Literature DB >> 35765071

Single nucleotide polymorphism analysis of pvmdr-1 in Plasmodium vivax isolated from military personnel of Republic of Korea in 2016 and 2017.

Jin-Jong Bong1, Wonsig Lee1, Chan Hee Lee1, Quehn Park1, Kyung Tae Noh2.   

Abstract

BACKGROUND: Malaria chemoprophylaxis using chloroquine (CQ) and primaquine (PQ) has been administered to resident soldiers in the 3rd Army of Republic of Korea (ROK) to prevent malaria infection since the year 1997. Due to mass chemoprophylaxis against malaria, concern exists about the occurrence of chloroquine resistance (CQR). This study aimed to investigate the single nucleotide polymorphisms (SNPs) of the Plasmodium vivax multi-drug resistance protein-1 (pvmdr-1) gene to monitor the risk of CQR.
METHODS: SNPs of the pvmdr-1 gene were analysed in 73 soldiers of the 3rd Army of ROK diagnosed with infection by P. vivax.
RESULTS: Quintuple mutations (G698S, L845F, M908L, T958M, and F1076L) were detected in 73 soldiers. A newly identified non-synonymous mutation in the Y541C position had been introduced into P. vivax malaria-endemic areas in ROK, at a frequency of 1.3% (1/73). In addition, synonymous mutations were detected at positions K44 (38.4%, 28/73), L493 (26%, 19/73), T529 (61.6%, 45/73), and E1233 (52.1%, 38/73). Based on these SNPs, pvmdr-1 sequences of ROK were classified into 6 haplotypes. The phylogenetic analysis closed to the type of North Korean showed that P. vivax malaria of ROK could be a reason of influx from North Korea.
CONCLUSIONS: This study showed that synonymous and non-synonymous mutations of pvmdr-1 were observed in the malaria chemoprophylaxis-executed regions of ROK from 2016 to 2017. Based on the rapid transition of pvmdr-1 SNPs, continuous surveillance for SNPs of pvmdr-1 related to CQR in the malaria-endemic regions of ROK is essential.
© 2022. The Author(s).

Entities:  

Keywords:  Chemoprophylaxis; Multi-drug resistance protein 1; Plasmodium vivax; Single nucleotide polymorphism

Mesh:

Substances:

Year:  2022        PMID: 35765071      PMCID: PMC9238087          DOI: 10.1186/s12936-022-04214-6

Source DB:  PubMed          Journal:  Malar J        ISSN: 1475-2875            Impact factor:   3.469


Background

Malaria, a life-threatening disease caused by Plasmodium parasites, endangers about 40% of the world's population [1, 2]. Depending on the recent World Health Organization (WHO) malaria report, all malaria infection cases have been declined from 238 million cases in 2000 to 229 million cases in 2019. In case of P. vivax malaria, it decreased from about 7% in 2000 to 3% in 2019 [3]. This worldwide malaria reduction trends are attributed to the WHO preventive policy of eradicating malaria. Nevertheless, annually, more than 300 million people of the world`s population are infected with malaria, and about 500,000 people die from malaria. Vivax malaria was supposed to be eradicated in the Republic of Korea (ROK), but a re-emergence was reported in Paju City of Gyeonggi Province in 1993 [4, 5]. According to Korea Disease Control and Prevention Agency, since re-emergence occurred in a soldier of the 3rd Army of ROK, the incidence of malaria infections has been steadily increasing [6]. In ROK, P. vivax malaria-endemic regions are localized near the DMZ (demilitarized zone; the border between ROK and the Democratic People’s Republic of Korea, DPRK) [7]. Thus, soldiers and civilians residing in DMZ have been classified as a high-risk group of malaria infection. Among the total malaria patients of ROK, the military (soldiers and military veterans) accounted for a large proportion. Because of this, members of the army of ROK have undergone prophylactic chemotherapy against malaria to prevent patient outbreaks since 1997 [8]. The detailed procedure of chemoprophylaxis is as following, 300 mg chloroquine (CQ) is administrated weekly to military personnel nearby DMZ from July to October for 15 weeks, and 15 mg PQ is subsequently administrated daily for 2 weeks [9]. CQ is effective to eradicate P. vivax in asexual blood stages and gametocytes, and primaquine (PQ) is responsible for killing the hypnozoite form of P. vivax in the liver stage. Due to the risk of chloroquine resistance (CQR) by massive and long-term use of chemoprophylaxis for prevention of malaria [10], the army of ROK has been monitoring drug resistance by analysing mutations in pvmdr-1 [11]. Subsequently, several changes in the ROK Armed Forces chemoprophylaxis programme were implemented, including the reduction of the period of hydroxychloroquine (400 mg weekly) chemoprophylaxis by 2 months in 2008, and the discontinuation of terminal primaquine chemoprophylaxis (15 mg × 14 days) in 2016 in moderate-risk area [12]. To date, various CQR cases in several regions including Indonesia, Southeast Asia, India, and Central and South America have been reported [13-19]. There is concern about the influx of malaria resistance from Southeast Asian countries [20]. Recent studies have been shown that long-term chemoprophylaxis could induce genetic mutation. For example, polymorphism of pvcrt-o and pvmdr-1 was detected by CQ treatment [21-23]. Thus, it can be hypothesized that genetic changes occur in malaria chemoprophylaxis-executed malaria-endemic regions of ROK. Herein, this study was to focus on the surveillance of genetic mutation in pvmdr-1 (Malaria drug resistance-related gene).

