Literature DB >> 35771885

Rapid detection of methicillin-resistant Staphylococcus aureus in positive blood-cultures by recombinase polymerase amplification combined with lateral flow strip.

Arpasiri Srisrattakarn1, Pimchanok Panpru1, Patcharaporn Tippayawat1,2, Aroonwadee Chanawong1,2, Ratree Tavichakorntrakool1,2, Jureerut Daduang1,2, Lumyai Wonglakorn3, Aroonlug Lulitanond1,2.   

Abstract

Staphylococcus aureus, especially methicillin-resistant S. aureus (MRSA), is an important bacterium that causes community and healthcare-related infections throughout the world. However, the current conventional detection methods are time-consuming. We therefore developed and evaluated a recombinase polymerase amplification-lateral flow strip (RPA-LF) approach for detection of MRSA in positive blood-culture samples. Sixty positive blood-cultures from a hospital were tested directly without DNA extraction and purification before the amplification reaction. RPA primers and probes were designed for nuc (encoding thermonuclease) and mecA (encoding penicillin-binding protein 2a) genes to diagnose S. aureus and its methicillin-resistance status. The RPA reaction occurred under isothermal conditions (45°C) within 20 min and a result was provided by the LF strip in a further 5 min at room temperature. The evaluation of RPA-LF using blood-culture samples showed 93.3% (14/15) sensitivity for identifying S. aureus, and no cross-amplification was seen [100% (45/45) specificity]. For detection of methicillin resistance, the RPA-LF test provided 100% (16/16) sensitivity and 97.7% (43/44) specificity. The RPA-LF is rapid, highly sensitive, robust and easy to use. It can be used for direct detection of MRSA with no requirement for special equipment.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35771885      PMCID: PMC9246191          DOI: 10.1371/journal.pone.0270686

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Staphylococcus aureus is a Gram-positive bacterium that causes a wide variety of diseases. Its pathogenic potential ranges from minor to severe, the latter category including bloodstream infection and sepsis [1]. Several virulence factors of S. aureus cause inflammation and impair immune cell function, thus contributing to serious pathogenesis, which increases the risk of death [2]. S. aureus also produces an extracellular thermonuclease, encoded by the nuc gene, presence of which is commonly used to distinguish S. aureus from the other Staphylococcus spp. [3]. Methicillin-resistant S. aureus (MRSA) is now highly prevalent globally and is the biggest threat among Gram-positive pathogens [4]. The resistance depends on the production of a new penicillin-binding protein (PBP2a or PBP2′) encoded by the mecA gene. Patients infected with MRSA have a mortality rate about three times higher than those with methicillin-susceptible S. aureus [5-7]. Therefore, rapid and accurate detection methods for MRSA in bacteremia are essential for clinical diagnosis to facilitate a specific antimicrobial therapy and reduce the risk of mortality. The reference standard methods for the detection of MRSA in the blood are traditional culture-biochemical and susceptibility-testing methods. A positive result means bacteria or fungi are present in the blood (positive blood-culture). A negative result means that no signs of any bacteria or fungi were found in the blood. However, they are time-consuming (48–72 h) and laborious [6]. Nucleic-acid amplification tests, such as PCR-based methods, aim for rapid and accurate detection of MRSA, thus avoiding the drawbacks of conventional methods [7]. However, they need special equipment and trained personnel, making them difficult and impractical as point-of-care methods [6, 8]. Recombinase polymerase amplification (RPA) is an isothermal method for DNA amplification that is a promising alternative to PCR. It relies on the actions of three core proteins: recombinase, single-stranded DNA-binding (SSB) protein, and strand-displacing polymerase. The recombinase facilitates the binding of primers with DNA complementary sequences. Polymerase initiates DNA synthesis, whereas the SSB protein stabilizes the DNA strand to prevent primer displacement [9]. RPA is highly sensitive, rapid, and does not require a thermal cycler. It can amplify the target gene across a temperature range from 25 to 45°C within 3–20 min [10]. Moreover, the RPA reaction is also likely to be more robust to the presence of inhibitors than is the PCR method [11, 12]. Currently, amplicons generated by RPA can be detected using agarose gel electrophoresis (AGE), real-time fluorescence and lateral flow (LF) strip. However, the AGE and real-time fluorescence methods need expensive devices and are inconvenient in a hospital setting [13-15]. Detection of RPA products using LF devices is an approach increasingly used for detection of infectious pathogens because it is simple, rapid and readable by the naked eye [16, 17]. Clinical samples often contain both coagulase-negative staphylococci and S. aureus, all of which can carry the mecA gene [7]. Therefore, detection of mecA alone is insufficient for therapeutic decisions: samples should be tested for S. aureus in parallel with detection of the mecA gene. We previously established an RPA-LF assay for detection of the mecA gene (mecA-RPA-LF) [18]. In the present study, we developed an additional RPA-LF assay for nuc gene detection (nuc-RPA-LF) and evaluated the performance of both assays (nuc-RPA-LF and mecA-RPA-LF) for the detection of MRSA directly in positive blood-cultures from the hospital.

