased Bm-app promoter activity [25]. Therefore, this study further analyzed putative promoter sequences of BmVps13d. In our study, a 9 consecutive nucleotides fragment inserted and two deficiencies of adenine ribonucleotides by found in the putative promoter of BmVps13d in L10, which resulted in decreasing BmVps13d promoter activity in L10 (Fig 3). To further verify BmVps13d promoter activity of JS and L10, we constructed and transfected two plasmids with the BmVps13d putative promoter sequences of JS and L10 into dual-luciferase reporter system in BmN cells, respectively. The result showed that the activity of BmVps13d promoter in JS was remarkably higher than that of the L10 and the control transfecting with pGL3-Basic plasmid in BmN cells (Fig 4). The result verified that the sequence differences of the putative promoters resulted in the different activity of BmVps13d promoter in JS and L10. To further determine the functions of BmVps13d in B. mori, BmVps13d knockout by CRISPR/Cas9-mediated targeted mutagenesis system, which resulted in a decline in body weights, as well as the weights of cocoons, pupae, and cocoon shells in mutant silkworms (Fig 7). It was possible that BmVps13d expression level influenced the ESCRT signal pathway, and resulted in the development and the silk protein synthesis in mutant silkworms finally. The thumbnail image of mitochondrial autophagy mediated by BmVps13d in the ESCRT signal pathway was shown in S3 Fig. Besides, the ΔBmVps13d mutants could grow normally from larvae to adults, indicating that the inactivation of BmVps13d could not influence the normal development of tissues in different stages of silkworm.

Conclusions

In conclusion, this study is first to investigated the influence of BmVps13d on the body wight by CRISPR/Cas9 in B. mori. We propose that BmVps13d may have a great influence on silk production. Our findings provide new insights into BmVps13d gene related to the development, and provide new clues for silkworm breeding with high silk yield.

Plasmid map of CRISPR/Cas9 system.

A, The sgRNA expression vector with red fluorescent protein (RFP) reporter gene; B, The Cas9 expression vector with enhanced green fluorescent protein (eGFP) reporter gene. (TIF) Click here for additional data file.

Identification of positive mutant silkworm.

The picture shows the newly hatched first instar silkworm, scale bar = 1 mm. The red fluorescence, the ΔBmVps13d silkworm contains the sgRNA transgenic plasmid; the green fluorescence, the ΔBmVps13d silkworm contains the non-Cas9 transgenic plasmid. (TIF) Click here for additional data file.

The thumbnail image of the ESCRT signal pathway.

The picture shows the mechanism and process of mitochondrial autophagy and clearance mediated by BmVps13d in ESCRT pathway. (TIF) Click here for additional data file.

The RT-qPCR original data.

(XLSX) Click here for additional data file. (PDF) Click here for additional data file. 24 May 2022
PONE-D-22-12066
Bombyx mori Vps13d is a key gene affecting the silk yield
PLOS ONE Dear Dr. Li, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.
As you can see from the attached comments, both reviewers find the manuscript interesting and novel. However, they recommend to resolve some critical issues (which they highlights in their comments) before acceptance fo publication.
 
I suggest to revise carefully the manuscript according to the reviewers' suggestions.
 
