| Literature DB >> 35784695 |
Xiaoqing Ding1, Kexin Li1, Dezhi Yang2, Rui Yang3, Dandan Yang4, Haisheng Wang3, Changshan Wang1,5, Xilinqiqige Bao4,6.
Abstract
Objective: Traditional Mongolian Medicine Qiqirigan-8 (MMQ-8) is a Chinese botanical drug with effective pharmacological properties in obesity. However, the pharmacological mechanism of MMQ-8 remains unclear. This study aimed to determine the active metabolites of MMQ-8 and its therapeutic effects on lipid metabolism and inflammation.Entities:
Keywords: anti-inflammation; metabolites; obesity; optimize lipid metabolism; pharmacodynamic evaluation; traditional Mongolian medicine Qiqirigan-8
Year: 2022 PMID: 35784695 PMCID: PMC9240606 DOI: 10.3389/fphar.2022.863532
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
The scoring criteria of NAS.
| Pathological characteristic | Assessment | Score |
|---|---|---|
| Hepatocyte ballooning | none | 0 |
| a little | 1 | |
| a lot | 2 | |
| Lobular inflammation | none | 0 |
| (inflammatory foci/200x | <2 | 1 |
| field of view) | 2–4 | 2 |
| >4 | 3 | |
| Steatosis | <5% | 0 |
| 5%–33% | 1 | |
| 33%–66% | 2 | |
| >66% | 3 | |
| Pathological diagnosis | Total score |
Primers used in this study for RT-PCR.
| Gene | Forward Primer (5’→3′) | Reverse Primer (5’→3′) |
|---|---|---|
| GAPDH | GCGACTTCAACAGCAACTCCC | CACCCTGTTGCTGTAGCCGTA |
| TNF-α | AGTTCTATGGCCCAGACCCTC | TGTCTTTGAGATCCATGCCGTT |
| IRF1 | ACATAACTCCAGCACTGTCACC | TTCCCTTCCTCATCCTCGTCT |
| T-bet | GTATCCTGTTCCCAGCCGTTT | TCATAACTGTGTTCCCGAGGT |
| STAT1 | TCACAGTGGTTCGAGCTTCAG | GCAAACGAGACATCATAGGCA |
| STAT3 | CAATACCATTGACCTGCCGAT | GAGCGACTCAAACTGCCCT |
| STAT4 | TGGCAACAATTCTGCTTCAAAAC | GAGGTCCCTGGATAGGCATGT |
| STAT6 | CTCTGTGGGGCCTAATTTCCA | CATCTGAACCGACCAGGAACT |
| GATA3 | CTCGGCCATTCGTACATGGAA | GGATACCTCTGCACCGTAGC |
| IL-10 | GCTCTTACTGACTGGCATGAG | CGCAGCTCTAGGAGCATGTG |
| RORγt | GACCCACACCTCACAAATTGA | AGTAGGCCACATTACACTGCT |
| IκBα | TGAAGGACGAGGAGTACGAGC | TTCGTGGATGATTGCCAAGTG |
| IL-17A | TTTAACTCCCTTGGCGCAAAA | CTTTCCCTCCGCATTGACAC |
FIGURE 1An overview of MMQ-8 chemical components was detected by UHPLC-QE-MS assay. (A) The fingerprint of MMQ-8 total chemical components in NEG electrospray ionization modes. We marked 33 active metabolites screened according to the Percent Human Oral Absorption and drug likeness values (B) The fingerprint of MMQ-8 total chemical components detected in POS electrospray ionization modes. We marked 43 active metabolites screened according to the Percent Human Oral Absorption and drug likeness values. (C) In total, 642 chemical components of MMQ-8 were obtained, among which flavonoids, terpenoids, phenylpropanoids, phenols, and alkaloids were the most abundant.