Methods

Ethics statement and sample preparation

This study was approved by the ethics committee of the Armed Forces Medical Command (Approval No. AFMC-16067-IRB-16-056, September 2016). An approval form was used to obtain written informed consent and permission from each participant for providing a 5 ml blood sample.

Volunteers enrolment—inclusion criteria

Blood samples were collected from malaria patients who agreed to the study. Positive patients with a rapid diagnostic test (Standard Diagnostics Inc., USA) or blood smear test with microscopy, or malaria-suspected patients (A person who needs a malaria molecular test as a result of medical treatment with a body temperature of 38 degrees Celsius) were enrolled this study. Most patients have a history of fever in the previous 48 h without malaria chemoprophylaxis compliance. All blood samples collected from 3 military hospitals (Yangju, Koyang, and Ildong), during 2016–2017 were screened using 18S rRNA nested PCR.

Collection of clinical isolates

141 venous blood samples (Whole blood-EDTA samples) from male patients infected with malaria or malaria suspected patients with fever were collected in the three Armed Forces Hospitals (Yangju, Koyang, and Ildong) near the DMZ located in northern Gyeonggi Province and northwest region of the ROK from 2016 to 2017. The Armed Forces Hospitals performed a rapid diagnostic test (STANDARD DIAGNOSTICS Inc., USA), and a blood smear test with microscopy for all participants.

Plasmodium vivax nested PCR analysis (18S rRNA and pvmdr-1)

Genomic DNA was extracted from 200 ul Whole blood-EDTA using DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) as recommended by the manufacturer. For screening P. vivax infection, purified DNA samples from all patients were diagnosed by nested polymerase chain reaction (PCR) targeting P. vivax 18S rRNA. 1100 bp or 120 bp was detected by 2nd nested PCR [24]. As shown in the previous report [23], the pvmdr-1 gene was amplified using the indicated primer sets of nested PCR (Table 1) for the SNPs analysis of pvmdr-1. The first round of PCR was performed under the following conditions: 94 °C for 5 min, followed by 30 cycles of 94 °C for 30 s, 57 °C for 30 s, and 72 °C for 4.5 min, and a final extension at 72 °C for 10 min. The second PCR was performed under the following conditions: 94 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, 57 °C for 30 s, and 72 °C for 4 min, and a final extension at 72 °C for 10 min. PCR products were analysed on 1.5% agarose gels using 1 Kb Plus DNA Ladder (Thermo Fisher Scientific) by electrophoresis (Fig. 1) and visualized by Fluor Chem FC3 (Protein Simple, USA).
Table 1

