| Literature DB >> 35795645 |
Wanwei He1, Emanuele C Goes2, Jeremy Wakaruk2, Daniel R Barreda1,2, Douglas R Korver2.
Abstract
Necrotic enteritis (NE) in poultry is an opportunistic infection caused by Clostridium perfringens. Well-known as a multifactorial disease, NE development is under the influence of a wide range of environmental risk factors that promote the proliferation of pathogenic C. perfringens at the expense of nonpathogenic strains. Current in vivo NE challenge models typically incorporate pre-exposure to disease risk factors, in combination with exogenous C. perfringens inoculation. Our goal was to enhance current models using a natural uptake of C. perfringens from the barn environment to produce a subclinical infection. We incorporated access to litter, coccidial exposure (either 10× or 15× of the manufacturer-recommended Coccivac B52 Eimeria vaccine challenge; provided unspecified doses of E. acervulina, E. mivati, E. tenella, and two strains of E. maxima), feed composition, and feed withdrawal stress, and achieved the commonly observed NE infection peak at 3 weeks post-hatch. NE severity was evaluated based on gut lesion pathology, clinical signs, and mortality rate. Under cage-reared conditions, 15× coccidial vaccine-challenged birds showed overall NE lesion prevalence that was 8-fold higher than 10× coccidial vaccine-challenged birds. NE-associated mortality was observed only in a floor-reared flock after a 15× coccidial vaccine challenge.Entities:
Keywords: Clostridium perfringens; broiler chicken; environment; natural infection model; necrotic enteritis
Year: 2022 PMID: 35795645 PMCID: PMC9251903 DOI: 10.3389/fphys.2022.788592
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
FIGURE 1A wide range of environmental factors determines the manifestation of necrotic enteritis (NE) caused by Clostridium perfringens. Chickens are at higher risk to develop NE infection with impaired immune status (A), which can result from declining maternal antibodies and/or pre-exposure to immunosuppressive factors (Lee et al., 2011). The intestine environment also plays a role in virulence modulation of C. perfringens, the first example can be seen in the upregulated toxin expression when in close contact with epithelial cells (B) (Vidal et al., 2009). A complex microbiota environment, compared to a culture medium, can differentially regulate the virulence phenotype of the bacterium via inter and intra strain interactions through bacteriocin production (C) (Ohtani and Shimizu, 2015). Virulent strains are capable of producing bacteriocins that strongly inhibit non-virulent strains, as a mechanism in pathogen-commensal competition (Barbara et al., 2008; Timbermont et al., 2009). Meanwhile, non-virulent strains can inherit the virulence genes horizontally (D), leading to the emergence of new strains that are capable of causing NE (Lacey et al., 2017). Preexisting mucosal damage that exposes epithelial extracellular matrix (E), increased plasma protein leakage and mucus production (F) can provide an extra advantage for pathogenic C perfringens, which possess a stronger binding ability and mucolytic activity (Collier et al., 2008; Martin and Smyth, 2010). Diet components comprising part of the gut environment are also key risk factors associated with NE development (G). For example, feeds rich in water-soluble non-starch polysaccharides, such as a wheat-based diet, can increase digesta viscosity, prolong transit time, and promote pathogen retention (Annett et al., 2002; Shojadoost et al., 2012).
FIGURE 2Induction of subclinical NE in broiler chicken by application of disease predisposing factors. (A) To promote natural development of the already-existing virulent C perfringens in the gut, this disease model incorporated multiple predisposing factors: housing condition, diet components, coccidiosis-induced mucosal damage, and stressor leading to alteration of gut environment. (B) Timeline of animal handling and sampling schedule.
Mortality and intestinal lesion prevalence in three experimental flocks with different flock sizes, housing types, and coccidiosis challenge intensities. Coccidial pre-exposure was incorporated in the NE disease model through oral gavage of live Eimeria oocysts using the Coccivac-B52 vaccine (Merck Animal Health).
| Flock 1 | Flock 2 | Flock 3 | |
|---|---|---|---|
| Flock size | 344 | 120 | 288 |
| Housing type | cage | cage | floor |
| Eimeria dosage | 10× | 15× | 15× |
| Overall mortality (%) | 1.15% | 1.39% | 2.86% |
| Mortality (%), day 18–35 | 0 | 0 | 1.51% |
| Overall lesion prevalence | 10.42% | 85.19% | 80.08% |
A concentrated Coccivac-B52 vaccine was applied at 10× (flock 1) or 15× (flocks 2 and 3) of the recommended dosage. Each bird received 1 ml of vaccine diluted in distilled water.