Thirty-three MMQ-8 active metabolites have been detected in NEG electrospray ionization modes of UHPLC-QE-MS assay and screened by the Percent Human Oral Absorption and drug-likeness values.
| Peak no. | Chemical components name | InChIKey | Formula | Class | rtmed | MMQ-.8 |
|---|---|---|---|---|---|---|
| 1 | Linoleic acid | OYHQOLUKZRVURQ-HZJYTTRNSA-N | C18H32O2 | Fatty Acyls | 13.86 | 3908299.68 |
| 2 | Scutellarein | JVXZRQGOGOXCEC-UHFFFAOYSA-N | C15H10O6 | Flavonoids | 8.89 | 42271653.76 |
| 3 | Ginkgolic acid C17-1 | MBYNDKVOZOAOIS-FPLPWBNLSA-N | C24H38O3 | Phenolic acids | 14.27 | 360133.87 |
| 4 | Acacetin | DANYIYRPLHHOCZ-UHFFFAOYSA-N | C16H12O5 | Flavonoids | 12.56 | 6993462.76 |
| 5 | Daidzein | ZQSIJRDFPHDXIC-UHFFFAOYSA-N | C15H10O4 | Flavonoids | 13.04 | 28079447.48 |
| 6 | Genistein | TZBJGXHYKVUXJN-UHFFFAOYSA-N | C15H10O5 | Flavonoids | 8.71 | 23184570.51 |
| 7 | Methyl hexadecanoate | FLIACVVOZYBSBS-UHFFFAOYSA-N | C17H34O2 | Fatty Acyls | 12.54 | 228205245.45 |
| 8 | Palmitic acid | IPCSVZSSVZVIGE-UHFFFAOYSA-N | C16H32O2 | Fatty acids | 13.48 | 2829838.42 |
| 9 | Aloeemodin | YDQWDHRMZQUTBA-UHFFFAOYSA-N | C15H10O5 | Quinones | 10.12 | 54173807.97 |
| 10 | Quercetin | REFJWTPEDVJJIY-UHFFFAOYSA-N | C15H10O7 | Flavonoids | 7.94 | 310447894.57 |
| 11 | Pinocembrin | URFCJEUYXNAHFI-UHFFFAOYSA-N | C15H12O4 | Flavonoids | 7.92 | 11150537.32 |
| 12 | isoimperatorin | IGWDEVSBEKYORK-UHFFFAOYSA-N | C16H14O4 | Coumarins and derivatives | 6.71 | 18470601.53 |
| 13 | Fisetin | XHEFDIBZLJXQHF-UHFFFAOYSA-N | C15H10O6 | Flavonoids | 12.14 | 5330818.86 |
| 14 | Prenyletin | AWEFUQDNSBBNCR-UHFFFAOYSA-N | C14H14O4 | Phenylpropanoids | 11.60 | 31376050.12 |
| 15 | Rheic acid | FCDLCPWAQCPTKC-UHFFFAOYSA-N | C15H8O6 | Quinones | 10.48 | 506969375.75 |
| 16 | Oleic acid | ZQPPMHVWECSIRJ-KTKRTIGZSA-N | C18H34O2 | Fatty acids | 17.69 | 107660221.94 |
| 17 | Kaempferol-3-O-rutinoside | RTATXGUCZHCSNG-QHWHWDPRSA-N | C27H30O15 | Flavonoids | 6.39 | 297808697.00 |
| 18 | Ellagic acid | AFSDNFLWKVMVRB-UHFFFAOYSA-N | C14H6O8 | Phenols | 5.88 | 316699609.73 |
| 19 | Di-n-butyl phthalate | DOIRQSBPFJWKBE-UHFFFAOYSA-N | C16H22O4 | Organic acids and derivatives | 12.74 | 15817642.96 |
| 20 | Biochanin A | WUADCCWRTIWANL-UHFFFAOYSA-N | C16H12O5 | Flavonoids | 5.98 | 1370100199.65 |
| 21 | Oxypeucedan hydrate | PEWFWDOPJISUOK-UHFFFAOYSA-N | C16H16O6 | Phenylpropanoids | 5.05 | 377495449.04 |
| 22 | Kaempferide | SQFSKOYWJBQGKQ-UHFFFAOYSA-N | C16H12O6 | Flavonoids | 5.93 | 45821248.89 |
| 23 | Hematoxylin | WZUVPPKBWHMQCE-UHFFFAOYSA-N | C16H14O6 | Flavonoids | 2.88 | 22993795.20 |
| 24 | Isoginkgetin | HUOOMAOYXQFIDQ-UHFFFAOYSA-N | C32H22O10 | Flavonoids | 7.28 | 21679037.51 |
| 25 | Phloretin | VGEREEWJJVICBM-UHFFFAOYSA-N | C15H14O5 | Flavonoids | 8.31 | 7418001.46 |
