Literature DB >> 35758024

MicroRNA miR-331-3p suppresses osteosarcoma progression via the Bcl-2/Bax and Wnt/β-Catenin signaling pathways and the epithelial-mesenchymal transition by targeting N-acetylglucosaminyltransferase I (MGAT1).

Wen Bi1, Mengyue Yang2, Pengfei Xing1, Tao Huang1.   

Abstract

Osteosarcoma (OS) is a high-grade malignant disease that is a prevalent primary malignant sarcoma of the bone. The purpose of this investigation was to therefore elucidate the association between miR-331-3p and OS development and to identify a potential underlying mechanism. Key genes involved in OS were selected using GSE65071 dataset from the Gene Expression Omnibus (GEO) database and Gene Expression Profiling Interactive Analysis (GEPIA). Reverse transcription quantitative polymerase chain reaction (RT-qPCR) and Western blotting were conducted to detect miR-331-3p, MGAT1, the epithelial-mesenchymal transition (EMT), Bcl-2/Bax and Wnt/β-Catenin signaling pathways related proteins. Dual-luciferase reporter assay and TargetScan were used for validating interaction between MGAT1 mRNA and miR-331-3p. Biological effects of miR-331-3p and MGAT1 on OS cells were detected employing MTT, Transwell, wound healing and flow cytometry, respectively. MiR-331-3p was under-expressed in OS, and up-regulation or inhibition of its expression could significantly inhibit or promote the malignant phenotypes of OS cells. Furthermore, we found that MGAT1, a target of miR-331-3p, had elevated expression in OS. Interestingly, MGAT1 could partially alleviate the effect of miR-331-3p in vitro. Collectively, miR-331-3p acts as an critical tumor suppressor through inhibiting MGAT1, results in suppressed Wnt/β-Catenin pathway and decreased proliferation of OS cells; leads to increased apoptosis via Bcl-2/Bax pathway and inhibited migration and invasion ability via the EMT.

Entities:  

Keywords:  MGAT1; Osteosarcoma; Wnt/β-Catenin; epithelial-mesenchymal transition; miR-331-3p

Mesh:

Substances:

Year:  2022        PMID: 35758024      PMCID: PMC9342255          DOI: 10.1080/21655979.2022.2083855

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   6.832


Highlights

MiR-331-3p was lowly expressed both in OS tissues and cell lines. Overexpressed miR-331-3p suppressed the malignant phenotypes of OS cells and induced apoptosis. MGAT1 was up-regulated in OS tissues and cell lines, and MGAT1 downregulation could partially reverse the malignant phenotypes of OS cells induced by miR-331-3p in vitro. MiR-331-3p targets MGAT1 to inhibit OS cells progression, via Wnt/β- Catenin pathway to inhibit proliferation, via Bcl-2/Bax signaling pathway to induce apoptosis, via EMT to inhibit migration and invasion.