Information of primers used to amplify pvmdr-1 gene

PrimersSequence (5' → 3')
Pvmdr-1 (1st F)ATG AAA AAG GAT CAA AGG CAA C
Pvmdr-1 (1st R)CTA CTT AGC CAG CTT GAC GTA C
Pvmdr-1 (2nd F)TTG AAC AAG AAG GGG ACG TT
Pvmdr-1 (2nd R)CTT ATA TAC GCC GTC CTG CAC
Sequencing primer 1TAC GGA ACG AGA ATC ATC AT
Sequencing primer 2GAT GGT CAG CAT GAA CAT AC
Sequencing primer 3TCA GGT GGA CAG AAG CAG AG
Sequencing primer 4GCG AAC TCG AAT AAG TAC TC
Sequencing primer 5AAG TCC CTC ATC GAC GTG AG

Pvmdr-1 primers set were adapted from Barnadas et al. [23]. Sequencing primers were newly designed for this study

Fig. 1

Gel electrophoresis of P. vivax 18S rRNA and pvmdr-1 nested PCR. a 18S rRNA nested PCR. Blood samples were collected from malaria patients who agreed to the study. All blood samples collected in three hospitals (Yangju, Koyang and Ildong), during 2016 and 2017, were screened using 18S rRNA nested PCR. Based on the screened result, 73 samples were identified as positive samples. 1100 bp or 120 bp was detected by 2nd PCR of 18S rRNA. b Nested PCR targeting pvmdr-1 amplicons ranged from 104 bp to 4,254 bp were observed in 73 P. vivax positive samples using pvmdr-1 nested PCR. M: 1 Kb Plus DNA Ladder

Information of primers used to amplify pvmdr-1 gene Pvmdr-1 primers set were adapted from Barnadas et al. [23]. Sequencing primers were newly designed for this study Gel electrophoresis of P. vivax 18S rRNA and pvmdr-1 nested PCR. a 18S rRNA nested PCR. Blood samples were collected from malaria patients who agreed to the study. All blood samples collected in three hospitals (Yangju, Koyang and Ildong), during 2016 and 2017, were screened using 18S rRNA nested PCR. Based on the screened result, 73 samples were identified as positive samples. 1100 bp or 120 bp was detected by 2nd PCR of 18S rRNA. b Nested PCR targeting pvmdr-1 amplicons ranged from 104 bp to 4,254 bp were observed in 73 P. vivax positive samples using pvmdr-1 nested PCR. M: 1 Kb Plus DNA Ladder

Sequencing of pvmdr-1

After the amplification, sequence analysis was performed by specific sequencing primers as shown in Table 1. Sequencing primers were designed to cover the near full-length pvmdr-1 gene (4,395 bp). Direct sequencing of PCR products was performed by using Big Dye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, CA, USA) and the products were resolved on ABI 3730XL Genetic Analyzer (Applied Biosystems, CA, USA).

Phylogenetic analysis

Nearly full-length sequence (from 104 bp to 4,290 bp) of pvmdr-1 was used to perform phylogenetic relationship analysis. The sequences of Sal I strain (GenBank Accession# AY571984) and global parasites in PlasmoDB [25] were used as reference sequences. pvmdr-1 sequences of 73 P. vivax clinical samples isolated from military personnel of the ROK army in 2016 and 2017 were analysed using BioEdit Sequence Alignment Editor. The phylogenetic analysis was constructed by 1000 bootstrap replications [26] using the neighbor-joining method [27].

Results

Nested PCR and SNP analyses of the pvmdr-1 gene

A total of 73 out of 141 samples were identified as P. vivax infected specimen through nested PCR analysis targeting 18S rRNA (Fig. 1a). For SNP analysis of pvmdr-1, nested PCR targeting pvmdr-1 was performed using 73 positive specimens (Fig. 1b), which were used for sequence analysis. As shown in Table 2, five non-synonymous mutations (G698S, L845F, M908L, T958M, and F1076L) were detected in all specimens (2016: 20/20, 2017: 53/53). Interestingly, a novel non-synonymous mutation (Y541C) was detected in 1 soldier at a frequency of 1.8% (2017: 1/53). In addition, silent mutations in K44 [2016: 4/20 (20%), 2017: 24/53 (45.2%)], L493 [2016: 5/20 (25%), 2017: 14/53 (26.4%)], T529 [2016: 15/20 (75%), 2017: 30/53 (56.6%)], and E1233 [2016: 8/20 (40%), 2017: 30/53 (56.6%) positions were detected in specimens. Alignment and mapping data of pvmdr-1 wild-type and mutant-type sequences were provided (Additional File 1: Fig. S1).
Table 2