| 26 | Wedelolactone | XQDCKJKKMFWXGB-UHFFFAOYSA-N | C16H10O7 | Phenylpropanoids | 7.80 | 28242363.39 |
| 27 | Isorhamnetin | IZQSVPBOUDKVDZ-UHFFFAOYSA-N | C16H12O7 | Flavonoids | 9.05 | 379239800.95 |
| 28 | Isoxanthohumol | YKGCBLWILMDSAV-UHFFFAOYSA-N | C21H22O5 | Chalcones | 16.24 | 112424264.07 |
| 29 | 4-[2-(2,6-dimethoxy-4-prop-2-enylphenoxy)-1-hydroxypropyl]-2-methoxyphenol | ULZFTGWWPHYLGI-UHFFFAOYSA-N | C21H26O6 | Miscellaneous | 10.13 | 18399869.54 |
| 30 | Hispidulin | IHFBPDAQLQOCBX-UHFFFAOYSA-N | C16H12O6 | Flavonoids | 4.20 | 136805092.85 |
| 31 | Baicalein | FXNFHKRTJBSTCS-UHFFFAOYSA-N | C15H10O5 | Flavonoids | 18.51 | 4909421.35 |
| 32 | 8-Desoxygartanin | GVQOVMKBYJKZSY-UHFFFAOYSA-N | C23H24O5 | Xanthones | 16.62 | 127605764.90 |
| 33 | Naringenin chalcone | YQHMWTPYORBCMF-ZZXKWVIFSA-N | C15H12O5 | Flavonoids | 2.98 | 12120512.80 |
Forty-three MMQ-8 active metabolites have been detected in POS electrospray ionization modes of UHPLC-QE-MS assay and screened by the Percent Human Oral Absorption and drug-likeness values.
| Peak no. | Chemical components name | InChIKey | Formula | Class | rtmed | MMQ-.8 |
|---|---|---|---|---|---|---|
| 1 | Dehydroglaucine | RZUHGAKUNBFQJS-UHFFFAOYSA-N | C21H23NO4 | Alkaloids | 4.90 | 338700.94 |
| 2 | Prunetin | KQMVAGISDHMXJJ-UHFFFAOYSA-N | C16H12O5 | Flavonoids | 9.56 | 22018287.57 |
| 3 | Biochanin A | WUADCCWRTIWANL-UHFFFAOYSA-N | C16H12O5 | Flavonoids | 7.74 | 554287545.01 |
| 4 | alpha-Linolenic acid | DTOSIQBPPRVQHS-PDBXOOCHSA-N | C18H30O2 | Fatty Acyls | 13.11 | 750206063.91 |
| 5 | Piperanine | QHWOFMXDKFORMO-XVNBXDOJSA-N | C17H21NO3 | Alkaloids | 10.96 | 28890056271.05 |
| 6 | Kaempferol | IYRMWMYZSQPJKC-UHFFFAOYSA-N | C15H10O6 | Flavonoids | 6.30 | 81334291.04 |
| 7 | Rotundine | AEQDJSLRWYMAQI-UHFFFAOYSA-N | C21H25NO4 | Alkaloids | 18.68 | 43512140.81 |
| 8 | 2,3-dihydroxypropyl hexadecanoate | QHZLMUACJMDIAE-UHFFFAOYSA-N | C19H38O4 | Miscellaneous | 16.67 | 153597508.15 |
| 9 | monoolein | RZRNAYUHWVFMIP-KTKRTIGZSA-N | C21H40O4 | Ester | 14.95 | 85289125.39 |
| 10 | Di (2-ethylhexyl)phthalate (DEHP) | BJQHLKABXJIVAM-UHFFFAOYSA-N | C24H38O4 | Miscellaneous | 27.88 | 1853021.65 |
| 11 | Linoleic acid | OYHQOLUKZRVURQ-HZJYTTRNSA-N | C18H32O2 | Fatty Acyls | 16.62 | 134004328.85 |
| 12 | Tanshinone IIA | HYXITZLLTYIPOF-UHFFFAOYSA-N | C19H18O3 | Diterpenoids | 14.13 | 35506306.90 |
| 13 | (2E,4E)-N-(2-methylpropyl)deca-2,4-dienamide | MAGQQZHFHJDIRE-BNFZFUHLSA-N | C14H25NO | Miscellaneous | 12.50 | 9498955663.63 |
| 14 | 4-[4-(4-chlorophenyl)-4-hydroxypiperidin-1-yl]-N,N-dimethyl-2,2-diphenylbutanamide | RDOIQAHITMMDAJ-UHFFFAOYSA-N | C29H33ClN2O2 | Alkaloids | 5.08 | 595202.27 |
| 15 | Glycitein | DXYUAIFZCFRPTH-UHFFFAOYSA-N | C16H12O5 | Flavonoids | 4.25 | 61336663.26 |
| 16 | Laudanoside | KGPAYJZAMGEDIQ-UHFFFAOYSA-N | C21H27NO4 | Alkaloids | 18.36 | 814876194.31 |
