Literature DB >> 35758269

Preparation of a nanopearl powder/C-HA (chitosan-hyaluronic acid)/rhBMP-2 (recombinant human bone morphogenetic protein-2) composite artificial bone material and a preliminary study of its effects on MC3T3-E1 cells.

Wenbo Zhang1, Pu Xu2, Yanan Cheng2, Yanlan Yang2, Qiuhua Mao1, Zuogeng Chen2.   

Abstract

A nanopearl powder/C-HA (chitosan-hyaluronic acid)/rhBMP-2 (recombinant human bone morphogenetic protein-2) composite artificial bone material was prepared, and its biological properties were evaluated. The nanopearl powder/C-HA/rhBMP-2 composite porous artificial bone material was prepared using the freeze-drying method after the nanopearl powder was prepared using mechanical ball milling. The particle was measured with a transmission electron microscope, its surface morphology and pore size were observed under a scanning electron microscope. The porosity of the artificial bone was determined using pycnometry, a compression performance test was conducted with a universal testing machine, and XRD (X-ray diffraction) patterns were recorded to examine the crystal form of the pearl powder in the composite artificial bone. Finally, the artificial bone was cocultured with mouse MC3T3-E1 cells to investigate its effects on cell proliferation and differentiation and the expression of osteogenesis-related genes. The pearl powder prepared in this experiment had a particle size in the nanometer range. This nanopearl powder, along with C-HA and rhBMP-2, was compounded into the nanopearl powder/C-HA/rhBMP-2 composite artificial bone, showing pore sizes of 188.53 ± 15.32 μm, a porosity of 86.43 ± 2.78% and a compressive strength of 0.342 ± 0.024 MPa. Notably, rhBMP-2 was released from the artificial bone in a sustained manner. Moreover, this artificial bone promoted the adhesion, proliferation, and differentiation of MC3T3-E1 cells and upregulated the expression of ColαI (collagen α1), OCN (osteocalcin), OPN (osteopontin) and Runx2 (runt-related gene 2). Conclusively, this nanopearl powder/C-HA/rhBMP-2 composite artificial bone material showed good performance and cytocompatibility, suggesting that it can be used for bone tissue engineering.

Entities:  

Keywords:  Nanopearl powder; chitosan; composite artificial bone; hyaluronic acid; recombinant human bone morphogenetic protein

Mesh:

Substances:

Year:  2022        PMID: 35758269      PMCID: PMC9342380          DOI: 10.1080/21655979.2022.2085394

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   6.832


Highlights

The pearl powder prepared had a particle size in the nanometer range. The rhBMP-2 was released from the artificial bone in a sustained manner. Artificial bone promoted the adhesion, proliferation, and differentiation of MC3T3-E1 cells

Introduction

Bone defects caused by trauma, tumors, infections or other factors are some of the difficulties that stomatologists often encounter, and they may lead to varying degrees of maxillofacial bone tissue defects. The prospects of bone tissue engineering are very important to solve this problem; thus, clinicians have aimed to develop an ideal bone-inducing material that provides good clinical osteogenic effects. Pearl powder, a bone substitute material, has a certain research foundation both at home and abroad. Notably, bone substitute materials composed of nanopearl powder as the main constituent not only show good biocompatibility and biological activity but also have excellent osteoconductive and osteoinductive properties [1-3]. However, a single material is unable to easily meet all of the requirements for tissue engineering. Therefore, in recent years, an increasing number of studies have prepared composite artificial bones from multiple materials that complement each other and optimized their performance to meet the needs of bone tissue with good results. Chitosan (CS), a degradable organic substance, is procured from a wide range of natural sources. It has no immunogenicity, reduced irritation and good biocompatibility. Additionally, chitosan promotes wound healing and possesses inherent antibacterial activity [4,5]. Hyaluronic acid (HA) is also derived from natural sources. Its good biocompatibility and hydrophilicity promote cell adhesion, growth and differentiation. Moreover, its physical properties are similar to those of natural tissues. A skeleton prepared based on HA supports and stimulates the growth of new bone and then is gradually degraded and replaced by new bone tissue [6,7]. Studies have shown that C and HA composites formed into a three-dimensional hollow artificial bone material have good biocompatibility and osteogenic properties, are conducive to cell growth, have the ability to repair bone defects, and are expected to be used in bone tissue engineering [8,9]. However, composite artificial bone materials prepared by combining CS with HA have a limited ability to promote bone formation and induction. Thus, further research is needed to enhance their osteoinductive abilities by adding other substances. Bone morphogenetic protein (BMP) is currently known as an indispensable transformation factor during the process of fracture healing, and studies have shown that a nanopearl powder combined with BMP exerts synergistic effects throughout bone formation [10,11]. Therefore, we assumed that the nanopearl powder/C-HA/rhBMP-2 composite artificial bone would have beneficial osteogenic properties. In this study, we aimed to explore the preparation of a nanopearl powder artificial bone material and investigate its effect on osteogenic properties in vitro. Nanopearl powder, chitosan and HA were combined and loaded with rhBMP-2 under freeze-drying conditions to form a nanopearl powder artificial bone material that not only retained the advantages of the aforementioned materials but also overcame their shortcomings. Additionally, the osteogenic properties of the nanopearl powder artificial bone materials with and without rhBMP-2 and the properties of C-HA artificial bone were compared in vitro to determine the osteogenic advantages of the nanopearl powder/C-HA/rhBMP-2 composite artificial bone.