Ingredient and calculated nutrient composition of experimental diets for birds during starter, grower, and finisher stages.
| Flocks 1 and 2 | Flock 3 | |||||
|---|---|---|---|---|---|---|
| Starter | Grower | Finisher | Starter | Grower | Finisher | |
| Ingredients (%) | ||||||
| Canola meal | 5 | 7.5 | 10 | 7.5 | 10 | 12 |
| Fish meal | 4 | 4 | 4 | - | - | - |
| Soybean meal | 24.05 | 17.62 | 11.75 | 27.96 | 22.44 | 19.38 |
| Wheat | 62.25 | 65.44 | 67.18 | 59.18 | 61.46 | 61.40 |
| Limestone | 0.92 | 0.78 | 0.66 | 1.18 | 1.03 | 0.93 |
| Monocalcium phosphate | 0.43 | 0.20 | - | 1.00 | 0.75 | 0.57 |
| NaCl | 0.30 | 0.30 | 0.30 | 0.27 | 0.26 | 0.26 |
| | 0.06 | 0.06 | 0.92 | 0.10 | 0.07 | 0.02 |
| | 0.26 | 0.22 | 0.2 | 0.30 | 0.25 | 0.23 |
| | 0.05 | 0.03 | 0.01 | 0.05 | 0.01 | - |
| Hy-D® Premix | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 |
| Vitamin Mineral Premix | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 |
| Choline Chloride Premix | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 |
| Phytase | 0.01 | 0.01 | 0.01 | 0.01 | 0.01 | 0.01 |
| Canola oil | 1.62 | 2.79 | 3.92 | 1.86 | 3.12 | 4.63 |
| Mycotoxin binder | 0.05 | 0.05 | 0.05 | 0.15 | 0.15 | 0.15 |
| Xylanase | — | — | — | 0.05 | 0.05 | 0.05 |
| Calculated nutrient composition | ||||||
| Crude protein | 25.5 | 23.62 | 22.65 | 25.2 | 23.58 | 22.73 |
| ME, kcal/kg | 3,000 | 3,100 | 3,200 | 3,000 | 3,100 | 3,200 |
| Calcium | 0.96 | 0.87 | 0.79 | 0.96 | 0.87 | 0.81 |
| Available phosphorus | 0.48 | 0.435 | 0.395 | 0.48 | 0.435 | 0.405 |
Provided 69 µg 25-hydroxycholecalciferol per kg diet.
Provided per kilogram of diet: vitamin A (retinyl acetate), 10,000 IU; cholecalciferol, 4,000 IU; vitamin E (DL-α-tocopheryl acetate), 50 IU; vitamin K, 4.0 mg; thiamine mononitrate (B1), 4.0 mg; riboflavin (B2), 10 mg; pyridoxine HCL (B6), 5.0 mg; vitamin B12 (cobalamin), 0.02 mg; d-pantothenic acid, 15 mg; folic acid, 0.2 mg; niacin, 65 mg; biotin, 1.65 mg; iodine (ethylenediamine dihydroiodide), 1.65 mg; Mn (MnSO4H2O), 120 mg; Cu, 20 mg; Zn, 100 mg, Se, 0.3 mg; Fe (FeSO4·7H2O), 800 mg.
Provided 100 mg choline per kg of diet.
Provided 500 FTU phytase per kg of diet (Phyzyme XP, Danisco Animal Nutrition, Marlborough, United Kingdom).
Biomin II (Biomin Canada Inc. Mont-St-Hilaire, Québec, Canada).
Econase XT, 25 (AB, Vista, Marlborough, United Kingdom) provided 80,000 BXU, of endo-1, 4-beta-xylanase activity per kg diet.
Clostridium perfringens qPCR targeted genes and primer sequences used in this study.
| Target | Sense | Sequence | References |
|---|---|---|---|
| 16S rRNA | Fw | GGGTTTCAACACCTCCGTG | AP017630.1 |
| Rv | GCAAGGGATGTCAAGTGTAGG | ||
| netB | Fw | TGATACCGCTTCACATAAAGGTTGG |
|
| Rv | ATAAGTTTCAGGCCATTTCATTTTTCCG |
FIGURE 3Quantification of C perfringens and intestine lesion confirmed induction of subclinical necrotic enteritis using the natural infection model (A) Detection of C perfringens 16s and netB gene in cecal contents by qRT-PCR. The percentages of animals detected with 16s or netB are plotted within bars. Data were collected from flock 1 (n = 16) (B) Abundance of 16s and netB gene expressed as copy number/g of cecal content. Data were collected from flock 1. T-tests were conducted to compare gene abundance between the age of days 17 and 21. The netB abundance on day 21 was significantly higher than on day 17 (p = 0.0242) (C) Intestine gross lesion prevalence in flock 1 (challenged with 10× concentrated coccidial vaccine) and flock 2 (challenged with 15× concentrate/d coccidial vaccine). The percentages of animals detected with gross lesions are plotted within bars. Fisher’s exact test was conducted to compare the difference between low and high coccidial challenged animals (D17: p < 0.0001, D21: p = 0.0045; D40: p < 0.0001) (D) Lesion scoring results from flock 1 and flock 2. A nonparametric Mann-Whitney test was used to compare the rank of lesion score between two coccidial challenge levels from the same age (D17: p < 0.0001, D21: p = 0.0045, D40: p < 0.0001) (E) Severity of NE-specific lesions was scored from 0 to 3 based on the intestine gross examination. The tissue at the lesion site was processed for the histology analysis. The original magnification of the images is ×25. The necrotic tissue was typically covered by a layer of mixed cellular debris (arrow). Sloughed mucosa leading to complete loss of villi (arrowhead) was observed in intestinal tissue with a score of 3.