| 17 | Baicalein | FXNFHKRTJBSTCS-UHFFFAOYSA-N | C15H10O5 | Flavonoids | 11.80 | 18364679.77 |
| 18 | Remerine | JCTYWRARKVGOBK-UHFFFAOYSA-N | C18H17NO2 | Alkaloids | 9.57 | 20462783.36 |
| 19 | suberosin | RSZDAYHEZSRVHS-UHFFFAOYSA-N | C15H16O3 | Phenylpropanoids | 7.69 | 40617001.09 |
| 20 | Boldine | LZJRNLRASBVRRX-UHFFFAOYSA-N | C19H21NO4 | Alkaloids | 5.40 | 130502155.57 |
| 21 | Tectochrysin | IRZVHDLBAYNPCT-UHFFFAOYSA-N | C16H12O4 | Flavonoids | 6.90 | 899216497.98 |
| 22 | Higenamine | WZRCQWQRFZITDX-UHFFFAOYSA-N | C16H17NO3 | Alkaloids | 9.03 | 20164741.63 |
| 23 | Cinchonine | KMPWYEUPVWOPIM-UHFFFAOYSA-N | C19H22N2O | Alkaloids | 11.65 | 16887401.82 |
| 24 | Musk ketone | WXCMHFPAUCOJIG-UHFFFAOYSA-N | C14H18N2O5 | Alkaloids | 9.49 | 13299260.88 |
| 25 | Zizyberanalic acid | SLWJVQQNDGLXTK-UHFFFAOYSA-N | C30H46O4 | Terpenoids | 12.59 | 59303945.96 |
| 26 | Propranolol | AQHHHDLHHXJYJD-UHFFFAOYSA-N | C16H21NO2 | Benzenoids | 9.38 | 74955671.48 |
| 27 | xanthohumol | ORXQGKIUCDPEAJ-YRNVUSSQSA-N | C21H22O5 | Flavonoids | 10.07 | 83091714.83 |
| 28 | Naringenin chalcone | YQHMWTPYORBCMF-ZZXKWVIFSA-N | C15H12O5 | Flavonoids | 7.58 | 30710288.38 |
| 29 | Formononetin | HKQYGTCOTHHOMP-UHFFFAOYSA-N | C16H12O4 | Flavonoids | 9.29 | 31752046.23 |
| 30 | Papaverine | XQYZDYMELSJDRZ-UHFFFAOYSA-N | C20H21NO4 | Alkaloids | 9.99 | 12503204.08 |
| 31 | Chlorpheniramine | SOYKEARSMXGVTM-UHFFFAOYSA-N | C16H19ClN2 | Alkaloids | 5.71 | 5190412.73 |
| 32 | Allethrin | ZCVAOQKBXKSDMS-UHFFFAOYSA-N | C19H26O3 | Terpenoids | 11.34 | 133359654.70 |
| 33 | Daidzein-8-C-glucoside | HKEAFJYKMMKDOR-UHFFFAOYSA-N | C21H20O9 | Flavonoids | 7.05 | 16799822.33 |
| 34 | Apigenin | KZNIFHPLKGYRTM-UHFFFAOYSA-N | C15H10O5 | Flavonoids | 8.73 | 22348134.67 |
| 35 | 2-(8-hydroxy-4a,8-dimethyl-1,2,3,4,5,6,7,8a-octahydronaphthalen-2-yl)prop-2-enoic acid | FXKCXGBBUBCRPU-UHFFFAOYSA-N | C15H24O3 | Terpenoids | 12.61 | 103129070.76 |
| 36 | Wedelolactone | XQDCKJKKMFWXGB-UHFFFAOYSA-N | C16H10O7 | Phenylpropanoids | 5.44 | 34482940.62 |
| 37 | Isoliquiritigenin | DXDRHHKMWQZJHT-FPYGCLRLSA-N | C15H12O4 | Flavonoids | 7.61 | 58007436.18 |
| 38 | Lysionotin | KRFBMPVGAYGGJE-UHFFFAOYSA-N | C18H16O7 | Flavonoids | 8.15 | 9912440.23 |
| 39 | Dihydrocapsaicin | XJQPQKLURWNAAH-UHFFFAOYSA-N | C18H29NO3 | Alkaloids | 8.36 | 95100671.72 |
| 40 | Daidzein | ZQSIJRDFPHDXIC-UHFFFAOYSA-N | C15H10O4 | Flavonoids | 6.14 | 27867169.51 |
| 41 | Dubinidine | NETGEQWGGLFVRL-UHFFFAOYSA-N | C15H17NO4 | Alkaloids | 8.98 | 193406036.72 |
| 42 | Dehydrodiisoeugenol | ITDOFWOJEDZPCF-UHFFFAOYSA-N | C20H22O4 | Lignans | 10.77 | 40344890.10 |
| 43 | Isorhamnetin | IZQSVPBOUDKVDZ-UHFFFAOYSA-N | C16H12O7 | Flavonoids | 6.40 | 141579166.87 |
FIGURE 2continued