Materials and methods

Materials

Fresh water pearl powder (micrometer-sized) was purchased from Hainan Jingrun Ltd, China. MC3T3-E1 subclone 14 cells were purchased from the Cell Bank, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

Preparation of the nanopearl powder/C-HA/rhBMP-2 composite artificial bone

Using fresh water pearl powder as the raw material, the nanopearl powder was prepared using mechanical ball milling (KLLN-1, Keli, China). Chitosan (C; C105803) (4 wt%) and HA (H107141, Aladdin) (1 wt%) were weighed on an electronic balance, dissolved separately in 1% acetic acid solutions, placed in a Thinky blender and stirred at 2000 rpm for 5 minutes overnight at room temperature. After 24 hours, the two liquids were combined and stirred in a mixer at a speed of 2000 rpm for 5 minutes. The electronic balance was then used to weigh the nanopearl powder (10 wt%), which was added to the C-HA solution and stirred at 2000 rpm for 10 minutes. This well-stirred mixed liquid was transferred to a 96-well plate with a pipette, with an equal volume of liquid in each well. The plate was then transferred to a − 20°C freezer for 24 hours. After the solution had frozen, a vacuum was applied at −20°C under negative pressure. Next, the samples were dried in a freezer for 48 hours to prepare the nanopearl powder/C-HA artificial bone. Then, neutralized phosphate-buffered saline (PBS) was added dropwise to a tube containing the rhBMP-2 protein (Abcam, Cat#ab50099) at a concentration of 5.0 μg/ml. For each group, the prepared nanopearl powder/C-HA artificial bone was soaked in rhBMP-2 solution and placed on a shaker. A cylindrical shape was configured from each milliliter of protein solution, which was evenly soaked, removed from the solution and then freeze-dried again. After drying for 48 hours to prepare the nanopearl powder/C-HA/rhBMP-2 artificial bone, the final material was sterilized with 12 kGy of 60Co irradiation and stored at 4°C for subsequent use.

Scanning electron microscopy (SEM) analysis

The micromorphologies of the scaffolds were observed using a TESCAN scanning electron microscope (MIRA3, Czech Republic). Briefly, the scaffolds were prepared into thin slices with a thickness of approximately 3 mm, and the samples that were flat, smooth and free of contamination were pasted and fixed on the electron microscope observation sample preparation table in order, and critical point drying, gold spraying sample preparation and other operations were performed. The micromorphologies of the scaffolds were observed using a TESCAN scanning electron microscope (MIRA3, Czech Republic).

Determination of the porosity of the composite artificial bone

First, the mass (W1) of the pycnometer filled with absolute ethanol at a temperature of 25°C and a density of 0.789 g/cm3 was determined. The mass of the measured sample was defined as W0. The sample was immersed in absolute ethanol, and then the air in the vessel was evacuated under a vacuum. After the absolute ethanol had completely replaced the air in the sample, the pycnometer was filled with alcohol, and the mass was determined (W2). The sample was then removed, the mass (W3) of the pycnometer and the remaining absolute ethanol was measured, and the porosity of the material was calculated using the following formula [12]:

Examination of the mechanical properties of the composite artificial bone

The artificial bone materials to be tested were prepared as samples with a diameter of 8 mm and a height of 15 mm. Three samples from each material group were placed in an electronic apparatus. The compressive strength was measured in a universal testing machine at a loading speed of 2 mm/min. The average compressive strengths of artificial bone materials were compared [13].

Analysis of the crystallinity of the pearl powder in composite artificial bone

The following parameters were adjusted to examine the crystallinity of the pearl powder: operating current of 40 mA, voltage of 25 kV, Cu and K targets, a scan speed to 0.02/min and a scanning angle of 5°-90°. The processed sample was placed on the workbench for fixation and testing. After opening the analysis software, the data were imported, and the inorganic phase of the sample was compared with the standard aragonite, punctate aragonite and calcite cards.