Materials and methods

Microbial isolates and DNA extraction from colonies

Fifty-six isolates (26 S. aureus and 30 non-S. aureus) collected from the Clinical Microbiology Unit, Srinagarind Hospital, Khon Kaen University, Thailand during 2010–2019 [18] (S1 Table) were cultured on blood agar (Oxoid, Hampshire, UK) at 37°C for 24 h. DNA was extracted from colonies using the achromopeptidase method [19] or boiling methods. All fifty-six isolates were used for evaluating the performance of the chosen primer set on RPA-AGE test for detection of MRSA colonies.

Clinical samples

Sixty blood-culture bottles, identified as positive by the BacT/Alert® Virtuo Microbial Detection System (bioMérieux, Marcy l’Etoile, France) and in which pathogens were identified by conventional biochemical tests and/or by the VITEK ®2 automated system, were obtained from Srinagarind Hospital (Table 1). All sixty samples were used for evaluating the performance of the RPA-LF test for MRSA detection (Table 1) and a subset of 30 were used to compare the efficacy of 2 brands of nucleic acid detection strips [Milenia HybriDetect vs. Kestrel Bio Sciences (KB)] (S2 Table).
Table 1

Prospective evaluation of the RPA-LF assay for the detection of nuc and mecA genes in 60 positive blood-culture samples.

Organisms (n)a found in positive blood-culture samplesNo. of positive samples by
PCRRPA-LF (KB)b
nuc mecA nuc mecA
mecA-carrying Staphylococci (16)
    Staphylococcus aureus (1)1111
    coagulase-negative Staphylococci (13)013013
    Staphylococcus epidermidis (1)0101
     Staphylococcus capitis (1)0101
Non-mecA-carrying Staphylococci (23)
    S. aureus (14)140130
    coagulase-negative Staphylococci (8)0000
    Staphylococcus saprophyticus (1)0000
Non-mecA-carrying organisms (21)
    Gram-positive bacteria (8)
    Micrococcus spp. (1)0000
     Bacillus spp. (3)0000
    Enterococcus spp. (2)0001
    Enterococcus casseliflavus (1)0000
    Enterococcus faecalis (1)0000
Gram-negative bacteria (11)
     Escherichia coli (6)0000
    Klebsiella pneumoniae (3)0000
    Salmonella group B (1)0000
    Salmonella group C (1)0000
Yeast (2)
    Cryptococcus neoformans (2)0000
Total (60) 15161417

a Pathogens were identified by conventional biochemical tests and/or by the VITEK ®2 automated system.

b KB, Kestrel Bio Sciences.

a Pathogens were identified by conventional biochemical tests and/or by the VITEK ®2 automated system. b KB, Kestrel Bio Sciences. The organisms other than S. aureus and MRSA are used for testing the specificity of the developed RPA method. A positive result must be generated only with S. aureus and MRSA strains, but not with the other organisms.

Primer and probe design

A set of primers and probes was manually designed to be specific for a conserved region of the nuc gene following suggestions in the TwistAmp® DNA amplification assay design manual. The primers and probe for the mecA gene from our previous report were used [18] (Table 2). For the TwistAmp® nfo reaction, the reverse primer was labeled with either 5’-Btn or -Dig. The probes (46 or 47 nt) include a 5´-carboxyfluorescein (FAM) antigenic label, a tetrahydrofuran (THF) spacer replacing at nt 30 and an adjacent downstream oligonucleotide (16 or 17 nt) carrying a C3-spacer (polymerase extension blocking group) at its 3´ end. Specificity of all designed RPA primers and probes was confirmed by using a BLAST search and OligoEvaluator™ Sequence Analysis software (http://www.oligoevaluator.com; last accessed April 18, 2020) [18]. Primers and probes were synthesized by Bio Basic Inc. (Makham, Ontario, Canada). The primer and probe sequences used for the RPA-LF of the nuc and mecA genes are provided in Table 2 and S3 Table. The performance of the primer set for the nuc gene designed in this study was compared with primer sets from previous studies by Du et al. [13] and Geng et al. [20] (S3 Table).
Table 2

Nucleotide sequences of the primers and probes used for RPA-LF for detection of nuc and mecA genes in positive blood-cultures.

Primer sets Primer names Oligonucleotide sequences (5´ to 3´) Length (nucleotides) Expected products (bp) References
nuc-set 4nuc-F2 TTAAGTGCTGGCATATGTATGGCAATCGTTTC 32286[20]
nuc-R3(RPA) CACCATCAATCGCTTTAATTAATGTCGCAGGTTC 34This study
nuc-R3-Dig-RPA-LFDig-CACCATCAATCGCTTTAATTAATGTCGCAGGTTCThis study
nuc-R3-Btn-RPA-LFBtn-CACCATCAATCGCTTTAATTAATGTCGCAGGTTCThis study
nuc-probeFAM-CGTAAATAGAAGTGGTTCTGAAGATCCAAC-[THF]–GTATATAGTGCAACTTC-C3-SpacerThis study
mecA-set 1mecA-F-(RPA_1) GCGATAATGGTGAAGTAGAAATGACTGAACGTCCG 35176[21]
mecA-R-(RPA_1) TTGAACGTTGCGATCAATGTTACCGTAGTTTG 32[18]
mecA-R-Btn-RPA-LFBtn-TTGAACGTTGCGATCAATGTTACCGTAGTTTG
mecA-probeFAM-CGTTAAAGATATAAACATTCAGGATCGTAA-[THF]-ATAAAAAAAGTATCTA-C3-Spacer[18]

Btn, biotin; Dig, digoxin; FAM, Carboxyfluorescein; THF, Tetrahydrofuran; C3 Spacers, a polymerase extension-blocking site.