The list and frequency of pvmdr-1 mutations in ROK army from 2016 to 2017

Mutations in the pvmdr-1 geneNo.(%) of mutated isolates
2016 (N = 20)2017 (N = 53)
K44 (AAG-132-AAA)4/20 (20%)24/53 (45.2%)
L493 (TTA-1477-CTA)5/20 (25%)14/53 (26.4%)
T529 (ACA-1587-ACG)15/20 (75%)30/53 (56.6%)
Y541C (TAC-1622-TGC)0/20 (0%)1/53 (1.8%)
G698S (GGC-2092-AGC)20/20 (100%)53/53 (100%)
L845F (CTC-2533-TTC)20/20 (100%)53/53 (100%)
M908L (ATG-2722-CTG)20/20 (100%)53/53 (100%)
T958M (ACG-2873-ATG)20/20 (100%)53/53 (100%)
F1076L (TTT-3226-CTT)20/20 (100%)53/53 (100%)
E1233 (GAG-3699-GAA)8/20 (40%)30/53 (56.6%)

Quintuple non-synonymous mutations (G689S, L845F, M908L, T958M, and F1076L) and synonymous mutations (K44, L493, T529, and E1233) were detected in specimens. Furthermore, a novel non-synonymous mutation (Y541C) was detected in 1 patient

The list and frequency of pvmdr-1 mutations in ROK army from 2016 to 2017 Quintuple non-synonymous mutations (G689S, L845F, M908L, T958M, and F1076L) and synonymous mutations (K44, L493, T529, and E1233) were detected in specimens. Furthermore, a novel non-synonymous mutation (Y541C) was detected in 1 patient

Genotypic classification of the pvmdr-1 gene

As shown in Table 3, all specimens were clustered into 6 groups from Type 0 to Type 5, and all haplotypes possessed 5 non-synonymous mutations (G698S, L845F, M908L, T958M, and F1076L). 6 haplotypes were classified genotypically based on pvmdr-1 sequences from 73 specimens in the ROK army from 2016 to 2017 (Fig. 2). Type 0 was found in 1 case in 2016, and there was no mutation other than the 5 non-synonymous mutations. For synonymous mutation, K44 mutant was found in Type 1 (2016; 1/20, 2017; 8/53) and Type 2 (2016; 3/20, 2017; 16/53), T529 mutant was found in Type 3 (2016; 5/20, 2017; 14/53), Type 4 (2016; 10/20, 2017; 14/53), and Type 5 (2016; 0/20, 2017 1/53), E1233 mutant was found in Type 2 (2016; 3/20, 2017; 16/53) and Type 3 (2016; 5/20, 2017; 14/53), and L493 was only found in Type 3 (2016; 5/20, 2017; 14/53). Type 5 (2017; 1/53) was nearly the same as Type 4, except it harboured the first identified Y541C mutation. In the years 2016 and 2017, Type 4 (24/73) was abundant and showed a 100% match with the pvmdr-1 sequence of North Korean.
Table 3

The haplotypes of the pvmdr-1 gene in Republic of Korea from 2016 to 2017

K44AAG → AAAL493TTA → CTAT529ACA → ACGY541CTAC → TGCG698SGGC → AGCL845FCTC → TTCM908LATG → CTGT958MACG → ATGF1076LTTT → CTTE1233GAG → GAAFrequency
20162017
Type 0AGCTTCCTGATGCTT10
Type 1AAAAGCTTCCTGATGCTT18
Type 2AAAAGCTTCCTGATGCTTGAA316
Type 3CTAACGAGCTTCCTGATGCTTGAA514
Type 4ACGAGCTTCCTGATGCTT1014
Type 5ACGTGCAGCTTCCTGATGCTT01
2053