Detection of the slow release of rhBMP-2 from the composite artificial bone

The composite artificial bone was placed in the orifice of a sterile culture plate to ensure that the quality of each piece was the same. A pipette was used to accurately measure 1 ml of sterile PBS for dropwise addition, followed by placing the plate in a constant temperature incubator at 37°C. After 1, 2, 4, 7, 14, 21, 28, and 35 days, liquid samples were randomly removed from the 3 wells in a particular order and frozen at −80°C for storage and further use. After 35 days, all of the sample solutions were collected, and the concentration of rhBMP-2 in each stored sample was measured with an enzyme-linked immunoassay [13]

In vitro cell-based experiment

Coculture of the composite artificial bone with cells

This study used mouse MC3T3-E1 cells for coculture with sterilized composite artificial bone materials (C-HA composite artificial bone (S1), nanopearl powder/C-HA composite artificial bone (S2), and nanopearl powder/C-HA/rhBMP-2 composite artificial bone (S3)). Each sample was transferred to a new 24-well plate, and 1 ml of culture medium was added to fully soak each sample. The plate was then placed in a culture plate in an incubator at 37°C with 5% CO2 for 12 hours. Then, the adherent MC3T3-E1 cells were removed from the plate. Following digestion and centrifugation, the supernatant was discarded using the passage method, and the cells were resuspended in fresh medium. After the cells were counted, they were adjusted to a density of 5 × 105 cells/ml and inoculated with 0.1 ml of the appropriate composite artificial bone. After culturing in an incubator at 37°C with 5% CO2 for 4 hours, 1 ml of medium was added to each well for continued culture.

Observation of cell adhesion to the composite artificial bone materials

After cocultivation for 3 days, the artificial bone materials were removed and transferred to a new 24-well plate. A 2.5% glutaraldehyde solution was used for fixation overnight at 4°C. Then, a gradient of ethanol solutions (30%, 50%, 70%, 80%, 90%, 95% and 100%) was used to dehydrate the artificial bone. Samples were incubated with each concentration twice for 15 minutes each. Finally, the artificial bone was washed with a 25%, 50%, and 100% gradient of tert-butanol solutions, and the artificial bone was placed into a freeze dryer for 4 hours to dry. After removal, the bone samples were cut into 3 mm wide slices with a flat surface, fixed on conductive glue, sprayed with gold for 60 seconds, fixed, and placed under a vacuum SEM for analysis (MIRA3, Czech Republic). The adhesion of the cells on the composite artificial bone materials was observed.

Detection of cell proliferation on the composite artificial bone materials

On the 1st, 3rd, 5th, and 7th days of culture, 3 samples (wells) from each artificial bone group were selected and 100 μl of CCK-8 solution were added. The culture plate was placed in an incubator at 37°C with 5% CO2 for incubation with medium for 3.5 hours. When the color change became obvious, 100 μl of reaction liquid were removed from each well with a pipette, and the liquid was transferred to a 96-well plate. The plate was placed in a microplate reader, and the absorbance value was measured at 450 nm [14].

The effects of composite artificial bone on the activity of cellular alkaline phosphatase (ALP)

On the first day, 3 days, 5 days, and 7 days of culture, the culture solution was aspirated and discarded, and the cells were washed twice with PBS. After adding 0.25% trypsin for digestion, the cells were centrifuged, and the supernatant was again discarded. Next, 400 μl of 1% Triton-100 solution in culture media were added to each group, and the cells were lysed at room temperature for 30 minutes. The mixture was transferred to a new, sterile 1.5 ml Eppendorf (EP) tube, which was placed on ice, sonicated for 5 seconds, and transferred to a low-temperature high-speed centrifuge for centrifugation at 12000 rpm for 30 minutes at 4°C. The supernatant was then removed using a pipette and transferred to a new sterile EP tube. The supernatant was stored on ice, and the ALP activity of each group of composite artificial bone materials was determined according to the instructions of the ALP test kit [15].

RT–qPCR analysis

After seven days, cells on the scaffolds were collected for RT–qPCR analysis [16]. The expression levels of the collagen type I (ColαI), osteocalcin (OCN), osteopontin (OPN) and runt-related transcription factor 2 (Runx2) genes were measured. The primers are listed in Table 1.
Table 1.

RT–qPCR target gene primer sequences.

Gene namePrimer sequence (5’ – 3’)
ColαIForward, CTGGACGCCATCAAGGTCTACTReverse, CAGTGATAGGTGATGTTCTGGGAG
Runx2Forward, CGCCTCACAAACAACCACAGReverse, TCACTGTGCTGAAGAGGCTG
OCNForward, TGCTTGTGACGAGCTATCAGReverse, GAGGACAGGGAGGATCAAGT
OPNForward, CTGGATGAACCAAGTCTGGAAACReverse, TGTCCTTGTGGCTGTGAAACTT
RT–qPCR target gene primer sequences.

