Ke Li1, Ming Yang1, Mengyue Tian2, Li Jia1, Jinliang Du1,3, Yinghao Wu1, Lianmin Li1, Lining Yuan1, Yuzhong Ma4. 1. College of Veterinary Medicine, Hebei Agricultural University, Baoding, 071001, Hebei, China. 2. College of Life Science and Food Engineering, Hebei University of Engineering, Handan, 056038, Hebei, China. 3. Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi, 214081, China. 4. College of Veterinary Medicine, Hebei Agricultural University, Baoding, 071001, Hebei, China. dkma@hebau.edu.cn.
Abstract
BACKGROUND: Mastitis is one of the most prevalent diseases and causes considerable economic losses in the dairy farming sector and dairy industry. Presently, antibiotic treatment is still the main method to control this disease, but it also brings bacterial resistance and drug residue problems. Lactobacillus plantarum (L. plantarum) is a multifunctional probiotic that exists widely in nature. Due to its anti-inflammatory potential, L. plantarum has recently been widely researched in complementary therapies for various inflammatory diseases. In this study, the apoptotic ratio, the expression levels of various inflammatory mediators and key signalling pathway proteins in Escherichia coli-induced bovine mammary epithelial cells (BMECs) under different doses of L. plantarum 17-5 intervention were evaluated. RESULTS: The data showed that L. plantarum 17-5 reduced the apoptotic ratio, downregulated the mRNA expression levels of TLR2, TLR4, MyD88, IL1β, IL6, IL8, TNFα, COX2, iNOS, CXCL2 and CXCL10, and inhibited the activation of the NF-κB and MAPK signalling pathways by suppressing the phosphorylation levels of p65, IκBα, p38, ERK and JNK. CONCLUSIONS: The results proved that L. plantarum 17-5 exerted alleviative effects in Escherichia coli-induced inflammatory responses of BMECs.
BACKGROUND: Mastitis is one of the most prevalent diseases and causes considerable economic losses in the dairy farming sector and dairy industry. Presently, antibiotic treatment is still the main method to control this disease, but it also brings bacterial resistance and drug residue problems. Lactobacillus plantarum (L. plantarum) is a multifunctional probiotic that exists widely in nature. Due to its anti-inflammatory potential, L. plantarum has recently been widely researched in complementary therapies for various inflammatory diseases. In this study, the apoptotic ratio, the expression levels of various inflammatory mediators and key signalling pathway proteins in Escherichia coli-induced bovine mammary epithelial cells (BMECs) under different doses of L. plantarum 17-5 intervention were evaluated. RESULTS: The data showed that L. plantarum 17-5 reduced the apoptotic ratio, downregulated the mRNA expression levels of TLR2, TLR4, MyD88, IL1β, IL6, IL8, TNFα, COX2, iNOS, CXCL2 and CXCL10, and inhibited the activation of the NF-κB and MAPK signalling pathways by suppressing the phosphorylation levels of p65, IκBα, p38, ERK and JNK. CONCLUSIONS: The results proved that L. plantarum 17-5 exerted alleviative effects in Escherichia coli-induced inflammatory responses of BMECs.