Introduction

Osteosarcoma (OS) is a common type of primary malignant bone sarcoma that most frequently affects children, adolescents and young adults. It is a very rare cancer, the incidence peaks in adolescence is approximately 4.4 cases per million globally [1]. In USA, although OS only accounts for 2% of childhood cancers cases, it has the lowest 5-year survival rate compared to the other most common cancers [1,2]. At present, the three main therapeutic approaches for patients with OS include: i) Surgical resection of all tumor sites; ii) radiation therapy; and iii) multi-agent combined chemotherapy [3]. However, despite significant research into OS therapeutics, there are few clinically effective treatments, with the exception of methotrexate, doxorubicin and cisplatin chemotherapy. Furthermore, OS survival rates have remained unchanged since the 1980s [1]. Since the introduction of systemic chemotherapy, the 5-year survival rate of patients with localized OS has plateaued at ~60-70%. However, in patients with metastatic OS the 5-year survival rate is ~20%. In recent years, there have been different strategies for preclinical treatment of solid tumors including cervical cancer, among which molecular targeted therapy is considered as an effective approach [4]. Therefore, to inhibit OS progression and increase the survival rate, finding new molecular therapeutical target may bring new ideas for OS. MicroRNAs (miRNAs/miRs) are 18–25 nucleotides long, endogenic non-coding RNAs, which can regulate at the post-transcriptional level via binding to 3’-untranslated regions (UTRs) of key genes involved in various types of biological processes like environmental stress response, self-renewal and tumor progression [5,6]. Several miRNAs, including miR-200a, miR-29b, miR-328-3p, have been shown to regulate OS progression and radiosensitivity in earlier research [7-9]. miRNAs play a crucial role in ferroptosis of OS. Overexpressed miR-1287-5p could induce OS cells ferroptosis via targeting GPX4 [10]. Our previous work illustrated that miR-106a was upregulated in OS tissues and cells, reduction of its expression could inhibit OS cells progression and induce apoptosis by upregulating VNN2 [11]. MiR-331-3p is a particular miRNA that participates in the genesis of malignancies. In some tumors, it acts as an oncogene such as pancreatic cancer [12,13], while it acts as a suppressor gene in other tumors like ovarian cancer, lung cancer and nasopharyngeal carcinoma [14-16]. However, its role in OS remains unclear. An abnormal N-glycosylation structure is usually observed in malignant cancer cells [17]. N-acetylglucosaminyltransferase-I (MGAT1) is a critical enzyme for the initial synthesis of complex N-glycans and also serves an essential role in branch formation [18]. MGAT1 has also been linked to tumor progression in a number of studies. MGAT1 knockdown suppresses human prostate and HeLa cervical cancer cell migration and invasion and significantly inhibits primary tumorigenesis and the occurrence of lung metastasis in vivo [19]. MGAT1 therefore has a pivotal role in cancer oncogenesis and development. MGAT1 accelerates the hepatocellular carcinoma cell proliferation and invasion process, and MGAT1 overexpression promotes tumor growth in vivo [20]. Furthermore, via activating glucose transporter 1, MGAT1 promotes the glioma cells malignant ability [21]. Although MGAT1 has been linked to oncogenesis, its essential role in human OS progression and how it is regulated by miRNAs remains to be elucidated. In this essay, bioinformatics analysis suggested that MGAT1 might be an underlying target of miR-331-3p. We speculated that the miR-331-3p/MGAT axis is involved in OS malignancy. Next, experiments were conducted to verify this hypothesis. In contrast to recent publications on miRNAs and target genes in OS, this paper explored the potential signaling pathway mechanism of miR-331-3p/MGAT1 in OS malignancy and provided a reasonable explanation for the experimental phenomenon [22,23].

Materials and methods

Clinical specimens & bioinformatic analysis

The GSE65071 dataset (20 OS and 15 healthy controls) from the GEO database (https://www.ncbi.nlm.nih.gov/geo/) was used to acquire miR-331-3p expression data. R software (version 4.1.2; Bird Hippie) was used to perform statistical analysis. MGAT1 expression data was collected using GEPIA (http://gepia.cancer-pku.cn). MicroRNA target genes were forecasted using TargetScan (version 8.0; http://www.targetscan.org/vert_80/) [24].

Cell culture

Cell information involved in this study was described in the previous literature [11]. All cells were authenticated using short tandem repeat (STR) analysis. U2OS, Saos-2, MG63 and 293 T cells were cultured in DMEM with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin solution. The hFOB1.19 cell was grown in DMEM/F12 with 10% FBS and 1% penicillin/streptomycin solution. Monthly mycoplasma tests to ensure cells purity [25]. All cultures were grown in a humidified environment, in 95% air and 5% CO2 at 37 °C.