Statistical analysis

All statistical analyses were performed with SPSS 19.0 software, and the results are presented as the means ± standard deviations ( ± SD). The one-sample K-S nonparametric test was used to verify the normality of the data, and the Levene method was used to confirm data homogeneity. One-way analysis of variance was adopted as the statistical method to compare whether the differences in the data from each group were statistically significant. For pairwise comparisons, if the variances were the same, the Tukey-HSD test was used, and if the variances were not uniform, the Welch test was used. The test level was set to α = 0.05, and a result of P < 0.05 was considered statistically significant.

Results

Here, a nanopearl powder was prepared using the mechanical ball milling method, and the sizes of the powder particles were on the nanometer level, which not only retained the advantages of the aforementioned materials but also overcame their shortcomings. Additionally, the in vitro osteogenic properties of the nanopearl powder artificial bone materials with and without rhBMP-2 and the properties of C-HA artificial bone were assessed.

Transmission electron microscopy (TEM) observations of the pearl powder after grinding

As shown in Figure 1, the TEM observations showed that the shape of the ground pearl powder was round or elliptical, the particle sizes were different, and agglomeration occurred. Notably, most of the particles were approximately 50–60 nm and generally less than 100 nm.
Figure 1.

TEM observations of the pearl powder after grinding.

TEM observations of the pearl powder after grinding.

Observations of the morphology, pore size, porosity and compressive strength of the composite artificial bone

Figure 2(a) shows the morphology of the composite artificial bone viewed with the naked eye. The artificial bone prepared in this experiment was a milky white solid with pores on its outer surface. Figure 2(b) shows an SEM image of a cross-section of the nanopearl powder/C-HA/rhBMP-2 composite artificial bone. The pores inside the material represent the cavities that were left after the sublimation of the ice crystals following freeze-drying. The holes exhibited a disorderly distribution with diverse shapes. According to the Image-Pro Plus 6.0 analysis, the pore sizes were approximately 188.53 ± 15.32 μm, and smaller pores with sizes of 30–550 μm were observed between the larger pores, showing mutual communication. The porosity of the material measured using pycnometry was 86.43 ± 2.78%, and the compressive strength of the composite artificial bone was 0.342 ± 0.024, displaying a certain degree of mechanical strength.
Figure 2.

Morphology of the composite artificial bone. A. Image of the nanopearl powder/C-HA/rhBMP-2 artificial bone as viewed with the naked eye. B. SEM image of a cross-section of the nanopearl powder/C-HA/rhBMP-2 composite artificial bone at 100X magnification.

Morphology of the composite artificial bone. A. Image of the nanopearl powder/C-HA/rhBMP-2 artificial bone as viewed with the naked eye. B. SEM image of a cross-section of the nanopearl powder/C-HA/rhBMP-2 composite artificial bone at 100X magnification.

Crystal form of the nanopearl powder in the composite artificial bone

Figure 3 shows the phase diagram of the nanopearl powder in the nanopearl powder/C-HA/rhBMP-2 composite artificial bone as measured using X-ray diffraction (XRD). The crystal peaks were mainly distributed between 25°-55°. After comparison with the aragonite and calcite cards, the crystal form of the nanopearl powder in the artificial bone was mainly aragonite calcium carbonate, with only a small amount of calcite.
Figure 3.

XRD (X-ray diffraction) spectrum of the nanopearl powder/C-HA/rhBMP-2 composite artificial bone.

XRD (X-ray diffraction) spectrum of the nanopearl powder/C-HA/rhBMP-2 composite artificial bone.

In vitro sustained release of rhBMP-2 from the nanopearl powder/C-HA/rhBMP-2 composite artificial bone

Figure 4 displays the curve of the sustained release of rhBMP-2 from the nanopearl powder/C-HA/rhBMP-2 composite artificial bone. When the nanopearl powder/C-HA/rhBMP-2 composite artificial bone was soaked in PBS, the content of rhBMP-2 in the buffer solution increased rapidly for the first 7 days. The release rate slowed gradually and exhibited continuous release that lasted for more than 35 days.
Figure 4.

Curve showing the sustained release of rhBMP-2 from the nanopearl powder/C-HA/rhBMP-2 composite artificial bone.

Curve showing the sustained release of rhBMP-2 from the nanopearl powder/C-HA/rhBMP-2 composite artificial bone.

Adhesion and growth of MC3T3-E1 cells on the surface of the composite artificial bone material

Mouse MC3T3-E1 cells were cocultured with the nanopearl powder/C-HA/rhBMP-2 composite artificial bone, and the morphology of the cells in the three-dimensional artificial bone was observed using SEM. The results are shown in Figure 5. In the composite artificial bone group, the cell surface morphology was more regular, with protruding pseudopods attached to the artificial bone surface.
Figure 5.