Btn, biotin; Dig, digoxin; FAM, Carboxyfluorescein; THF, Tetrahydrofuran; C3 Spacers, a polymerase extension-blocking site.

Primer screening and the performance of the RPA-AGE assay for detecting nuc and mecA genes

The RPA-AGE assay using the TwistAmp® Basic kit (TwistDX, Cambridge, UK) was used to identify the best primer sets [four sets of nuc primers (S3 Table)]. The sensitivity and specificity of the RPA-AGE assay were evaluated for detecting nuc and mecA genes using the chosen sets of primers and genomic DNA from the panel of 56 isolates [18] (S1 Table). The total volume of a reaction was 12.5 μL. The reaction mixture included 480 nM of each RPA primer, 14 mM of magnesium acetate (MgOAc), and 0.5 μL of bacterial DNA. The tubes were incubated for 20 min at 37 and 45°C for nuc and mecA genes respectively, and the reaction was stopped at 65°C for 10 min. Detection of amplification products was carried out by subjecting the product to electrophoresis through a 2% agarose gel. The results of the RPA-AGE method were compared with those of the PCR-AGE approach.

PCR assays of nuc and mecA genes for identification of MRSA

For the conventional PCR assay, the total volume used per reaction was 25 μL, including 0.5 μM of each primer of nuc-Set 4 (this study and Geng et al. [20]) (Table 2) or mecA primers of Kondo et al. [22], 1X PCR buffer, 0.2 mM dNTP, 2 mM MgCl2, 1 U of Taq DNA polymerase (Vivantis Technologies Sdn. Bhd., Selangor Darul Ehsan, Malaysia), and 2 μL of DNA template. The PCR method was carried out according to our previous study [18].

Optimization for nuc-RPA-LF reaction

For nuc-RPA-LF, the reaction was performed at temperatures of 37, 40, 45 and 50°C, and the optimum reaction time was determined by incubating the reaction mixtures for 5, 10, 20 and 30 min. After optimization, the nuc-RPA-LF and mecA-RPA-LF reactions were carried out separately in a total volume of 10 μL each. The master mix for RPA reaction comprised 2.1 μL of each primer [nuc-F2 & nuc-R3-Dig-RPA-LF or nuc-F2 & nuc-R3-Btn-RPA-LF [20, this study]; mecA-F-(RPA_1) & mecA-R-Btn-RPA-LF] [18, 21] (420 nM), 0.6 μL of nuc-probe or mecA-probe (120 nM), 29.5 μL of rehydration buffer and 11.2 μL of sterile distilled water. The reaction mixture was added to the freeze-dried enzyme pellet of a TwistAmp® nfo kit (TwistDx, Cambridge, UK), mixed thoroughly by pipetting, and then divided into five aliquots (9.1 μL each) into 0.2 mL tubes. The template DNA (0.4 μL) was added into each tube, and then the reaction was initiated by adding 280 mM MgOAC (0.5 μL). The reaction tube was incubated at 45°C for 20 min. After incubation, the amplification was stopped at 82°C for 5 min to denature the primer dimer according to the method of Liu et al. [23]. For LF detection, 1 μL of mecA-RPA product or nuc-RPA product using the reverse primer labeled with a Btn at the 5′ end was added into 49 μL of the HybriDetect assay buffer. The nuc-RPA product generated using the reverse primer labeled with a Dig at the 5′ end was diluted to 1:100 and 2.5 μL of the diluted product was added to a tube containing 50 μL of HybriDetect assay buffer. Finally, the HybriDetect-1 (for Btn labeled) or HybriDetect-2 (for Dig labeled) LF strip (Milenia Biotec GmbH, Gieβen, Germany) was dipped into the mixture containing the DNA product and buffer, and then left for 5 min at room temperature. The appearance of color at both the test and control lines on the strip indicates a positive result whereas a negative result shows only a control line on the strip. The absence of a control line on the LF indicates that the strip has not worked correctly.