Mastitis is one of the most prevalent diseases in dairy cows, causing severe economic losses and restricting the development of the dairy cow industry [1]. It is usually caused by infection of the mammary gland with pathogens, such as Escherichia coli, one of the major environmental pathogens responsible for dairy cow mastitis [2, 3]. Coliform mastitis is normally characterized by severe local inflammatory responses and systemic symptoms, and can even cause death under the most serious circumstances [4]. Therefore, it is essential to determine the primary pathogens and inhibit inflammatory reactions to control this disease.Currently, there is no exact and effective treatment for dairy cow mastitis in the clinic, and antibiotics are often used to control the progression of disease. Despite the positive results of this treatment approach, the excessive use of antibiotics also brings drug resistance and residue problems [5, 6]. Considering these potential issues, many countries, such as China and the European Union, have already restricted antibiotics in animal feed [7]. Hence, finding alternative safe and effective drugs is of great importance for human health and animal welfare.L. plantarum is a versatile and abundant probiotic found in diverse environments ranging from food to animal and human gastrointestinal tracts [8]. L. plantarum is widely used for food processing and livestock feed due to its potential health benefits and biosafety [9]. In recent years, with the deepening of research, the potential anti-inflammatory properties of L. plantarum have come into the sight of researchers. Yue et al. found that L. plantarum could reduce the expression of TLR4, IL6, and TNFα as well as jejunal injury and had a protective effect on diarrhoea caused by enterotoxigenic Escherichia coli [10]. Tian et al.’s research showed that oral supplementation with L. plantarum TW1–1 decreased inflammation and modulated gut microbiota in DEHP-induced testicular damage mice [11]. Frola et al. pointed out that L. plantarum CRL 1716 provided good therapeutic effects on dairy cow mastitis after intramammary inoculation in lactating cows [12]. Thus, we hypothesized that L. plantarum might have a protective effect against inflammatory injury in mastitis cows. However, our analysis of the present literature reveals that related basic research is still limited.In this study, the probiotic L. plantarum 17–5 with possible anti-inflammatory activity was selected. This study aimed to investigate the potential protective effects of this probiotic on Escherichia coli-induced inflammatory responses of BMECs and lay an excellent foundation for developing relevant microecological preparations.
Results
Dose effect of L. plantarum 17–5 on cell viability
To evaluate the toxicity of L. plantarum 17–5 on BMECs, the CCK-8 assay was performed to detect cell viability. As shown in Fig. 1, none of the tested concentrations showed cytotoxicity on BMECs, except the 107 CFU/mL dose. Therefore, three concentrations (104, 105 and 106 CFU/mL) were selected for subsequent experiments.
Fig. 1
The cytotoxic effects of L. plantarum 17–5 on BMECs. Cell viability was assessed at gradient concentrations of L. plantarum 17–5 (0, 103, 104, 105, 106 and 107 CFU/mL) for 3 h by CCK-8 assay. The data were presented as the mean ± SEM, n = 5
The cytotoxic effects of L. plantarum 17–5 on BMECs. Cell viability was assessed at gradient concentrations of L. plantarum 17–5 (0, 103, 104, 105, 106 and 107 CFU/mL) for 3 h by CCK-8 assay. The data were presented as the mean ± SEM, n = 5
Effect of L. plantarum 17–5 on apoptosis of BMECs
The effects of varying L. plantarum 17–5 doses on the apoptosis of BMECs were analysed (Fig. 2A). The results showed that the apoptotic ratio in the ECOL group increased significantly (P < 0.05) compared with those in the CON group and decreased significantly (P < 0.05) in the L. plantarum 17–5 preconditioning group compared with those in the ECOL group (Fig. 2B). Similar results were seen in the necrotic ratio. The necrotic ratio in each dose preconditioning group decreased significantly (P < 0.05) compared with those in the ECOL group (Fig. 2C).
Fig. 2
A Apoptosis was determined by Annexin V-FITC/PI staining. The apoptotic cells showed green fluorescence (FITC-positive and PI-negative), necrotic cells showed both green and red fluorescence (FITC-positive and PI-positive), and normal cells had no fluorescence signal (FITC-negative and PI-negative). Scale bars: 100 μm. (B, C) The apoptotic ratio and necrotic ratio in each group. Values from five visual fields were shown as mean ± SEM. The same letter on top of the bars indicated no significant difference, however, different letters indicated significant difference (P < 0.05). The same as the following figures
A Apoptosis was determined by Annexin V-FITC/PI staining. The apoptotic cells showed green fluorescence (FITC-positive and PI-negative), necrotic cells showed both green and red fluorescence (FITC-positive and PI-positive), and normal cells had no fluorescence signal (FITC-negative and PI-negative). Scale bars: 100 μm. (B, C) The apoptotic ratio and necrotic ratio in each group. Values from five visual fields were shown as mean ± SEM. The same letter on top of the bars indicated no significant difference, however, different letters indicated significant difference (P < 0.05). The same as the following figures
Effect of L. plantarum 17–5 on the mRNA expressions of TLRs and MyD88
The expression levels of TLR2, TLR4 and MyD88 were measured by real-time PCR. As shown in Fig. 3, after E. coli induction, the expression levels of TLR2, TLR4 and MyD88 mRNA increased compared with those in the CON group (P < 0.05). Pretreatment with three different doses of L. plantarum 17–5 significantly reduced the expression of TLR2, TLR4 and MyD88 mRNA after E. coli infection (P < 0.05) (Fig. 3A-C).