Please, note that the rest of this email is automatically generated.
Please submit your revised manuscript by Jul 04 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, René Massimiliano Marsano, Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf. 2. During your revisions, please confirm whether the wording in the title is correct and update it in the manuscript file and online submission information if needed. Specifically, we believe the title should read 'Bombyx mori Vps13d is a key gene affecting silk yield. 3. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service. Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services.  If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free. Upon resubmission, please provide the following: ● The name of the colleague or the details of the professional service that edited your manuscript ● A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file) ● A clean copy of the edited manuscript (uploaded as the new *manuscript* file) 4. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability. "Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized. Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access. We will update your Data Availability statement to reflect the information you provide in your cover letter 5.PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 6. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The silk yield is an important indicator to measure the quality of silkworm varieties. This paper determined that the difference in BmVps13d gene expression between JS and L10 may be related to the difference in promoter sequence, and verified that BmVps13d gene has an important effect on silk yield of silkworm using the CRISPR/Cas9 system. The findings are interesting and meaningful. It is acceptable after some revision. 1. Why were the sequence characterizations of Vps13d proteins compared in B. mori, D. melanogaster, and H. sapiens in Figure 1? 2. Line 178-180, “The results showed that the expression of BmVps13d were significantly higher in the midgut and silk gland of JS than in that of L10 at the third day of fifth instar larval stage (Fig 2)”. However, Figure 2 does not reflect the expression of BmVps13d significantly higher in the silk gland of JS than in that of L10. It is recommended to provide original data or change the plotting method. 3. Line 252-257, “The body weights of the ΔBmVps13d mutants showed a 24.7% decline than that of Nistari at the third day of fifth instar larval stage (Fig 7 A). ΔBmVps13d females showed 27.3%, 24.5%, and 24.8% declines in the weights of cocoons, pupae, and cocoon shells respectively; ΔBmVps13d males showed 11.9%, 4.3%, and 5.4% declines in the weights of cocoons, pupae, and cocoon shells respectively; 256 females and males of ΔBmVps13d showed 2.4% and 2.9% declines in the cocoon layer ratio respectively (Fig 7 B).” It is known that the body weight of the larvae directly affects the weight of cocoons, pupae, and cocoon shells. Knockout of BmVps13d resulted in reduced larval weight, which directly affected cocoons, pupae, and cocoon shells. Therefore, a direct relationship between the BmVps13d gene and cocoons, pupae, and cocoon shells cannot be demonstrated. Therefore, the conclusion needs to be revised. 4. It is recommended that authors analyze the expression of silk protein genes in Nistari and ΔBmVps13d mutants. Reviewer #2: 1. The promoter sequence in Figure 4 is the same as in Figure 3? 2. Page 6: lines 114-115: the role of pRL-TK vector in dual luciferase assay should be demonstrated. 3. Two sgRNA sites of BmVps13d were designed. Why was only one detected in Figure 6? 4. Page 8: lines 158-160: Why were ΔBmVps13d mutants and Nistari weighed on the third day after cocooning? 5. How about the effect of BmVps13d on the expression of silk protein genes? As an important information, the author should detect it. 6. There are some writing errors in the manuscript, please proofread the full text carefully. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
6 Jun 2022 Reviewer #1: The silk yield is an important indicator to measure the quality of silkworm varieties. This paper determined that the difference in BmVps13d gene expression between JS and L10 may be related to the difference in promoter sequence, and verified that BmVps13d gene has an important effect on silk yield of silkworm using the CRISPR/Cas9 system. The findings are interesting and meaningful. It is acceptable after some revision. 1.Why were the sequence characterizations of Vps13d proteins compared in B. mori, D. melanogaster, and H. sapiens in Figure 1? The functions of Vps13d have been reported in D. melanogaster and H. sapiens, this study predicted and compared the functional domain of this gene protein in B. mori, D. melanogaster and H. sapiens. 2. Line 178-180, “The results showed that the expression of BmVps13d were significantly higher in the midgut and silk gland of JS than in that of L10 at the third day of fifth instar larval stage (Fig 2)”. However, Figure 2 does not reflect the expression of BmVps13d significantly higher in the silk gland of JS than in that of L10. It is recommended to provide original data or change the plotting method. The original data of Figure 2 has been provided in S4_Table. 3. Line 252-257, “The body weights of the ΔBmVps13d mutants showed a 24.7% decline than that of Nistari at the third day of fifth instar larval stage (Fig 7 A). ΔBmVps13d females showed 27.3%, 24.5%, and 24.8% declines in the weights of cocoons, pupae, and cocoon shells respectively; ΔBmVps13d males showed 11.9%, 4.3%, and 5.4% declines in the weights of cocoons, pupae, and cocoon shells respectively; 256 females and males of ΔBmVps13d showed 2.4% and 2.9% declines in the cocoon layer ratio respectively (Fig 7 B).” It is known that the body weight of the larvae directly affects the weight of cocoons, pupae, and cocoon shells. Knockout of BmVps13d resulted in reduced larval weight, which directly affected cocoons, pupae, and cocoon shells. Therefore, a direct relationship between the BmVps13d gene and cocoons, pupae, and cocoon shells cannot be demonstrated. Therefore, the conclusion needs to be revised. The conclusion has been revised in lines 307-309. 4. It is recommended that authors analyze the expression of silk protein genes in Nistari and ΔBmVps13d mutants. The expression of silk protein genes in Nistari and ΔBmVps13d mutants have been analyzed in Lines 263-270. Reviewer #2: 1. The promoter sequence in Figure 4 is the same as in Figure 3? Yes,the promoter sequence in Figure 4 is the same as in Figure 3. 2. Page 6: lines 114-115: the role of pRL-TK vector in dual luciferase assay should be demonstrated. The role of pRL-TK vector in dual luciferase assay has been demonstrated in lines 114. 3. Two sgRNA sites of BmVps13d were designed. Why was only one detected in Figure 6? The target site2 missed the target and was not knocked out successfully. 4. Page 8: lines 158-160: Why were ΔBmVps13d mutants and Nistari weighed on the third day after cocooning? During this period, silkworms have been completely cocooned, and phenotypic investigation is most appropriate at this time. 5. How about the effect of BmVps13d on the expression of silk protein genes? As an important information, the author should detect it. The expression of silk protein genes in Nistari and ΔBmVps13d mutants have been detected in lines 263-270. 6. There are some writing errors in the manuscript, please proofread the full text carefully. We proofread the full text and correct some writing errors in lines 11、14、20、28、70、79、82-83、165、167-170、181、232、292、298、308、309、311. Submitted filename: Response to Reviewers.docx Click here for additional data file. 20 Jun 2022 Bombyx mori Vps13d is a key gene affecting silk yield PONE-D-22-12066R1 Dear Dr. Li, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, René Massimiliano Marsano, Ph.D. Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 24 Jun 2022 PONE-D-22-12066R1 Bombyx mori Vps13d is a key gene affecting silk yield Dear Dr. Li: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. René Massimiliano Marsano Academic Editor PLOS ONE
  24 in total