Performance of the Milenia HybriDetect vs. Kestrel Bio Sciences (KB) nucleic acid detection strips

Besides the Milenia strips used for detection of RPA products, DNA amplification product from 30 positive blood-culture samples (S2 Table) (subset of 60 positive blood-culture samples) were also processed using KB strips (Kestrel Bio Sciences, Pathum Thani, Thailand) following the manufacturers’ instructions. Briefly, 5 μL of RPA product labeled with Btn was pipetted directly onto the sample application area of a KB strip. The strip was placed in a tube containing 50 μL of buffer and allowed to absorb up for 5 min at room temperature. Then the strips were removed and the results were inspected immediately. The interpretation of the KB strip was the same as that of the Milenia strip. The percent of agreement and the Cohen’s Kappa index value were calculated using the free software VassarStats (http://vassarstats.net/; last accessed June 26, 2021). The Kappa index value was interpreted as follows: ≤0, poor agreement; 0.01 to 0.20, slight agreement; 0.21 to 0.40, fair agreement; 0.41 to 0.60, moderate agreement; 0.61 to 0.80, substantial agreement; 0.81 to 1, almost perfect or perfect agreement [24].

Determination of detection limit

The detection limits of RPA-AGE and RPA-LF for detection of the nuc and mecA genes were determined [18]. The KB strips were used for the detection of amplified products from both genes. The intensity of the signal at the test line, expressed as peak area, was determined using ImageJ software (version 1.53a) (National Institute of Health, Bethesda, MD, USA) and calibration curves were generated for the detection of nuc- and mecA-carrying S. aureus. Above a threshold peak-area value established to be 1000, the RPA-LF was positive for detection of both nuc and mecA genes. The peak area increased with increasing cell numbers.

Prospective evaluation of the RPA-LF test for MRSA detection directly from positive blood-culture samples

The developed nuc- and mecA-RPA-LF assays were evaluated using KB strips to test with 60 positive blood-culture samples from Srinagarind Hospital. Blood-culture samples were tested directly that no prior extraction of DNA was required. The results of the RPA-LF were compared with either conventional biochemical tests or results from the VITEK 2 system (bioMérieux) and PCR-AGE. The intensity of the signal at the test line was determined by ImageJ and interpreted as described above. Finally, the sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and 95% confidence interval (CI) were calculated using the free software VassarStats (http://vassarstats.net/; last accessed June 26, 2021). All tests were performed in duplicate, and results were blindly read by two independent observers. If both results were discordant, the sample was tested for the third time and the modal result was accepted. The RPA-LF was imaged with a smartphone (Huawei Nova 2i, Huawei Base, Shenzhen, China) at a 90° angle and a distance of 10 cm. This study was approved by the Ethics Committee of Khon Kaen University (project number HE611605).

Results

Screening of RPA primers and the performance of the RPA-AGE assay for detecting nuc and mecA genes

Our previous RPA primer set and probe for mecA gene detection were used in this study [18]. For the nuc gene, we initially evaluated four primer sets against three isolates of S. aureus, S. haemolyticus, and E. faecium. The sizes of DNA fragments expected to be generated by these nuc-primer sets were 139, 164, 141 and 286 bp, respectively (S3 Table). The nuc-primer set 4 showed the highest specificity with no cross-reactions. The RPA-AGE using these primer sets [nuc-set 4 & mecA-set 1, (Table 2)] provided 100% and 92.1% sensitivity for identifying nuc and mecA genes, respectively, in 56 samples. In addition, negative results were seen in all PCR-negative isolates (100% specificity) (S1 Table). These primer sets were therefore used for further validation.

Optimization

In this study, the nuc-RPA-LF method worked well at 40–50°C and incubation time of 10–30 min (S1 Fig). Therefore, we selected a 45°C and 20 min as the optimal temperature and time for nuc-RPA-LF, respectively, similar to those for the mecA-RPA-LF [18].

Performance of the Milenia HybriDetect vs. KB nucleic acid detection strips

Detection of RPA products from 30 positive blood-culture samples using the Milenia and KB strips showed a perfect agreement (100% agreement with a Cohen’s Kappa index value of 1.0) (S2 Table). Btn-labeled and Dig-labeled primers gave identical results for detecting nuc-RPA products using Milenia strips (100% agreement with a Cohen’s Kappa index value of 1.0) (S2 Table and Fig 1).
Fig 1

Detection of nuc-RPA products by RPA-LF.

A, Milenia strips and a Btn-labeled reverse primer; B, Milenia strips and a Dig-labeled primer; C, Kestrel Bio Sciences (KB) strips and a Btn-labeled primer. 1–4, nuc-carrying S. aureus; 5, non-nuc-carrying Bacillus spp.; 6, non-nuc-carrying E. coli; 7, non-nuc-carrying C. neoformans. +, positive reaction; -, negative reaction.

Detection of nuc-RPA products by RPA-LF.

A, Milenia strips and a Btn-labeled reverse primer; B, Milenia strips and a Dig-labeled primer; C, Kestrel Bio Sciences (KB) strips and a Btn-labeled primer. 1–4, nuc-carrying S. aureus; 5, non-nuc-carrying Bacillus spp.; 6, non-nuc-carrying E. coli; 7, non-nuc-carrying C. neoformans. +, positive reaction; -, negative reaction.

