Quercetin Inhibits KBM7R Cell Proliferation through Wnt/β-Catenin Signaling.

Background: Tyrosine kinase inhibitors could treat chronic myelogenous leukemia (CML) effectively, but they have no effect on patients with T315I mutation. It is necessary to find drugs to overcome the resistance. Quercetin (Qu) is a kind of bioflavonoid with an antitumor effect. In this study, we observed the effect of Qu on proliferation and Wnt/β-catenin pathway in KBM7R cells, an imatinib-resistant cell with T315I mutation.
Methods: The IC50 of Qu was detected by trypan blue staining. The KBM7R cell apoptosis and cycle were detected through the method of flow cytometry (FCM). The expression of the related mRNA and protein was evaluated by means of an RT-PCR assay and western blot in KBM7 (sensitive to IM) and KBM7R cells.
Results: These results showed that in the KBM7R cell, the proliferation inhibition effect was increased after 48 h administration with different Qu concentrations. The IC50 to Qu was 241.7 μmol/L. The different doses of Qu (50, 100, and 200 μmol/L) would raise apoptosis and depress the cell cycle at the G1 phase. Dealing with a median Qu concentration (100 μmol/L) for 48 h, the mRNA and the protein level of caspase-3, caspase-8, and caspase-9 along with p21 and p27 raised compared with the control. The median concentration of Qu could inhibit both the mRNA and protein levels of GSK-3β, β-catenin, and Lef-1 in the Wnt/β-catenin signal pathway and also the downstream targets PPAR-δ and cyclin D1 in both KBM7 and KBM7R cells. Conclusions: Our findings suggest that Qu could inhibit proliferation, induce apoptosis, and arrest the cell cycle on IM-resistant KBM7R cells with T315I mutation. And this effect could be related with the inhibition of the Wnt/β-catenin signal pathway and downstream targets.

1. Introduction

CML (chronic myelogenous leukemia) is a disease with a myeloproliferative disorder in hematopoietic stem cells, and its character shows the expression of the BCR-ABL fusion oncoprotein and the Philadelphia chromosome [1]. Imatinib (IM), a tyrosine kinase inhibitor (TKI), has changed CML therapy. But due to the occurrence of BCR-ABL kinase mutations, such as Y253 H, E255 K, F359 V, G250 E, F317 L, E355 G, H396 P, T315I, and so on, which are related with drug resistance, limits the therapy [2]. The new-generation TKI, dasatinib, nilotinib, and bosutinib still have fewer effects on CML patients with T315I mutation. And clinical scientists are able to overcome the drug resistance caused by T315I mutation for the moment.

Quecetin (Qu) is a natural and bioactive flavonoid compound which has multiple pharmacological actions. Previous studies show that Qu is proposed as a potential anticancer agent. Qu combination with other drugs has been used in treatment of several cancers in order to obtain synergistic effects and reduce side effects [3]. We take the CML cell line KBM7R, with T315I mutation and resistance to IM as the object and observe the action of Qu on multiplication, apoptosis, and cell cycle, and analyze the Wnt/β-catenin signaling change.

2. Methods

2.1. Cell Lines and Culture Conditions and Agents

The KBM7R cells with the T315I mutant CML cell line (Human) provided by Harbin Institute of Hematology and Tumor (Harbin, China) were cultured in a 1640 medium (Gibco, New York, USA) in an incubator containing 10% FBS at 37°C with 5% CO2. Quercetin was provided by Sigma (St. Louis, MO, USA). It was dissolved into dimethyl sulphoxide (DMSO) to the final concentration of 20 mmol/L and preserved at −20°C.

2.2. Cell Proliferation Assay with Trypan Blue Test

About 2 × 104 KBM7R cells per well were seeded into 96-well plates in triplicate. Cells were incubated for 48 h with different concentrations of Qu from 5 μmol/L to 320 μmol/L. The trypan blue assay detected cell viability. Nonviable cells showed a blue stain. The following formula was calculated for cell viability: cell viability = (viable cell number in the experimental group/viable cell number in the DMSO group) × 100%. This experiment was performed three times. The IC50 of Qu was calculated by GraphPad Prism software.