Fig. 3
Effects of L. plantarum 17–5 on TLRs and MyD88 mRNA expression in E. coli-treated BMECs. The mRNA expression levels of TLR2, TLR4 and MyD88 (A-C) were evaluated with qRT–PCR in BEECs. The values were presented as the means ± SEM of three independent experiments
Effects of L. plantarum 17–5 on TLRs and MyD88 mRNA expression in E. coli-treated BMECs. The mRNA expression levels of TLR2, TLR4 and MyD88 (A-C) were evaluated with qRT–PCR in BEECs. The values were presented as the means ± SEM of three independent experiments
Effect of L. plantarum 17–5 on the mRNA expression of inflammatory mediators and chemokines
The expression levels of IL1β, IL6, IL8, TNFα, COX2, iNOS, CXCL2 and CXCL10 were examined using the same method as above. The results showed that E. coli increased the mRNA levels of all the indicators (P < 0.05). However, these increases were significantly mitigated by pretreatment of L. plantarum 17–5 (P < 0.05) (Fig. 4A-H).
Fig. 4
Effects of L. plantarum 17–5 on the inflammatory mediator and chemokine mRNA expression in E. coli-treated BMECs. The mRNA expression levels of IL1β IL6, IL8, TNFα, COX2, iNOS, CXCL2 and CXCL10 (A-H) in BEECs were detected with the same methods as above. Values were presented as the means ± SEM from three independent experiments
Effects of L. plantarum 17–5 on the inflammatory mediator and chemokine mRNA expression in E. coli-treated BMECs. The mRNA expression levels of IL1β IL6, IL8, TNFα, COX2, iNOS, CXCL2 and CXCL10 (A-H) in BEECs were detected with the same methods as above. Values were presented as the means ± SEM from three independent experiments
Effect of L. plantarum 17–5 on the protein expression of the NF-κB and MAPK pathways
Western blot analysis demonstrated that E. coli upregulated the phosphorylation levels of p65, IκBα, p38, ERK and JNK (P < 0.05). However, these upregulations were inhibited by pretreatment of L. plantarum 17–5 (Fig. 5A, B).
Fig. 5
Inhibitory effects of L. plantarum 17–5 on NF-κB (A) and MAPK (B) phosphorylation in BMECs. Data were represented as the mean ± SEM of three independent experiments
Inhibitory effects of L. plantarum 17–5 on NF-κB (A) and MAPK (B) phosphorylation in BMECs. Data were represented as the mean ± SEM of three independent experiments
Discussion
Due to the multiple problems caused by the overuse of antibiotics, several alternative biologics, including beneficial microbes, are being considered to treat and prevent dairy cow mastitis [13]. Several studies suggested that some lactic acid bacteria showed promising effects in treating bovine mastitis [14, 15], among which L. plantarum is a typical Lactobacillus species with various beneficial effects on host metabolic health. Martín et al. successfully isolated Lactobacillus fermentum, Lactobacillus aerogenes and Lactobacillus salivarius from the milk of healthy females, thereby confirming the existence of probiotics in normal healthy mammary gland tissue [16], this study provides a basis for probiotic treatment in humans. However, there are still some potential problems with this biological therapy, especially when it acts directly on the mammary gland tissue. A recent study reported that intramammary injections of Lactococcus lactis (approximately 107 CFU) might elicit a suppurative inflammatory response in the murine model [17]. In light of these challenges, we used a lower dose and treatment time than the above report. Meanwhile, the cytotoxicity assay showed that test doses of L. plantarum 17-5 were not toxic to BMECs. Given this result and subsequent indicators, we believe that the test conditions were safe and effective for the cell.Identifying pathogens is the first step in defence against invading pathogens in the immune system [18]. Mammary epithelial cells have many pattern recognition receptors (PRRs) that are distributed on the cell surface or in the cytoplasm, such as toll-like