Detection limit

The detection limits of the RPA-LF methods for identifying the nuc and mecA genes were 10 colony forming unit (CFU) per reaction (peak area = 1,045 and 1,809, respectively), whereas those of the RPA-AGE method for the nuc and mecA genes were 10 CFU and 1 CFU per reaction, respectively (Fig 2). With 104 CFU per reaction of mecA-carrying S. aureus, the RPA-LF showed a result due to the “hook” effect [Fig 2(A-2 to C-2)].
Fig 2

Comparison of the detection limit of the RPA-LF, RPA-AGE and PCR assays.

Detection limit of the RPA-LF assay (A) compared with that of the RPA-AGE (D) and PCR (E) assays for detecting nuc (1) and mecA (2) genes. Lane M, 100 bp DNA ladder. B-1 & B-2, the calibration curve for RPA-LF with different concentrations of nuc-carrying S. aureus and mecA-carrying S. aureus corresponding to (A-1 & A-2). C-1 & C-2, Histogram representing peak area of the intensity of the test lines corresponding to (A-1 & A-2). The red dashed lines represent the threshold value (peak area = 1000) above which a result is regarded as positive.

Comparison of the detection limit of the RPA-LF, RPA-AGE and PCR assays.

Detection limit of the RPA-LF assay (A) compared with that of the RPA-AGE (D) and PCR (E) assays for detecting nuc (1) and mecA (2) genes. Lane M, 100 bp DNA ladder. B-1 & B-2, the calibration curve for RPA-LF with different concentrations of nuc-carrying S. aureus and mecA-carrying S. aureus corresponding to (A-1 & A-2). C-1 & C-2, Histogram representing peak area of the intensity of the test lines corresponding to (A-1 & A-2). The red dashed lines represent the threshold value (peak area = 1000) above which a result is regarded as positive. The RPA-LF test provided 93.3% sensitivity, 100.0% specificity, 100.0% PPV, and 97.8% NPV for detecting the nuc gene, and 100.0%, 97.7%, 94.1% and 100.0%, respectively, for the mecA gene (Table 1 and S4 Table). Examples of the RPA-LF results for identifying these genes in representative positive blood-culture samples and their corresponding peak areas are shown in Fig 3. The signal intensities of all positive results were higher than the threshold value (>1000 of peak area) (Fig 3). The mean values of signal intensity of nuc- and mecA-positive samples were 5857 and 4312 respectively.
Fig 3

Examples of RPA-LF results for the detection of nuc and mecA genes.

RPA-LF results of nuc (1) and mecA (2) genes in representative positive blood-culture samples (A) and their corresponding peak area profile plots (B). A-1 & B-1; numbers 1–11, 13 and 16, nuc gene-negative samples; 12, 14 and 15, nuc gene-positive samples. A-2 & B-2; numbers 2–5, 7, 13–16, mecA gene-negative samples; 1, 6, 8–12, mecA gene-positive samples. The threshold value of the intensity of peak area to determine a positive/negative result is 1000 (red dashed line).

Examples of RPA-LF results for the detection of nuc and mecA genes.

RPA-LF results of nuc (1) and mecA (2) genes in representative positive blood-culture samples (A) and their corresponding peak area profile plots (B). A-1 & B-1; numbers 1–11, 13 and 16, nuc gene-negative samples; 12, 14 and 15, nuc gene-positive samples. A-2 & B-2; numbers 2–5, 7, 13–16, mecA gene-negative samples; 1, 6, 8–12, mecA gene-positive samples. The threshold value of the intensity of peak area to determine a positive/negative result is 1000 (red dashed line).