All haplotypes (Type 0 to Type 5) contains quintuple non-synonymous SNPs (G689S, L845F, M908L, T958M and F1076L, marked in bold), novel non-synonymous SNP (Y541C), or synonymous SNPs (K44, L493, T529 and E1233) from 2016 to 2017. The frequency of each type was listed

Fig. 2

The malaria-endemic region and pvmdr-1 haplotypes of ROK in 2016 and 2017. Each red triangle indicates malaria-endemic region of haplotypes [Goseong (Type 1 and 4), Cheorwon (Type 1, 2, 3, 4, and 5), Yeonchen (Type 0, 1, 2, 3 and 4), Paju (Type 1, 2, 3 and 4), Gimpo (Type 2), and Hwacheon (Type 1 and 4)]. Six haplotypes were classified from 73 specimens collected in the Armed Forces Hospitals (Yangju, Koyang, and Ildong). Numeric letters mean 6 haplotypes. Reprinted from USGS National Map Viewer [36] under a CC BY license, with permission from U.S. Geological Survey, original copyright 2002

The haplotypes of the pvmdr-1 gene in Republic of Korea from 2016 to 2017 All haplotypes (Type 0 to Type 5) contains quintuple non-synonymous SNPs (G689S, L845F, M908L, T958M and F1076L, marked in bold), novel non-synonymous SNP (Y541C), or synonymous SNPs (K44, L493, T529 and E1233) from 2016 to 2017. The frequency of each type was listed The malaria-endemic region and pvmdr-1 haplotypes of ROK in 2016 and 2017. Each red triangle indicates malaria-endemic region of haplotypes [Goseong (Type 1 and 4), Cheorwon (Type 1, 2, 3, 4, and 5), Yeonchen (Type 0, 1, 2, 3 and 4), Paju (Type 1, 2, 3 and 4), Gimpo (Type 2), and Hwacheon (Type 1 and 4)]. Six haplotypes were classified from 73 specimens collected in the Armed Forces Hospitals (Yangju, Koyang, and Ildong). Numeric letters mean 6 haplotypes. Reprinted from USGS National Map Viewer [36] under a CC BY license, with permission from U.S. Geological Survey, original copyright 2002

Phylogenetic analysis of the pvmdr-1 gene

The phylogenetic relationships on the overall pvmdr-1 sequence were analysed and classified them into 6 haplotypes (Table 3). Type 4 sequence was identical to the MDR sequence in North Korean (length = 0.00001). The neighbourhood types of 6 haplotypes were identified as China_NB-16 and Papua New Guinea-PNG58/Thailand_VKBT-106 (Fig. 3).
Fig. 3

Phylogenetic analysis of 6 classified haplotypes via pvmdr-1 SNP analysis of 73 P. vivax clinical samples. The sequences of pvmdr-1 were aligned with that of Sal I strain (GenBank Accession# AY571984) and PlasmoDB by using BioEdit Sequence Alignment Editor. The aligned sequences were performed phylogenetic analysis by using 1000 bootstrap replications and the neighbour-joining method

Phylogenetic analysis of 6 classified haplotypes via pvmdr-1 SNP analysis of 73 P. vivax clinical samples. The sequences of pvmdr-1 were aligned with that of Sal I strain (GenBank Accession# AY571984) and PlasmoDB by using BioEdit Sequence Alignment Editor. The aligned sequences were performed phylogenetic analysis by using 1000 bootstrap replications and the neighbour-joining method