receptors (TLRs) [19]. Some TLRs, which span the cell membrane, can recognize pathogen-associated molecular patterns (PAMPs). For example, TLR2 recognizes bacterial lipoproteins, and TLR4 recognizes exogenous ligands such as LPS [20]. Escherichia coli is an important causative agent of dairy cow mastitis due to its higher incidence rate than other pathogenic microbes [21]. After E. coli invades cow mammary tissue, the TLR2 and TLR4 receptors are activated, which mostly leads to MyD88 downstream signalling and consequently activates a series of downstream pathways, kinases and transcription factors [18, 22]. In this study, we found that the mRNA expression levels of TLR2, TLR4 and MyD88 were upregulated after incubation with E. coli at 8 h, whereas preincubation with L. plantarum 17–5 significantly suppressed these changes. Based on these results, we suspect that L. plantarum 17–5 has regulatory effects on downstream inflammatory genes and pathways.Bacterial infections are usually accompanied by severe inflammatory responses [23]. Excessive inflammatory mediator production can promote inflammatory injury and induce cell apoptosis [24, 25]. TNFα is an inflammatory mediator that plays a proinflammatory role in early inflammation [26]. IL1β and IL6 participate in the occurrence and development of inflammation by activating the expression of other proinflammatory cytokines and modulating chemokine expression [27]. PGE2 and NO were proven to induce intense inflammation with trace amounts in previous research, whereas COX2 and iNOS are key enzymes in their biosynthesis, respectively [28]. Furthermore, some chemokines, such as IL8, CXCL2 and CXCL10, have also been implicated in inflammatory injury [29]. Previous studies have shown that E. coli can stimulate host cells to release various proinflammatory mediators, including IL1β, IL6, TNFα and NO, while inducing cell apoptosis [30, 31]. Our results showed that pretreatment with different doses of L. plantarum 17–5 reduced the expression of IL1β, IL6, IL8, TNFα, COX2, iNOS, CXCL2 and CXCL10 during E. coli infection. We also evaluated the effect of L. plantarum 17–5 on E. coli-induced apoptosis. As expected, L. plantarum 17–5 inhibited the apoptosis of these cells. This result is consistent with a previous report that probiotics can inhibit induced apoptosis [31].The MAPK and NF-κB signalling pathways, which are downstream of TLRs, play a key role in regulating cellular proliferation, apoptosis, and inflammation [32]. NF-κB is a pleiotropic transcription factor involved in the control of proinflammatory gene expression, such as TNFα, IL6, COX2 and iNOS [33]. In the quiescent state, NF-κB, as an inactive complex, binds to IκB, an NF-κB inhibitor. Under the action of upstream factors, IκB is phosphorylated and dissociates from NF-κB, allowing NF-κB p65 to translocate to the nucleus and thus activate related gene transcription [34]. The MAPK pathways include p38 MAPK, ERK1/2, and JNK, and this pathway controls the synthesis and release of cytokines during the inflammatory response [35]. The activation of each MAPK depends on multiple upstream kinases with unique cascade reactions [36]. A previous report indicated that Lactobacillus plantarum could inhibit the inflammatory response by modulating the NF-κB and MAPK pathways [37, 38]. Similarly, our data suggest that L. plantarum 17–5 markedly decreased the phosphorylation of key proteins in the NF-κB and MAPK signalling pathways.
Conclusions
In conclusion, L. plantarum 17–5 can attenuate E. coli-induced inflammatory responses by inhibiting the mRNA expression of inflammatory mediators and the activation of the NF-κB and MAPK signalling pathways in BMECs and may be a potential therapeutic agent for dairy cow mastitis. However, due to the limitations of the in vitro model, the biological significance of these findings needs further investigation in vivo.