Discussion

Primer and probe design is viewed as the most challenging step for setting up an RPA-LF experiment. To avoid non-specific cross-binding, we carefully designed and tested candidate sequences for secondary-structure formation and primer-primer interactions, hairpins, nucleotide composition, sequence length, and the interplay between probe and primers. In the present study, the RPA-LF method for both genes (nuc and mecA) could be performed under the same conditions, making it convenient for routine detection. In general, there is no single system best for all applications. We need to consider several important factors before selecting an assay including the LF strip that best fits the situation. These factors include cost, speed, ease of use, performance (acceptable sensitivity and specificity) and availability in our area. Currently, the cost of the RPA-LF assay is rather higher than other molecular methods [25]. However, a cheaper lateral-flow format or the use of alternative labeling technologies for primers may help to reduce the cost per test. The Milenia strip costs ⁓$4.7 per strip compared with ⁓$2.76 for the KB strip. In the present study, Milenia and KB strips showed perfect agreement for detecting nuc- and mecA-RPA products. In addition, the KB strips is convenient to order and took short delivery times. The primer cost for biotin (Btn) labeling is 50% saving than that for digoxin (Dig) labeling. Therefore, we decided to use KB strips and Btn-labeled primers for the remaining experiments. In the present study, the detection limits of the RPA-LF and RPA-AGE methods for detecting the nuc gene were equal to that of the PCR method. For the mecA gene, the detection limit of RPA-LF was 10 times less sensitive than those of the RPA-AGE and PCR methods [Fig 2(A-2 to E-2)]. Although the sensitivity of the mecA-RPA-LF using KB strips was lower than that of the RPA-AGE and PCR assays, it could nevertheless detect this gene within the concentration range that usually occurs in positive blood-culture bottles (⁓108−109 CFU/mL) [26] [the detection limit of the RPA-LF assay using KB strips for detecting both genes was 105 CFU/mL (10 CFU per reaction)]. This test has considerable potential for routine detection of MRSA in positive blood-culture bottles. RPA combined with LF has been shown to have high sensitivity and specificity for detecting the nuc gene of S. aureus in food [13, 27]. Recently, Brunauer et al. [28] reported successful direct detection of Pseudomonas aeruginosa by RPA-LF from wound exudate after a rapid sample preparation (crude lysis). Wang et al. [29] also developed a multiplex-touchdown PCR method to detect the mecA gene from positive blood-culture bottles. As far as we know, there is still no RPA-LF test available for the direct detection of MRSA in positive blood-culture samples. This study is the first report describing the performance of such a test evaluated using blood samples from a hospital without prior DNA extraction. However, the developed RPA-LF method could not detect the nuc gene of one S. aureus isolate in a positive blood-culture bottle (Table 1) but could detect the gene in colonies. This may be due to some inhibitor in this particular blood-culture bottle. Blood samples contain various inhibitors (e.g. lactoferrin and immunoglobulin G) that can interfere with molecular testing [30, 31]. Interference factors may hinder the enzymatic amplification reaction by direct interaction with the enzymes or by interfering with cofactors required for the enzymatic activity [30-32]. However, the high concentrations of hemoglobin seem to have no influence on a successful RPA-LF reaction [32]. In 2013, Xafranski et al. [33] reported that bovine serum albumin (BSA) was the most efficient protein for reducing inhibition of amplification. BSA can bind to PCR inhibitors in the samples and prevent them from interacting with DNA (Taq) polymerase. Therefore, it has been used to increase the sensitivity of PCR amplification from clinical samples [30, 34]. The sensitivity and the detection limit of our developed RPA-LF can be improved further. In our previous report [18], the RPA-LF provided 100% specificity for the detection of the mecA gene from both colonies and spiked blood cultures. In this study, one false positive from a non-mecA-carrying Enterococcus spp. isolate in a positive blood-culture bottle from the hospital was observed. A false-positive result may be caused by any degradation products in the positive blood-culture bottle or an unknown background of the patient. However, the crowding agent (dextran sulfate) and proteins in RPA reactions can interfere and cause non-specific binding of antibody-labeled gold nanoparticles to the test line of an LF strip. Thus, the amplicon of each gene should be diluted sufficiently to avoid non-specific binding and false-positive signals [35]. Moreover, primer-primer binding at room temperature may produce a false positive signal [36]. The RPA mixtures should be kept on ice during the reaction preparation. The LF strip tended to show false positives when it was left in the running buffer for too long time [37]. We read the result of the LF test within 20 min in this study. However, the false-positive and false-negative rates of the RPA-LF in this study were ⁓2%. In 2017, Yeh et al. [12] reported that an RPA reaction using plasma samples was much more robust than a PCR reaction or loop-mediated isothermal amplification (LAMP). The elimination of sample extraction and purification steps makes the RPA-LF method significantly less laborious, expensive and time-consuming. Of these techniques, RPA is the easiest one to perform, furthermore, its reagents in a dried pellet format are highly stable [38]. In addition, the LF strip is stable at room temperature for at least six months. However, the RPA does have some limitations. The RPA reaction kits are produced by only one company, which has a high impact on the cost, availability and delivery times. Therefore, we tested by using reduced volume of the RPA reaction in this study (10 μL), similar to a previous report [39], which reduced the cost of RPA reagent to ⁓$0.5 per test. Recently, Lillis et al. [40] and Subbotin et al. [41] showed that reducing the reaction volume from 50 μL to 5 μL had very little effect on the performance. Our study had a small sample size for the analysis because of a limited number of TwistAmp® nfo kits from the manufacturing company: larger samples should be evaluated in further studies. In conclusion, we developed an RPA-LF test, which is simple, rapid, robust, cost-effective, highly sensitive, and specific for the direct detection of MRSA from positive blood-culture samples. This may be suitable for use in epidemiological surveillance and identification in hospitals. Moreover, it may serve as a model platform for detecting other pathogens. Optimization of incubation temperature and time for nuc- (A, B) and mecA- (C, D) RPA-LF assays. +, positive reaction; +w, weakly positive; -, negative reaction. (TIF) Click here for additional data file. (PDF) Click here for additional data file.

Diagnostic performance of the RPA-AGE assay in the detection of nuc and mecA genes in 56 clinical isolate samples.

(PDF) Click here for additional data file.

Performance of the RPA-LF using Milenia vs. KB strips compared with PCR assay for detecting nuc and mecA genes in positive blood-cultures from routine Srinagarind Hospital.

(PDF) Click here for additional data file.

Nucleotide sequences of the RPA primers and probes tested for detection of nuc and mecA genes used in this study.

(PDF) Click here for additional data file.

Diagnostic performance of the RPA-LF assay in the detection of nuc and mecA genes in 60 positive blood samples from Srinagarind Hospital.