Discussion

Plasmodium vivax-endemic area is localized in the Gyeonggi province of the ROK near the DMZ. In this study, pvmdr-1 SNPs of P. vivax were analysed using malaria-infected blood specimens in malaria-endemic regions including Goseong, Cheorwon, Yeonchen, Paju, Gimpo, and Hwacheon (Fig. 2). Since 1997, the ROK Army has conducted continuous malaria chemoprophylaxis (CQ and PQ) to prevent and reduce transmission of malaria for approximately 100,000 military personnel. Due to the massive chemoprophylaxis efforts, there is a consistent concern regarding CQR. According to various reports [5, 28], long-term or massive chemoprophylaxis could cause CQR. Thus, the surveillance system should be needed to estimate the risk of chemoprophylaxis-mediated drug resistance. ROK army also has been interested in analysing SNPs of drug resistant-related genes along with the implementation of chemoprophylaxis. Thus, the SNPs analysis of pvmdr-1 against malaria-infected soldiers near chemoprophylaxis-executed malaria-endemic regions was investigated in clinical samples. CQR has occasionally been observed in malaria-endemic regions that follow extensive chemoprophylaxis. Through preventive CQR study, CQR was confirmed in 2 of 484 enrolled patients [29]. CQR was also studied via the treatment responses of P. vivax malaria patients in the ROK monitored during 2003–2007 [28]. Until recently, it was reported that P. vivax resistance to CQ had emerged in South America and French Guiana [30, 31]. In the ROK, to date, most malaria patients in the military have been cured with malaria chemotherapy. However, issues with chemoprophylaxis-mediated resistance have recently been reported [6, 28]. For example, Yeom and colleagues suggested that malaria resistance to prophylactic agents could decrease CQ susceptibility, and they cited that the mass chemoprophylaxis with CQ in the ROK Army could contribute to this issue [5]. Therefore, the relationship between CQ susceptibility and chemoprophylaxis should also be investigated. To date, although CQR cases of P. vivax malaria have been reported in many other areas of the world, the drug resistance in malaria-endemic regions of ROK has been reported rarely [28]. However, the issue of drug insusceptibility to CQ and rapid transition of pvmdr-1 SNPs has been raised [32]. In previous, Chung et al. identified four SNPs (F1076L, T529, E1233, and S1358) of pvmdr-1 in malaria-endemic regions of ROK from 2011 to 2012 [11]. In this study, the Y541C, K44, L493, and T529 mutations centred around quintuple mutations (G698S, L845F, M908L, T958M, and F1076L) in the pvmdr-1 gene were detected in malaria-infected military personnel of the ROK. Thus, it could be inferred that the rapid SNP transition of pvmdr-1 in chemoprophylaxis-executed malaria-endemic regions has been occurring. In the reports investigating the relationship between CQR and pvmdr-1 SNP, Suwanarusk et al. revealed that the Y976F mutation was linked to CQR based on an increase in the IC50 value [33]. In another report, the F1076L mutation was linked to the Y976F SNP as a background mutation [34]. This study neither identified any SNPs at the Y976F position nor concluded whether Y976F was linked with F1076L. And it also showed no CQR with the Y541C mutation. Thus, it could be inferred that the Y541C mutation was not related to CQR. Phylogenetic analysis showed that Type 4 (T529, G698S, L845F, M908L, T958M, and F1076L) was significantly related to the Type identified for North Koreans. In addition, a review by Chai indicated that a mosquito with blood from a malaria patient in North Korea near the DMZ flew south and infected Korean soldiers [6]. Based on this result, it is deduced that P. vivax malaria was introduced from North Korea, rather than as an influx from foreign countries. Since 2016, to evaluate the risk from malaria chemoprophylaxis in the ROK, G6PD deficiency prevalence has been investigated [35], and to infer the risk of resistance potentially introduced by chemoprophylaxis, SNPs of P. vivax genes have been examined by the Armed forces Medical Command (AFMC) and the Armed forces Medical Research Institute (AFMRI) of ROK. This study focused SNPs of pvmdr-1 against malaria-infected soldiers near chemoprophylaxis-executed malaria-endemic regions. However, for a more practical resistance analysis and effectiveness of malaria chemoprophylaxis, in vivo or ex vivo resistance studies via analysing malaria infection ratio or CQ metabolite under malaria chemoprophylaxis are needed via further research. Therefore, it is currently planned to perform these studies in cooperation with AFMC and KDCA (Korea Disease Control Agency).