Adhesion and growth of MC3T3-E1 cells on the surface of the artificial bone. Mouse MC3T3-E1 cells were cocultured with the nanopearl powder/C-HA/rhBMP-2 composite artificial bone, and the morphology of the cells in the three-dimensional artificial bone was observed using SEM.

Adhesion and growth of MC3T3-E1 cells on the surface of the artificial bone. Mouse MC3T3-E1 cells were cocultured with the nanopearl powder/C-HA/rhBMP-2 composite artificial bone, and the morphology of the cells in the three-dimensional artificial bone was observed using SEM.

The effects of the composite artificial bone on cell proliferation

A CCK-8 assay was performed to determine the proliferation of MC3T3-E1 cells in each artificial bone group on Days 1, 3, 5 and 7. As shown in Figure 6, no significant difference was observed in the number of cells growing on each of the artificial bone materials after 1 day. As cell proliferation increased, the difference between the S3 group and the S1 and S2 groups was statistically significant, while the difference between the S1 and the S2 groups was not. Proliferation after 5 and 7 days was similar to that at 3 days. The S3 group displayed the best performance, and cell proliferation was significantly different from those in the other two groups.
Figure 6.

CCK-8 assays of cell proliferation. MC3T3-E1 cells were cocultured with sterilized composite artificial bone materials (C-HA composite artificial bone (S1), nanopearl powder/C-HA composite artificial bone (S2), and nanopearl powder/C-HA/rhBMP-2 composite artificial bone (S3)).

CCK-8 assays of cell proliferation. MC3T3-E1 cells were cocultured with sterilized composite artificial bone materials (C-HA composite artificial bone (S1), nanopearl powder/C-HA composite artificial bone (S2), and nanopearl powder/C-HA/rhBMP-2 composite artificial bone (S3)).

Effects of the composite artificial bone on cellular ALP activity

The effects of the three types of composite artificial bone materials on the ALP activity in MC3T3-E1 cells are shown in Figure 7. No significant difference in ALP activity was observed between the three composite artificial bone materials after 1 day. After 3 days, the ALP activity in each group increased. The differences between the S3 group and the S1 and S2 groups were statistically significant, while the difference between the S1 group and the S2 group was not. The results obtained after 5 and 7 days were similar to those after 3 days. The S3 group displayed the best performance, and the differences were statistically significant compared with the other two groups.
Figure 7.

ALP activity in MC3T3-E1 cells from each group increased (* indicates P < 0.05) after growth on C-HA composite artificial bone (S1), nanopearl powder/C-HA composite artificial bone (S2), and nanopearl powder/C-HA/rhBMP-2 composite artificial bone (S3).

ALP activity in MC3T3-E1 cells from each group increased (* indicates P < 0.05) after growth on C-HA composite artificial bone (S1), nanopearl powder/C-HA composite artificial bone (S2), and nanopearl powder/C-HA/rhBMP-2 composite artificial bone (S3).

Expression of the ColαI, OCN, OPN and Runx2 genes in cells cocultured with composite artificial bone materials

On the 7th day of cell culture (Figure 8), the expression of the ColαI, OCN, OPN and Runx2 genes in the S3 composite artificial bone groups was significantly different from that in the S1 and S2 groups.
Figure 8.

Expression of the ColαI, OCN, OPN and Runx2 genes (* indicates P < 0.05). MC3T3-E1 cells were cocultured with sterilized composite artificial bone materials (C-HA composite artificial bone (S1), nanopearl powder/C-HA composite artificial bone (S2), and nanopearl powder/C-HA/rhBMP-2 composite artificial bone (S3)). A. RT–qPCR analysis of the expression of the ColαI, OCN, OPN and Runx2 mRNAs. B. Western blot analysis of the expression of the ColαI, OCN, OPN and Runx2 proteins.

Expression of the ColαI, OCN, OPN and Runx2 genes (* indicates P < 0.05). MC3T3-E1 cells were cocultured with sterilized composite artificial bone materials (C-HA composite artificial bone (S1), nanopearl powder/C-HA composite artificial bone (S2), and nanopearl powder/C-HA/rhBMP-2 composite artificial bone (S3)). A. RT–qPCR analysis of the expression of the ColαI, OCN, OPN and Runx2 mRNAs. B. Western blot analysis of the expression of the ColαI, OCN, OPN and Runx2 proteins.