2.3. Apoptosis and Cell Cycle Detection

The culture dish with approximately 2 × 106 KBM7R cells was managed and supplemented with DMSO (1%, v/v) for 48 h as a control and different concentrations of quercetin (50 μmol/L, 100 μmol/L, and 200 μmol/L), respectively. Then these cells were collected and prepared for apoptosis and cell cycle assay. Flow cytometry assay was performed as described previously [4].

2.4. Western Blotting

Approximately 2 × 106 cells were managed for 48 h at the concentration of 100 μmol/L quercetin. Western blotting was performed as described previously [4]. Antibodies against GSK-3β/p-GSK-3β, β-catenin/p-β-catenin, Lef-1, cyclin D1, and BCR-ABL /p-BCR-ABL were provided form Santa Cruz company (CA, USA), PPAR-δ from Millipore (Boston, USA), caspase-3, caspase-8, and caspase-9 from BioVision (San Francisco, USA), β-actin from HaiGene company (Heilongjiang, China).

2.5. PCR and Primer

Approximately 2 × 106 KBM7R cells were dealt with quercetin (100 μmol/L) in the culture dish for 48 h. According to the product protocol, the total RNA was extracted and the quantitative RT-PCR experiment was performed. The 2−ΔΔCt method was used to perform a relative quantitative assay in triplicate. The real-time fluorescence quantitative PCR was used to evaluate the BCR-ABL copy as described previously [4]. Table 1 shows the primers sequence.

Table 1

The primer sequence (5′–3′).

	Primer sequence (5′–3′)
GSK-3β	F	GTGATACCATACTCAGGAGTGG
	R	CTGGTGCTACACTAAGTCCCT 160 bp
β-Catenin	F	GTGTGGCGACATATGCAGCT
	R	CAAGATCAGCAGTCTCATTC 141 bp
Lef-1	F	GCCACGGACGAGATGATCC
	R	TGTCTGGCCACCTCGTGTC 170 bp
PPAR-δ	F	GTGATACCATACTCAGGAGTGG
	R	CTGGTGCTACACTAAGTCCCT 110 bp
Cyclin D1	F	GATGCCAACCTCCTCAACGAC
	R	CTCCTCGCACTTCTGTTCCTC 171 bp
β-Actin	F	TTGCGTTACACCCTTTCTT
	R	CACCTTCACCGTTCCAGT 147 bp

2.6. Statistical Assay

Both statistical assays were performed by SPSS 16.0 software. These data were shown as mean ± standard deviation. Student's t-test analyzed significance, and P values (<0.05) showed statistical significance.

3. Results

3.1. Quercetin Had Impacts on Proliferation and Apoptosis and the Cell Cycle

The trypan blue assay results showed that different concentrations of Qu could inhibit the proliferation (Figure 1), and IC50 was 241.7 μmol/L after calculation. After administration of 50, 100, and 200 μmol/L Qu, the KBM7R apoptosis rates were 12.37%, 31.43%, and 42.41%, respectively (Figure 2(a)). These apoptosis-related gene caspase-3, caspase-8, and caspase-9 mRNA expression ascended compared with the control. And their protein expression also increased (Figures 2(b) and 2(c)). 50, 100, and 200 μmol/L of Qu arrested cell cycle at the G1 phase, and the percentages were 51.54%, 61.29%, and 67.86%, respectively (Figure 3(a)). Compared with the control, Qu could promote the mRNA expression of P21 and P27. Meanwhile, P21 and P27 protein expression increased (Figures 3(b) and 3(c)).

Figure 1

Qu inhibits the proliferation of KBM7R cells.

Figure 2

Qu induced apoptosis in KBM7R cells.

Figure 3

Qu arrested KBM7R cells at the G1 phase.

3.2. Quercetin Could Inhibit Wnt/β-Catenin Signaling

In both KBM7 and KBM7R cells, we found that after administration of 100 μmol/L Qu for 48 h, the mRNA expression of the member and the target of Wnt/β-catenin signaling, GSK-3β, β-catenin, Lef-1, PPAR-δ, and cyclin D1 all decreased compared with the control (P < 0.01) (Figure 4(a)). Their corresponding protein level all decreased (Figure 4(b)). Therefore, it indicated that Qu could inhibit the Wnt/β-catenin signal.

