| Literature DB >> 35769104 |
Abdul Basit1, Hamza Tahir1, Zulquernain Haider1, Hafsa Tariq1, Asim Ullah1, Shafiq Ur Rehman1.
Abstract
Salmonella Gallinarum causes fowl typhoid in poultry leading to a huge economic loss to the poultry industry. The large virulence plasmid of S. gallinarum has been associated with various systemic infections in poultry. A five-gene spanning region (spvRABCD) of 7.8 kb on the large plasmid mainly confers virulence to the bacteria. However, the exact role of these genes in virulence has not been elucidated yet. SpvB exhibits delayed cell death by preventing actin polymerization followed by apoptosis during intracellular infection. The specific role of SpvB in causing the disease is not known yet. In the current study, the SpvB gene was deleted through CRISPR/Cas9 method from a large virulent plasmid of locally isolated S. gallinarum strain (SG18). The homology-directed repair method was used for complete deletion of SpvB gene using the modified pCas9 plasmid. The SpvB-deleted S. gallinarum strain (ΔSpvB_SG18), when tested for its virulence in broiler chicken showed no diseases signs and mortality. In addition, the avirulent strain does not affect the bird's weight and was rapidly cleared from the liver after infection. However, it cleared from the intestine only after 4-5 days, which suggests that the ΔSpvB_SG18 strain is unable to invade from the intestine to the liver. This is the first study to report a complete gene deletion from the S. gallinarum virulent plasmid and its effect. This method will be useful for the deletion of virulent genes from S. gallinarum, to study their role in pathogenesis, and to prepare an effective vaccine strain for controlling fowl typhoid in poultry.Entities:
Keywords: CRISPR/Cas9; Salmonella gallinarum; SpvB; fowl typhoid; poultry; virulent plasmid
Year: 2022 PMID: 35769104 PMCID: PMC9234527 DOI: 10.3389/fbioe.2022.885227
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
Details of the primers used in this study.
| Primer | Sequence | Other details |
|---|---|---|
| Oligo I | AAACGATCACAGAGTCGTATACCGG | gRNA (5՛→3՛) targeting SpvB gene, with the BsaI restriction site |
| Oligo II | CGGTATACGACTCTGTGATCCAAAA | gRNA reverse complement strand (5՛→3՛) targeting the SpvB gene, with the BsaI restriction site |
| H1F | TTGAGATCTGTCCATACCCATGGTCTAGAGTTCCGTTGCTCCCCAAACCCA | Forward primer to amplify homologous arm1 (1 kb upstream region of SpvB gene) having an overlap for the pET22b vector and the XbaI restriction site |
| H1R | GGCCAGTTTCAGGAGATAGTGTATACTAAGAATCGATTCCAGAAGT | Reverse primer to amplify homologous arm1 (1 kb upstream region of the SpvB gene) an having overlap for homologous arm2 |
| H2F | CTTCTGGAATCGATTCTTAGTATACACTATCTCCTGAAACTGGCC | Forward primer to amplify homologous arm2 (1 kb downstream region of the SpvB gene) having an overlap for homologous arm1 |
| H2R | GATACAGGTATATTTTTCTGACTCGAGTTCACAGGTCGTAACCGCCATCC | Reverse primer to amplify homologous arm2 (1 kb downstream region of the SpvB gene) having an overlap for the pET22b vector |
| C1 | ATAGTGACTGGCGATGCTGTC | Reverse primer for gRNA confirmation in pCas9. This primer is used in combination with OligoI and amplifies a 180 bp fragment |
| C2 | ATGGGTATGGACAGATCTC | Reverse primer for gRNA confirmation in pCasSA when used in combination with OligoI and amplifies 130 bp fragment |
| Screen_F | GGAATTCGTCAGTAAGGGGGGA | Forward primer binds to 1.1 kb upstream of the SpvB gene |
| Screen_R | AACCGCGATTCCGCACAGCAGAA | Reverse primer binds to 1.2 kb downstream of the SpvB gene and amplifies a 4.3 kb fragment from unedited large virulent plasmid of SG18, while 2.2 kb fragment in case of SpvB gene deletion |
| SpvB_F | CTAAATGGTTTTTCATCTGCCAC | These primers are used for detection of the SpvB gene in |
| SpvB_R | TGTACCTTGCTGAGATAGCGCATG |
FIGURE 1Diagrammatic representation of SpvB gene deletion from S. gallinarum large virulent plasmid through engineered CRISPR/Cas9 mediated homologous recombination.