1.  Efficient CRISPR/Cas9 genome editing with low off-target effects in zebrafish.

Authors:  Alexander Hruscha; Peter Krawitz; Alexandra Rechenberg; Verena Heinrich; Jochen Hecht; Christian Haass; Bettina Schmid
Journal:  Development       Date:  2013-11-20       Impact factor: 6.868

Review 2.  The ESCRT pathway.

Authors:  William M Henne; Nicholas J Buchkovich; Scott D Emr
Journal:  Dev Cell       Date:  2011-07-19       Impact factor: 12.270

Review 3.  ESCRT machinery and cytokinesis: the road to daughter cell separation.

Authors:  Anna Caballe; Juan Martin-Serrano
Journal:  Traffic       Date:  2011-07-27       Impact factor: 6.215

4.  Mitophagy: Vps13D Couples Mitochondrial Fission and Autophagic Clearance.

Authors:  Zheng Wang; Hong Zhang
Journal:  Curr Biol       Date:  2018-01-22       Impact factor: 10.834

5.  Transgene-based, female-specific lethality system for genetic sexing of the silkworm, Bombyx mori.

Authors:  Anjiang Tan; Guoliang Fu; Li Jin; Qiuhong Guo; Zhiqian Li; Baolong Niu; Zhiqi Meng; Neil I Morrison; Luke Alphey; Yongping Huang
Journal:  Proc Natl Acad Sci U S A       Date:  2013-04-08       Impact factor: 11.205

Review 6.  Virus budding and the ESCRT pathway.

Authors:  Jörg Votteler; Wesley I Sundquist
Journal:  Cell Host Microbe       Date:  2013-09-11       Impact factor: 21.023

7.  The evolutionary road from wild moth to domestic silkworm.

Authors:  Hui Xiang; Xiaojing Liu; Muwang Li; Ya'nan Zhu; Lizhi Wang; Yong Cui; Liyuan Liu; Gangqi Fang; Heying Qian; Anying Xu; Wen Wang; Shuai Zhan
Journal:  Nat Ecol Evol       Date:  2018-07-02       Impact factor: 15.460

8.  CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites.

Authors:  Yuki Naito; Kimihiro Hino; Hidemasa Bono; Kumiko Ui-Tei
Journal:  Bioinformatics       Date:  2014-11-20       Impact factor: 6.937

9.  A palmitoyltransferase Approximated gene Bm-app regulates wing development in Bombyx mori.

Authors:  Ye Yu; Xiao-Jing Liu; Xiao Ma; Zhong-Jie Zhang; Tai-Chu Wang; Fan Sun; Cheng-Xiang Hou; Mu-Wang Li
Journal:  Insect Sci       Date:  2018-08-23       Impact factor: 3.262

10.  Genetic and genomic analysis for cocoon yield traits in silkworm.

Authors:  Shou-Min Fang; Qiu-Zhong Zhou; Quan-You Yu; Ze Zhang
Journal:  Sci Rep       Date:  2020-03-30       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.