Materials and methods
Chemicals and reagents
Dulbecco’s modified Eagle’s medium/Ham’s F-12 nutrient mixture (DMEM/F12) and foetal bovine serum (FBS) were purchased from Gibco (Grand Island, NY), hydrocortisone from Sigma–Aldrich (MO, USA), de Man Rogosa Sharpe (MRS) broth and Luria-Bertani (LB) broth from Aobox (Beijing, China), cell counting kit-8 (CCK-8), RIPA lysis buffer, BCA protein assay kit and BCIP/NBT colour development kit from Solarbio (Beijing, China), and ultrapure RNA extraction kit from CWBIO (Beijing, China). Uelris Il RT–PCR System for First-Strand cDNA Synthesis and AugeGreen™ qPCR Master Mix from US Everbright Inc. (CA, USA), and an Annexin V-FITC Apoptosis Detection Kit from Beyotime (Shanghai, China). Primary antibodies against p38 (Catalog #8690 T), phospho-p38 (Catalog #4511 T), ERK (Catalog #4695 T), phospho-ERK (Catalog #4370 T), JNK (Catalog #9252 T), phospho-JNK (Catalog #4668 T) and IκBα (Catalog #4812S) were acquired from Cell Signaling Technology (Danvers, MA, USA), and antibodies against NF-κB p65 (Catalog #bs-0465R), NF-κB phospho-p65 (Catalog #bs-0982R), phospho-IκBα (Catalog #bsm-52169R) and β-actin (Catalog #bs-0061R) were purchased from Bioss (Woburn, MA, USA).
Culture of bacterial strains and cells
Lactobacillus plantarum 17–5 (ATCC 8014, American Type Culture Collection, Manassas, VA, USA) was cultured by static culture with MRS broth at 37 °C for 24 h. Escherichia coli O111:K58 (B4) (ATCC 43887) was grown in LB broth at 37 °C for 12 h with shaking. After three generations, bacterial strains at the logarithmic growth phase were used for subsequent experiments. Primary cultures of bovine mammary epithelial cells (BMECs) from the mammary glands of Holstein dairy cows by modification of previously reported protocol [39], these changes were made to make cells grow better. The acquired mammary tissues were washed using PBS with constant stirring to remove residual milk, finely sliced into small pieces (0.5 cm3) and cultured in humidified air containing 5% CO2 at 37 °C. When the cells were 60–80% confluent, the tissue was removed. The fibroblasts were removed and subsequent epithelial cells were enriched according to their different sensitivity to 0.25% trypsin-EDTA. Next, the cells were inoculated into new flasks and cultured in DMEM/F12 supplemented with 15% FBS, 0.1% hydrocortisone, 0.025 M HEPES, 100 U/mL penicillin–streptomycin, and maintained in the same culture conditions as described above.
Cell viability assay
The L. plantarum 17–5 cytotoxicity to BMECs was evaluated using the CCK-8 assay according to the manufacturer’s instructions. BMECs were seeded into 96-well microplates at a concentration of 1 × 104 cells/well and cultured to 80–90% confluence. Cells were treated with varying concentrations of L. plantarum 17–5 (103 to 107 CFU/mL) for 3 h. Then, 10 μL CCK-8 solution was added to each well and further incubated for 2 h at 37°C. Subsequently, the absorbance at 450 nm was measured using a microplate reader.
Cell immunofluorescence assay
BMECs were seeded in 96-well plates and cultured to 70–80% confluence as described above. The confluent cells were then treated as follows: CON group, DMEM/F12 alone; ECOL group, E. coli (107 CFU/mL) infection alone; LP group, L. plantarum 17–5 (105 CFU/mL) incubation alone for 3 h; (L, M, H) LP + ECOL group, L. plantarum 17–5 (104, 105 and 106 CFU/mL) preincubation for 3 h before the addition of E. coli (107 CFU/mL). After E. coli infection for 8 h, the medium was discarded, and the cells were washed with PBS. Subsequently, the cells were stained with an Annexin V-FITC / Propidium Iodide (PI) Apoptosis Detection Kit and observed under a fluorescence microscope. Five visual fields were randomly selected for microscopic observation and the positive cells were counted by ImageJ software (NIH, Bethesda, USA). The apoptotic ratio was calculated as the ratio between the number of apoptotic cells in the treatment group and the untreated control group. The same was done for the necrotic ratio.