Conclusions

In this study, there were clinical samples that possessed various SNPs of pvmdr-1. Thus, it inferred that quintuple mutation (G698S, L845F, M908L, T958M, and F1076L) was a prevalent background mutation in malaria-infected military personnel of the ROK. Phylogenetic analysis indicated that the malaria type was close to the type seen in North Korean, indicating that P. vivax malaria in the ROK could have come from North Korea. Furthermore, consistent monitoring of chemoprophylaxis-linked pvmdr-1 polymorphisms should be conducted to detect rapidly changed SNP profiling against P. vivax malaria in the ROK. Additional file 1: Fig. S1. Alignment and mapping data of pvmdr-1 wild-type and mutant-type sequences in ROK army in 2016-2017. After the amplification of pvmdr-1using 73 P. vivax clinical samples, sequencing of PCR products was performed by using Big Dye™ Terminator v3.1 Cycle Sequencing Kit and ABI 3730XL Genetic Analyzer. Sequence analysis was performed using BioEdit Sequence Alignment Editor. The red box indicates the changed nucleotide in the alignment of pvmdr-1 SNPs for 20 and 53 specimens in 2016 and 2017. MDRF-WT is used as a reference sequence of pvmdr-1 gene (Gene Accession# AY571984).
  32 in total

Review 1.  Chloroquine resistance in Plasmodium vivax.

Authors:  J Kevin Baird
Journal:  Antimicrob Agents Chemother       Date:  2004-11       Impact factor: 5.191

Review 2.  Plasmodium vivax malaria: status in the Republic of Korea following reemergence.

Authors:  Jae-Won Park; Gyo Jun; Joon-Sup Yeom
Journal:  Korean J Parasitol       Date:  2009-10       Impact factor: 1.341

3.  The international limits and population at risk of Plasmodium vivax transmission in 2009.

Authors:  Carlos A Guerra; Rosalind E Howes; Anand P Patil; Peter W Gething; Thomas P Van Boeckel; William H Temperley; Caroline W Kabaria; Andrew J Tatem; Bui H Manh; Iqbal R F Elyazar; J Kevin Baird; Robert W Snow; Simon I Hay
Journal:  PLoS Negl Trop Dis       Date:  2010-08-03

4.  Development of resistance to chloroquine by Plasmodium vivax in Myanmar.

Authors: 
Journal:  Trans R Soc Trop Med Hyg       Date:  1995 May-Jun       Impact factor: 2.184

5.  Status of Plasmodium vivax malaria in the Republic of Korea, 2008-2009: decrease followed by resurgence.

Authors:  Joon-Sup Yeom; Gyo Jun; Jung-Yeon Kim; Won-Ja Lee; E-Hyun Shin; Kyu-Sik Chang; Ji-Hwan Bang; Sejoong Oh; Joon-Young Kang; Jae-Won Park
Journal:  Trans R Soc Trop Med Hyg       Date:  2012-05-04       Impact factor: 2.184

6.  Chloroquine-resistant Plasmodium vivax in Papua New Guinea.

Authors:  G J Schuurkamp; P E Spicer; R K Kereu; P K Bulungol; K H Rieckmann
Journal:  Trans R Soc Trop Med Hyg       Date:  1992 Mar-Apr       Impact factor: 2.184

7.  Polymorphisms in chloroquine resistance-associated genes in Plasmodium vivax in Ethiopia.

Authors:  Lemu Golassa; Berhanu Erko; Frederick N Baliraine; Abraham Aseffa; Göte Swedberg
Journal:  Malar J       Date:  2015-04-16       Impact factor: 2.979

Review 8.  Emerging Plasmodium vivax resistance to chloroquine in South America: an overview.

Authors:  Lígia Antunes Gonçalves; Pedro Cravo; Marcelo Urbano Ferreira
Journal:  Mem Inst Oswaldo Cruz       Date:  2014-08       Impact factor: 2.743

9.  Multiple Origins of Mutations in the mdr1 Gene--A Putative Marker of Chloroquine Resistance in P. vivax.

Authors:  Mette L Schousboe; Samir Ranjitkar; Rupika S Rajakaruna; Priyanie H Amerasinghe; Francisco Morales; Richard Pearce; Rosalyn Ord; Toby Leslie; Mark Rowland; Nahla B Gadalla; Flemming Konradsen; Ib C Bygbjerg; Cally Roper; Michael Alifrangis
Journal:  PLoS Negl Trop Dis       Date:  2015-11-05
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.