Discussion

The treatment of bone defects has always been a clinical problem. Autologous bone grafting of bone defects is the gold standard treatment, but its sources are limited. Allogeneic and xenogeneic bone grafts may lead to rejection reactions [17]. The commonly used bone filling materials in the clinic, such as bone and hydroxyapatite, have good biological compatibility and biological activity, form biological and natural bone bonds, and have high strength and wear resistance, corrosion resistance, chemical stability, etc., but exhibit low flexural strength, high brittleness, and low fatigue resistance in physiological environment and damage strength [18]. However, because it is a single material, it has low flexural strength, high brittleness, and low fatigue resistance and failure strength in a physiological environment [19]. With the improvement in material requirements for bone defect repair, when each material is used alone, it has poor mechanical strength and limited osteogenic ability [20], and thus it does not readily meet the requirements for bone defect repair. With the increasing requirements for bone defect repair materials, the use of each material alone to meet the requirements for bone defect repair is difficult. In recent years, the rapid development of bone tissue engineering has provided a new method to treat bone defects. Composite biomaterial artificial bone composed of different materials not only has the performance of component artificial bone, improves the osteogenic effect and mechanical properties of artificial bone, and compensates for the deficiency of mechanical strength of a single material but also possesses new properties that a single component material does not have [21]. The nanopearl powder used in this experiment was ground from micron-sized pearl powder using mechanical ball milling with absolute ethanol as the medium, and its organic matrix and amino acid contents did not change significantly compared with the micron-sized pearl powder [22,23]. This research group found that during the early stage of in vitro osteoblast culture, pearl powder biocompatibility was excellent, and the organic matrix component promoted bone formation. Moreover, the osteogenic effects of the nanosized pearl powder were more apparent than those of the micron-sized pearl powder [24]. Since the finished nanosized pearl powder is a powder, its operability and shaping ability are not good if it is used in the clinic, which is also one of the problems that must be overcome for the clinical use of bone substitute materials. Therefore, the osteogenic ability of the bone substitute material should be ensured. At the same time, it also has the advantage of being easy to shape, which is more convenient for clinicians to operate. Studies have shown that pearl powder and rhBMP-2 act synergistically to promote bone formation. The inclusion of SMAD4 in the pearl powder aqueous solution regulates the conversion of BMP signaling pathways and increases the rate of BMP utilization. This study prepared a pearl powder encapsulating rhBMP-2 to generate a composite material [25]. A proper pore size of composite artificial bone materials is necessary for cell growth. A pore size greater than 500 μm is not conducive to cell adhesion and does not supply sufficient mechanical strength to the artificial bone, which affects the formation of bone tissue. However, a pore size of less than 100 μm also affects bone tissue growth [26]. In this experiment, the nanopearl powder/C-HA/rhBMP-2 composite artificial bone prepared using the freeze-drying method is a three-dimensional porous artificial bone material with pore sizes of approximately 188.53 ± 15.32 μm, which are conducive to the entry of nutrients, the discharge of metabolites and the growth of cells. An ideal porosity benefits the tissue by ensuring a proper supply of nutrients and excretion of metabolites, promoting the migration of cells into the surrounding tissues and allowing the formation of blood vessels and nerves. Studies have shown that artificial bone materials with less than 75% porosity have difficulty meeting the normal growth requirements of most cells, and porosities greater than 90% may cause continuous cell membrane formation to fail [27,28]. The porosity of the nanopearl powder/C-HA/rhBMP-2 composite artificial bone material prepared in this study was determined to have an appropriate value of 86.43 ± 2.78%, which meets the normal growth requirements of most cells. The compressive strength of the nanopearl powder/C-HA/rhBMP-2 composite artificial bone material was 0.342 ± 0.024 MPa, which will allow the artificial bone material to maintain the proper shape and support in the body. Many studies have shown that the use of tissue engineering methods to prepare a scaffold capable of loading rhBMP-2 for sustained release allows rhBMP-2 to remain locally in the bone defect site for a long time and induce bone regeneration through the scaffold matrix [29,30]. The amount of rhBMP-2 retained at the defect enhances the osteoinductive effects of rhBMP-2. Moreover, the use of an appropriate scaffold material that promotes the controlled release of rhBMP-2 significantly reduces the amount of rhBMP-2 required and reduces the production cost [31]. In this study, the nanopearl powder/C-HA/rhBMP-2 composite artificial bone slowly released rhBMP-2 over a long period for continued osteoinduction, which meets the requirements of tissue engineering. rhBMP-2 liberation from the composite artificial bone material showed a sudden release behavior over the first 7 days, potentially because the rhBMP-2 present at the periphery of the material is more easily discharged. However, the release of rhBMP-2 from the material gradually slowed after 7 days and was continuously released until day 35, indicating that the composite artificial bone material prepared in this experiment promotes bone formation over a long period and