qRT–PCR analysis
Total RNA from BMECs was extracted using the Ultrapure RNA extraction kit according to the manufacturer’s instructions. The RNA integrity was assessed by agarose gel electrophoresis and the concentration and purity (the ratio of the OD260/OD280 and OD260/OD230) were measured on the Nanodrop 2000 (Thermo Fisher Scientific, Wilmington, DE, USA). Then the above RNA is reversely transcribed into cDNA by a reverse transcription kit for quantitative real-time PCR (qRT–PCR) analyses. The reaction procedures were as follows: 300 s at 95 °C followed by 40 cycles of 5 s at 95 °C, 30 s at 60 °C and 15 s at 72 °C. The PCR amplification efficiency was evaluated using standard curve analysis. The level of target gene expression was normalized to the GAPDH reference gene (For stability of the reference genes, please refer to supplementary material) and calculated using the 2−ΔΔCt method, and the primer sequences are listed in Table 1.
Table 1
Sequences of primer used for qRT-PCR
Gene
Primer sequence (5′-3′)
Product sizes (bp)
GenBank accession no.
TLR2
CATTCCCTGGCAAGTGGATTATC
201
AY634629
GGAATGGCCTTCTTGTCAATGG
TLR4
AGCTTCAACCGTATCATGGCCTCT
166
NM_174198.6
ACTAAGCACTGGCATGTCCTCCAT
MyD88
AAGTACAAGCCAATGAAGAAAGAG
102
NM_001014382.2
GAGGCGAGTCCAGAACCAG
IL-1β
CCTCGGTTCCATGGGAGATG
119
NM_174093.1
AGGCACTGTTCCTCAGCTTC
IL-6
TGAAAGCAGCAAGGAGACACT
90
NM_173923.2
TGATTGAACCCAGATTGGAAGC
TNF-α
GGGCTTTACCTCATCTACTCACAG
132
NM_173966.3
GATGGCAGACAGGATGTTGACC
IL-8
ACACATTCCACACCTTTCCAC
149
AF232704
ACCTTCTGCACCCACTTTTC
COX-2
GGTGCCTGGTCTGATGATGT
124
NM_174445.2
GATTAGCCTGCTTGTCTGGA
iNOS
TGTCAGCGGCAAGCACCACATT
289
NM_001076799.1
CGGCTGGTTGCATGGGAAAACT
CXCL-2
ACCGAAGTCATAGCCACTCTC
218
NM_174299.3
TCCAGATGGCCTTAGGAGGT
CXCL-10
CTCGAACACGGAAAGAGGCA
117
NM_001046551
TCCACGGACAATTAGGGCTT
GAPDH
CACCCTCAAGATTGTCAGCA
103
NM_001034034.2
GGTCATAAGTCCCTCCACGA
Sequences of primer used for qRT-PCR
Western blot analysis
Proteins from cells were extracted using RIPA lysis buffer and quantified using a BCA protein assay kit. Protein samples (20 μg) were separated on 12% polyacrylamide-SDS gels, and resolved proteins were then transferred onto nitrocellulose membranes. The membrane was blocked with 5% skimmed milk for 1 h at room temperature. After incubation with primary and secondary antibodies, immunoblot signals were visualized with an NBT/BCIP colour development kit. The densities of the protein bands from three separate experiments were quantified by ImageJ software.
Statistical analysis
All data are presented as the mean ± SEM from at least three independent experiments. Comparisons between the groups were evaluated by one-way ANOVA test with Tukey’s multiple comparisons test. P values < 0.05 were considered significantly different.Additional file 1. The original, full length blots of western blot.Additional file 2. Analysis of reference genes expression stability.