FIGURE 3MMQ-8 optimizes lipid metabolism in obesity. (A) Statistics of body weight in each month. (B) Results of body weight in the 10th month. (C) White adipose tissue weight, which includes adipose tissue above the epididymides and around the kidneys. MMQ-8 treatment significantly decreased body weight and white adipose tissue weight. (D) Levels of serum lipids measured every 3 months. Serum levels of TC, TG, and LDL-C were decreased and the serum levels of HDL-C were increased after MMQ-8 treatment in obese rats with hyperlipidemia. Data are presented as means ± SD, n = 8, *p < 0.05, **p < 0.01.
FIGURE 4MMQ-8 significantly reduced hepatic steatosis and improved liver function in obese rats fed an HFD. (A) Levels of serum hepatic functional marker AST. (B) Levels of serum hepatic functional marker ALT. Serum hepatic functional markers were reversed by MMQ-8 treatment. This suggested that MMQ was safe and did not cause liver toxicity. (C) Liver wet weights. (D) NAS of liver H&E staining images. (E) Representative H&E staining of liver (n = 6). (F) Representative Oil red O staining of liver (n = 6). MMQ-8 treatment significantly reduced hepatic steatosis. (G) MMQ-8 treatment decreased the phosphorylation levels of IκBα in liver tissue (H) MMQ-8 treatment decreased the phosphorylation levels of ERK1/2 in liver tissue. (I) MMQ-8 treatment decreased the phosphorylation levels of p38 in liver tissue. (J) MMQ-8 treatment decreased the phosphorylation levels of SAPK/JNK in liver tissue. MMQ-8 reduced liver protein phosphorylation levels of the TNF signaling pathway in obese rats. Data are presented as means ± SD, n = 8, *p < 0.05, **p < 0.01.
FIGURE 5MMQ-8 treatment significantly inhibited inflammation and vascular injury. MMQ-8 treatment significantly decreased serum levels of pro-inflammatory factors TNF-α, IL-6, and INOS and elevated the serum level of anti-inflammatory factor IL-10. (A) Serum levels of TNF-α. (B) Serum levels of IL-6. (C) Serum levels of INOS. (D) Serum levels of IL-10. (E) MMQ-8 treatment reduced vascular endothelium damage, smooth muscle cell proliferation, and foam cell formation. Representative H&E staining of arteries (n = 6). (F) MMQ-8 decreased the number of macrophages and increased macrophage polarization to M2 in artery walls. Representative images of artery immunohistochemistry staining for CD68 and CD206 (n = 6). (G) MMQ-8 treatment decreased the phosphorylation levels of IκBα in blood vessels (H) MMQ-8 treatment decreased the phosphorylation levels of ERK1/2 in vasculature. (I) MMQ-8 treatment decreased the phosphorylation levels of p38 in vasculature. (J) MMQ-8 treatment decreased the phosphorylation levels of SAPK/JNK in vasculature. MMQ-8 reduced the vascular protein phosphorylation levels of the TNF signaling pathway in obese rats. Data are presented as means ± SD, n = 3, *p < 0.05, **p < 0.01.
FIGURE 6Continued