(PDF) Click here for additional data file. 26 May 2022
PONE-D-22-05183
Rapid detection of methicillin-resistant Staphylococcus aureus in positive blood-cultures by recombinase polymerase amplification combined with lateral flow strip
PLOS ONE Dear Dr. Lulitanond, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Jul 10 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Dwij Raj Bhatta, PhD Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions 3. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. Additional Editor Comments (if provided): Manuscript requires corrections as pointed out but by reviewers! Please give justification: as in method section 56 isolates (26 S. aureus and 30 non-S. aureus) collected but in Table 1, there are total 60 isolates. Please check which one is correct. 2) why isolates other then S. aureus and MRSA are listed and studied? is it relevant to the title of the manuscript? study is related to S. aureus and MRSA only? [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: I Don't Know ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The authors described the sensitivity and specificity of RPA assay for the detection of methicillin resistant Staphylococcus aureus. The manuscript has been well written. It can accepted for publication. Reviewer #2: The manuscript is well written and findings are important in rapid detection of MRSA from blood culture. However, some changes are suggested 1) In Material and method section it is mentioned that, 56 isolates (26 S. aureus and 30 non-S. aureus) collected but in Table 1, there are total 60 isolates. Please check which one is correct. 2) Organism other than S. aureus and MRSA are listed. As per the title of the manuscript, study is related to S. aureus and MRSA only. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Megha Raj Banjara Reviewer #2: Yes: Dharm Raj Bhatta [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
Submitted filename: PONE-D-22-05183.docx Click here for additional data file. 14 Jun 2022 June 1, 2022 Dear Editor, Manuscript ID: PONE-D-22-05183 Title: Rapid detection of methicillin-resistant Staphylococcus aureus in positive blood-cultures by recombinase polymerase amplification combined with lateral flow strip Thank you very much for valuable comments and for giving us an opportunity to revise our manuscript. We have responses to all the issues raised by the editor and reviewers as in the following and use the "Track Changes" function in Microsoft Word of the revised manuscript. We would be grateful if you would consider our revised manuscript for publication. Yours sincerely, Aroonlug Lulitanond Corresponding author The response to editor’s and reviewer’s comments Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf Response: We have already checked PLOS ONE style as suggested. Our manuscript was prepared accordingly the PLOS ONE style. 2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions Response: Our manuscript provided the original images for all gel data reported in our submission. We already checked the policy and the journal’s other requirements for blot/gel reporting and figure preparation as suggested. We have confirmed that our figures adhere to the guidelines. Our blot/gel image data are not in Supporting Information or posted at a public data repository. 3. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. Response: The phrases “data not shown” in our manuscript were removed as suggested. The data are not a core part of the research. We have already checked carefully reference list and confirmed that it is complete and correct. Additional Editor Comments (if provided): 1. Manuscript requires corrections as pointed out but by reviewers! Please give justification: as in method section 56 isolates (26 S. aureus and 30 non-S. aureus) collected but in Table 1, there are total 60 isolates. Please check which one is correct. Response: We have already checked as suggested. The 56 isolates (26 S. aureus and 30 non-S. aureus) were used for evaluating the performance of the chosen primer set on the RPA-AGE test for detection of MRSA colonies (S1 Table) whereas the 60 samples were clinical blood-culture bottles from a routine laboratory in hospital which were used for evaluating the performance of RPA-LF test (Table 1). So, we have specified this point in lines 86-88, 90-94, and 126-128. 2) why isolates other than S. aureus and MRSA are listed and studied? is it relevant to the title of the manuscript? study is related to S. aureus and MRSA only? Response: The title of the manuscript is related to S. aureus and MRSA only because we want to develop the RPA assay for the detection of nuc and mecA genes to diagnose S. aureus and its methicillin-resistance status. The organisms other than S. aureus and MRSA are included for testing the specificity of the developed RPA method. A positive result must be generated only with S. aureus and MRSA strains, but not with the other organisms. We have added this matter in lines 98-99. Reviewers' comments: Responses to Reviewer's Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes Response: Thank you very much. ________________________________________ 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: I Don't Know Response: Thank you very much. We have described the sensitivity and specificity (statistical analysis) of RPA assay for the detection of methicillin resistant Staphylococcus aureus. ________________________________________ 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes Response: Thank you very much. ________________________________________ 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes Response: Thank you very much. ________________________________________ 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The authors described the sensitivity and specificity of RPA assay for the detection of methicillin resistant Staphylococcus aureus. The manuscript has been well written. It can accepted for publication. Response: Thank you very much for accepting our manuscript for publication. Reviewer #2: The manuscript is well written and findings are important in rapid detection of MRSA from blood culture. However, some changes are suggested 1) In Material and method section it is mentioned that, 56 isolates (26 S. aureus and 30 non-S. aureus) collected but in Table 1, there are total 60 isolates. Please check which one is correct. Response: We have already checked as suggested. The 56 isolates (26 S. aureus and 30 non-S. aureus) were used for evaluating the performance of the chosen primer set on the RPA-AGE test for detection of MRSA colonies (S1 Table) whereas the 60 samples were clinical blood-culture bottles from a routine laboratory in hospital which were used for evaluating the performance of RPA-LF test (Table 1). So, we have specified this point in lines 86-88, 90-94, and 126-128. 2) Organism other than S. aureus and MRSA are listed. As per the title of the manuscript, study is related to S. aureus and MRSA only. Response: The title of the manuscript is related to S. aureus and MRSA only because we would like to develop the RPA assay for the detection of nuc and mecA genes to diagnose S. aureus and its methicillin-resistance status. The organisms other than S. aureus and MRSA are included for testing the specificity of the developed RPA method. A positive result must be generated only with S. aureus and MRSA strains, but not with the other organisms. We have added this matter in lines 98-99.________________________________________ 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Megha Raj Banjara Reviewer #2: Yes: Dharm Raj Bhatta Response: Thank you very much. Submitted filename: Response to Reviewers_PONE-D-22-05183.pdf Click here for additional data file. 16 Jun 2022 Rapid detection of methicillin-resistant Staphylococcus aureus in positive blood-cultures by recombinase polymerase amplification combined with lateral flow strip PONE-D-22-05183R1 Dear Dr. Lulitanond, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Dwij Raj Bhatta, PhD Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 22 Jun 2022 PONE-D-22-05183R1 Rapid detection of methicillin-resistant Staphylococcus aureus in positive blood-cultures by recombinase polymerase amplification combined with lateral flow strip Dear Dr. Lulitanond: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Professor Dwij Raj Bhatta Academic Editor PLOS ONE
  36 in total