Figure 4

Qu inhibited Wnt-β-catenin signaling.

3.3. Quercetin Could Decrease the mRNA Expression of BCR-ABL

We also detected the BCR-ABL expression in both KBM7 and 7R cells. Qu (100 μmol/L) could make about 30% cut of BCR-ABL mRNA expression (P < 0.05) in two cell lines (Figure 5(a)). But the BCR-ABL and phosphorylated protein had no obvious change (Figure 5(b)).

Figure 5

The effect of Qu on BCR-ABL expression.

4. Discussion

Qu is an inhibitor of Wnt/β-catenin signaling [5], which play a vital function in tumor initiation and progression [6]. Increasing research shows that Wnt/β-catenin pathway dysregulation is involved with the development and progression of hematological malignancies. This signaling has a strong relation with self-renew and maintenances CML stem/progenitor cells [7, 8] and also plays a role in the CML blastic phase [9]. In view of this pathway function, it would become a potential target for CML treatment [10]. The current and common CML cell lines for research include K562, KBM5, KBM7, and homologous drug-resistant cells. The resistance to IM cells K562 R and KBM5R were induced by low-dose IM gradually, and KBM7R cells were carried with T315I mutation. The cells K562/K562 R are frequently used. The current research reported that the IC50 of KBM7 was 0.3 μmol/L and IC50 of KBM7R for IM was 5 mol/L, respectively [11]. Our results showed that IC50 of KBM7 and KBM7R was 0.28 μmol/L and 4.71 μmol/L, respectively. Accordingly, the IM resistance time was about 17 and similar to previous reports. So KBM7R is considered to be an appropriate cell drug resistance model for study. Our previous study has confirmed that Qu has inhibited the proliferation on KBM7 cell [4] and the IC50 of Qu was 107.6 μmol/L. This study showed that the IC50 of Qu was 241.7 μmol/L in the KBM7R cells. Therefore, the resistance time was 2.25. Compared with IM, Qu could improve the resistance greatly. Qu also induces the apoptosis of KBM7R in a dose-dependent manner, and it might be related with the increased caspase-3, caspase-8, and caspase-9 levels.

The transcription factor β-catenin is the pivotal component which is mediated by GSK3β for Wnt/β-catenin cascade. Subsequently, β-catenin interacts with Lef-1 to trigger the signal target genes such as PPAR-δ and cyclin D1. These results showed that Qu could inhibit this signal, and the gene and protein expression of cascade members were decreased in both sensitive and resistant cells. PPAR-δ is one of the targets of Wnt signaling and plays an important role in tumor proliferation [12]. Some studies reported that PPAR-δ expression increased in some solid tumors, such as colon cancer [13] and skin cancer [14], but the PPAR-δ action is not clear in CML so far. After administration of Qu, the PPAR-δ expression decreased, so it could be related with proliferation inhibition. Another target, cyclin D1, which is a key cell cycle regulator, has a crucial effect in cancer growth. Cyclin D1 decreased after administration of Qu and simultaneously P21 and P27 protein expressions increased. It suggests that these genes take part in cell cycle arrest.

5. Conclusion

Briefly, Qu could inhibit the proliferation of IM-resistant KBM7R cells and reduce the resistance. Moreover, the apoptosis increased and the cell cycle was arrested in the G1 phase. Meanwhile, Qu inhibited the Wnt/β-catenin signal pathway members' expression in both sensitive KBM7 and resistant KBM7R cells. Then, the expression of PPAR-δ and cyclin D1, the downstream targets of this signaling, and BCR-ABL gene expression were also reduced in both cells. The suppressed pathway might be involved in the effect of overcoming IM resistance. In this study, we only found the inhibition effect of Qu on CML in vitro, and its action should be testified in vivo in future. Moreover, the possibility would be investigated that Qu combined with chemotherapy drugs had a synergistic reaction and decrease the side effects.