increases the bioavailability of rhBMP-2. The composite artificial bone material prepared in this study allowed osteoblasts to attach and adhere to its surface, which are the primary conditions required for osteoblast proliferation, differentiation, and mineralization; this phenomenon also promotes the regeneration of new bone. Therefore, artificial bone materials must have a surface environment that enables osteoblast adhesion to their surface to allow the cells to migrate into the composite artificial bone and may also reflect the cellular compatibility of the composite material. The nanopearl powder/C-HA/rhBMP-2 composite artificial bone material prepared in this study was cocultured with MC3T3-E1 cells, and SEM observations showed that the cells adhered to the composite artificial bone surface. Therefore, this artificial bone material provided a surface environment that enabled MC3T3-E1 cells to adhere to its surface and grow, indicating that this artificial bone material has good cellular compatibility. Maintaining bone mass depends on the dynamic balance between bone formation and resorption, and disruptions in this balance will cause bone metabolic diseases [32]. Osteoblasts are derived from mesenchymal precursor cells, which are the material basis for osteogenesis and bone formation. Osteoblasts synthesize and secrete more than 20 types of collagenous and noncollagenous proteins, as well as certain local regulators of bone metabolism; they also generate osteoids during bone remodeling. In addition, while promoting the mineralization of osteoids, the newly formed bone repairs the lacuna formed by osteoclast bone resorption and secretes cytokines to regulate osteoclast differentiation [33,34]; thus, the continuous renewal of bone tissue is one of the most important functions of these cells. Since osteoblasts determine bone formation and maintain the balance between osteoblasts and osteoclasts, a decrease in the osteogenic functions of osteoblasts results in a decrease in new bone formation and a weakened ability to repair bone resorption lacunae [35]. These changes result in the thinning of bone trabeculae, weakness, perforation, and porous changes in the bone cortex. Therefore, studying the effects of artificial bone on the proliferation and differentiation of osteoblasts is very important to determine the efficacy of artificial bone materials and explore their mechanism of action. This study investigated the effects of artificial bone on the proliferation and differentiation of MC3T3-E1 cells by examining cell proliferation, ALP activity and bone-related gene expression. In this study, with increasing time, the proliferation and differentiation of MC3T3-E1 cells growing on all of the scaffolds increased significantly, while the nanopearl powder/C-HA/rhBMP-2 composite artificial bone material produced the greatest proliferation and differentiation, especially on days 3, 5 and 7. Compared with the other two groups, the differences in proliferation and differentiation were statistically significant, indicating that the nanopearl powder/C-HA/rhBMP-2 composite artificial bone prepared in this study significantly promoted the proliferation, differentiation and maturation of MC3T3-E1 cells. A significant difference was also observed between the nanopearl powder/C-HA/rhBMP-2 group and the control group. Based on this result, the new artificial bone material has good cellular compatibility and promotes cell proliferation and differentiation. In vivo, osteoblast development is divided into three stages, the first of which is the differentiation of preosteoblasts (involving Runx2 with participation from osterix). The final two stages in the development of osteoblasts are the formation of the bone matrix (involving ALP, ColαI, OPN, OCN and bone sialoprotein (BSP)) and bone mineralization of the substrate. In mature osteoblasts, the expression of bone-related genes plays a key role in the formation of the bone matrix and bone matrix calcification [36]. Among osteoblast-related genes, Runx2 induces and promotes the expression of osteoblast matrix protein, which is a marker of early osteoblast differentiation [37] and initiates the differentiation of undifferentiated mesenchymal cells or other types of cells into osteoblasts. ColαI, OPN and OCN are specialized bone matrix proteins that are specifically synthesized and secreted by osteoblasts and used to evaluate the functional activity of osteoblasts. As the most important fibrous collagen component in the bone matrix, ColαI provides a scaffold for the deposition of calcium salts and the attachment of cells. Its synthesis begins during cell proliferation and specifically reflects bone formation [38]. OPN participates in bone formation and reconstruction by regulating the balance between osteoblasts and osteoclasts. Additionally, OPN, another osteoblast marker, plays an important role in the mineralization and absorption of bone matrix [39]. The presence of OCN reflects osteoblast maturation and not only objectively indicates the osteogenic function of osteoblasts but also reveals the state of bone formation and turnover. OCN is the most abundant noncollagenous protein in bone tissue that maintains the normal calcification rate of bone and inhibits the formation of the abnormal hydroxyapatite crystals during bone formation [40]. In the present study, the expression levels of ColαI, OPN, OCN and Runx2 were significantly higher in the nanopearl powder/C-HA/rhBMP-2 composite artificial bone group after 7 days of coculture than those in the other two groups. This result is consistent with the results from the proliferation and differentiation experiments, indicating that the nanopearl powder/C-HA/rhBMP-2 composite artificial bone exerts better osteogenic effects than the other two types of artificial bone due to the upregulation of the examined osteogenesis-related genes that regulate cell proliferation and differentiation.