Review 1.  Review: a comprehensive summary of a decade development of the recombinase polymerase amplification.

Authors:  Jia Li; Joanne Macdonald; Felix von Stetten
Journal:  Analyst       Date:  2018-12-17       Impact factor: 4.616

2.  Comparison of the next-generation Xpert MRSA/SA BC assay and the GeneOhm StaphSR assay to routine culture for identification of Staphylococcus aureus and methicillin-resistant S. aureus in positive-blood-culture broths.

Authors:  Blake W Buchan; Stephen Allen; Carey-Ann D Burnham; Erin McElvania TeKippe; Thomas Davis; Michael Levi; Donna Mayne; Preeti Pancholi; Ryan F Relich; Richard Thomson; Nathan A Ledeboer
Journal:  J Clin Microbiol       Date:  2014-12-24       Impact factor: 5.948

3.  Accurate Detection of Methicillin-Resistant Staphylococcus aureus in Mixtures by Use of Single-Bacterium Duplex Droplet Digital PCR.

Authors:  Jun Luo; Junhua Li; Hang Yang; Junping Yu; Hongping Wei
Journal:  J Clin Microbiol       Date:  2017-07-19       Impact factor: 5.948

4.  Sensitive and rapid visual detection of Salmonella Typhimurium in milk based on recombinase polymerase amplification with lateral flow dipsticks.

Authors:  Jinqiang Hu; Runna Huang; Yanting Sun; Xiangke Wei; Yi Wang; Chunpeng Jiang; Yao Geng; Xincheng Sun; Jianzhou Jing; Hui Gao; Zhangcun Wang; Caiwen Dong
Journal:  J Microbiol Methods       Date:  2019-01-29       Impact factor: 2.363

5.  Bovine serum albumin further enhances the effects of organic solvents on increased yield of polymerase chain reaction of GC-rich templates.

Authors:  Eric M Farell; Gladys Alexandre
Journal:  BMC Res Notes       Date:  2012-05-24

6.  Multiplex Recombinase Polymerase Amplification Assay for the Simultaneous Detection of Three Foodborne Pathogens in Seafood.

Authors:  Biao Ma; Jiali Li; Kai Chen; Xiaoping Yu; Chuanxin Sun; Mingzhou Zhang
Journal:  Foods       Date:  2020-03-03

Review 7.  Igniting the fire: Staphylococcus aureus virulence factors in the pathogenesis of sepsis.

Authors:  Michael E Powers; Juliane Bubeck Wardenburg
Journal:  PLoS Pathog       Date:  2014-02-13       Impact factor: 6.823

8.  A paper and plastic device for the combined isothermal amplification and lateral flow detection of Plasmodium DNA.

Authors:  Michael S Cordray; Rebecca R Richards-Kortum
Journal:  Malar J       Date:  2015-11-26       Impact factor: 2.979

9.  Recombinase polymerase amplification assay combined with a lateral flow dipstick for rapid detection of Tetracapsuloides bryosalmonae, the causative agent of proliferative kidney disease in salmonids.

Authors:  Hatem Soliman; Gokhlesh Kumar; Mansour El-Matbouli
Journal:  Parasit Vectors       Date:  2018-04-11       Impact factor: 3.876

10.  Rapid Detection of Pathogens in Wound Exudate via Nucleic Acid Lateral Flow Immunoassay.

Authors:  Anna Brunauer; René D Verboket; Daniel M Kainz; Felix von Stetten; Susanna M Früh
Journal:  Biosensors (Basel)       Date:  2021-03-06
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.