FIGURE 2Confirmation of spacer RNA (gRNA) cloning in (A) pCas9 (B) and pCasSA vectors through PCR and Sanger sequencing. Lanes 1–3, colony PCR of the Top10 cells carrying recombinant pCas9-g showed amplification of a 180 bp fragment suggest the cloning of gRNA in pCas9. Lanes 4–6, colony PCR of the cells carrying the recombinant pCasSA-g plasmid amplified 130 bp fragment suggest the cloning of gRNA in pCasSA, which is further confirmed through Sanger sequencing shown in the chromatogram. (C) Plasmid map of recombinant pCas9-g carrying spacer RNA targeting the SpvB gene. The gRNA (colored red) is denoted with an arrow. Lane M, Gene Ruler 1 kb DNA ladder (SM0311), Lane M*, Gene Ruler 50 bp DNA ladder (SM0371) was used as the DNA ladder.
FIGURE 3PCR amplification and cloning of homologous arms in the pET22b (+) vector. Lane H1; homologous arm1, Lane H2; homologous arm 2, Lane Hs; fused homologous arms, Lane P; PCR amplified fused homologous arms was used as positive control, Lane 1–3; Colony PCR of Top10 cells carrying fused homologous arms as the DNA editing template cloned in the pET22b (+) vector (pET_HAs).
FIGURE 4Screening for SpvB deletion in SG18 cells co-transformed with pCas9_g and pCasSA_g plasmids in combination with the DNA editing template carrying vector. (A) All the pCas9-g transformed SG18 colonies screened showed a partial deletion of the SpvB gene, while (B) pCasSA-g transformed SG18 cells showed a partial deletion of the SpvB gene in 40% of total cells screened. Lanes 1–10 are the colonies electroporated with corresponding vectors, Lane P; large virulent plasmids isolated from SG18 cells were used as positive control, showing amplification of the SpvB gene (4 kb) through screening primers.
FIGURE 5Screening SG18 cells for SpvB gene deletion. The cells were primarily electroporated with the pET_HAs vector and after confirmation, subsequently; the DNA editing template-carrying cells were electroporated with pCas9_g vector. PCR-based screening showed that almost 50% cells screened showed a complete deletion of the SpvB gene, while the rest showed a partial deletion as shown in the aforementioned figure. The deleted mutant further confirmed through Sanger sequencing showed successful deletion of the SpvB gene from the large virulent plasmid of S. gallinarum, as shown in the aforementioned chromatogram. The encircled area (denoted by arrow) showing fused homology arms1 and 2 with no SpvB gene.
FIGURE 6(A) Rate of mortality in chickens observed during 15 days after infection with SG18 and ΔSpvB_SG18 strains. (B) Effect of SpvB deletion from S. gallinarum on poultry weight during the 36 days of experiment.
FIGURE 7Gross pathology of dead poultry birds exhibiting typical lesions of fowl typhoid. (A) Liver of control and (B) ΔSpvB_SG18 infected birds showing no signs of fowl typhoid. In contrary, (C) the wild type strain (SG18) infected birds showing enlarged livers with necrotic foci, which are typical features of fowl typhoid. Similarly, the gross pathology of (D) the control and (E) ΔSpvB_SG18-infected birds showed no apparent lesion of disease, suggesting that these chickens were clinically healthy, while (F) the SG18-infected birds showed signs of fever and inflammation caused by S. gallinarum.