Limitations

However, this study lacks an analysis of current bone materials commonly used in the clinic (Bio-Oss, etc.) and the corresponding comparative research and observations. The ability to achieve clinically usable osteogenic effects from this new material is still limited. However, the pearl powder artificial bone material may solve the problems of an inconvenient clinical operation caused by limited sources of clinical bone substitute materials, high cost, and shaping difficulties. Its research prospects and application value are relatively broad. The human body is a complex environment, and bone metabolism is affected by a variety of hormones and factors. Therefore, the effects of artificial bone on bone formation may not only be mediated by direct actions on osteoblasts but also through the regulation of the macroscopic network in the body. Accordingly, the mechanism of action of this artificial bone material requires further exploration in vivo.

Conclusions

Here, the artificial bone composite prepared with the nanopearl powder, chitosan, HA and/rhBMP-2 is a suitable artificial bone material. This material has a good pore size, porosity and penetration between the pores. It also possesses certain mechanical properties that meet the tissue engineering performance requirements for artificial bone materials and continuously and sustainably releases rhBMP-2 to repair bone defects. Moreover, the nanopearl powder/C-HA/rhBMP-2 composite artificial bone promotes cell adhesion, growth, proliferation and differentiation and has good biocompatibility, suggesting that it represents a good bone material to promote bone formation and can be used in bone defect repair research applications.
  34 in total

1.  Preparation and Characterization of a Chitosan/Gelatin/Extracellular Matrix Scaffold and Its Application in Tissue Engineering.

Authors:  Xiaoyan Wang; Tailong Yu; Guanghua Chen; Jilong Zou; Jianzhong Li; Jinglong Yan
Journal:  Tissue Eng Part C Methods       Date:  2017-02-22       Impact factor: 3.056

2.  Three dimensional printed bioglass/gelatin/alginate composite scaffolds with promoted mechanical strength, biomineralization, cell responses and osteogenesis.

Authors:  Qing Ye; Ying Zhang; Kun Dai; Xiaofeng Chen; Hannah Mae Read; Lei Zeng; Fei Hang
Journal:  J Mater Sci Mater Med       Date:  2020-08-20       Impact factor: 3.896

3.  Dually optimized polycaprolactone/collagen I microfiber scaffolds with stem cell capture and differentiation-inducing abilities promote bone regeneration.

Authors:  Hui Chi; Anlong Jiang; Xiaoyan Wang; Guanghua Chen; Chengchao Song; Ravi Kumar Prajapati; Ang Li; Zecheng Li; Jiaxin Li; Zhengye Zhang; Ye Ji; Jinglong Yan
Journal:  J Mater Chem B       Date:  2019-10-23       Impact factor: 6.331

4.  Effect of pore size and void fraction on cellular adhesion, proliferation, and matrix deposition.

Authors:  J Zeltinger; J K Sherwood; D A Graham; R Müeller; L G Griffith
Journal:  Tissue Eng       Date:  2001-10

5.  The use of chitosan/PLA nano-fibers by emulsion eletrospinning for periodontal tissue engineering.

Authors:  Renze Shen; Weihong Xu; Yanxiang Xue; Luyuan Chen; Haicheng Ye; Enyi Zhong; Zhanchao Ye; Jie Gao; Yurong Yan
Journal:  Artif Cells Nanomed Biotechnol       Date:  2018-04-16       Impact factor: 5.678

6.  [Effects of soluble matrix of nacre on bone morphogenetic protein-2 and Cbfa1 gene expressions in rabbit marrow mesenchymal stem cells].

Authors:  Jian-jun Wang; Jian-ting Chen; Chun-lu Yang
Journal:  Nan Fang Yi Ke Da Xue Xue Bao       Date:  2007-12

7.  Engineered three-dimensional scaffolds for enhanced bone regeneration in osteonecrosis.

Authors:  Tongtong Zhu; Yutao Cui; Mingran Zhang; Duoyi Zhao; Guangyao Liu; Jianxun Ding
Journal:  Bioact Mater       Date:  2020-04-17

8.  PfSMAD4 plays a role in biomineralization and can transduce bone morphogenetic protein-2 signals in the pearl oyster Pinctada fucata.

Authors:  Mi Zhao; Yu Shi; Maoxian He; Xiande Huang; Qi Wang
Journal:  BMC Dev Biol       Date:  2016-04-26       Impact factor: 1.978

9.  Influence of different incision designs on bone increment of guided bone regeneration (Bio-Gide collagen membrane +Bio-OSS bone powder) during the same period of maxillary anterior tooth implantation.

Authors:  Genying Zhuang; Jianshui Mao; Guoli Yang; Huiming Wang
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

10.  Enamel matrix derivative (EMD) enhances the osteogenic differentiation of bone marrow mesenchymal stem cells (BMSCs).

Authors:  Lu Cheng; Ying Li; Qian Xia; MaoHua Meng; ZhaoYang Ye; ZhengLong Tang; HongChao Feng; Xin Chen; HeLin Chen; Xiao Zeng; Yi Luo; Qiang Dong
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.