Cell transfection

MGAT1 small interfering RNA (siRNA), miR-331-3p mimic, inhibitor, and their corresponding control groups were constructed and bought from Shanghai GeneChem Co., Ltd. The following sequences were used: miR-331-3p mimic sense, 5’-GCCCCUGGGCCUAUCCUAGAA-3’ and antisense, 5’-CUAGGAUAGGCCCAGGGGCUU-3’; control mimic sense, 5’-UUCUCCGAACGUGUCACGUTT-3’ and antisense, 5’-ACGUGACACGUUCGGAGAATT-3’; miR-331-3p inhibitor, 5’-UUCUAGGAUAGGCCCAGGGGC-3’; control inhibitor, 5’-CAGUACUUUUGUGUAGUACAA-3’; MGAT1 siRNA, 5’-GCACCTCAAGTTTATCAAGCT-3’; control siRNA red fluorescent protein, 5’- CTACAAGACCGACATCAAGCT-3’ and LacZ, 5’-CCGTCATAGCGATAACGAGTT-3’. Transfection was performed as previously described [11]. Each experimental group of cells was collected for further experiments 72 h following transfection.

Transwell assay

Transwell chambers (8-μm pore filter) were conducted to investigate OS cells metastasis ability. 72 h after transfection, approximately 5 × 104 cells resuspended in 200 μl DMEM without serum were added to the top chamber, and the bottom chamber contained 500 μl of culture medium with 20% FBS. The top chamber of the invasion experiment was pre-coated with 50 μl Matrigel (5 mg/ml; Corning, Inc.). Following that, cells were incubated at 37°C with 5% CO2. 36 h later, chambers were infiltrated with 4% paraformaldehyde for 15 min at 25 °C, followed by 20 min of staining with 0.5% hematoxylin at 25 °C. The stained cells on the polycarbonate membrane surface were photographed after scraping out the top chamber cells [26]. Three random fields were used for imaging. The number of cells in each image was counted for statistical analysis. These steps were repeated in triplicate.

Wound healing assay

Following transfection, U2OS (5x104) was cultivated into each well of six-well plates until 90% confluency. Linear scratches were created by a 200 µl sterilized pipette tip, and using PBS to wash away the detached cells. The wound was imaged using a microscope (Leica Microsystems GmbH) at the indicated time [27]. Ultimately, we used Image J software (version 1.8.0) to calculate the relative proportion of scratched areas. These steps were replicated in triplicate.

MTT assay

Following transfection, OS cells were digested and counted. Cells were seeded at a density of 2 × 103 cells per well into a 96-well plate, with three parallel wells per group. After the cells had been cultured for 1, 2, 3 or 4 days, each well added 10 μl MTT solution, and incubated at 37°C for 4 h. Each well was then filled with 100 μl of formazan solution and incubated for 4 hours at 37 °C until all formazan had been dissolved. Eventually, the absorbance was then quantified by spectrophotometry (570 nm) [28].

Western blotting (WB)

For extraction of cellular protein, RIPA lysis buffer and a protease inhibitor cocktail were utilized [29]. Then the proteins were quantified using a BCA kit. After that, the proteins were separated using SDS-PAGE on a 12% gel (Beyotime Institute of Biotechnology). Separated proteins were blotted on PVDF membranes. Then incubated overnight at 4°C with primary antibodies after being sealed for 15 minutes with Quick BlockTM Blocking Buffer (Beyotime Institution of Biotechnology). The antibodies were used as follows: MGAT1 (1:1000; Abcam), β-actin (1:5000; Affinity), β-Catenin (1:5000; Abcam), c-Myc (1:1000; Abcam), Cyclin D1 (1:100,000; Abcam), Vimentin (1:1000; Abcam), E-Cadherin (1:10,000; Abcam), N-Cadherin (1:1000; Abcam), Bcl-2 (1:1000; Abcam), Bax (1:1000; Abcam). After washing the membranes three times with 1× TBST, membranes were incubated with a secondary antibody (1:5000; Affinity) at room temperature for 2 h. The membranes were then washed three times. Finally, ECL and a gel imaging system were utilized for visualization, and Image J software was utilized for protein quantitation.

RT-qPCR

As described in our previous study [11], total RNAs were isolated from each cell group. RT of RNA into complementary DNA was performed using the Mir-X miRNA First-Strand Synthesis Kit (Takara, Japan) and PrimeScript™ RT Reagent Kit with Genomic DNA Eraser (Takara, Japan). Subsequently, qPCR was implemented applying TB Green® Premix Ex Taq™ II (Takara, Japan). The 2−ΔΔCq method was applied for analyzing the relative quantitative values of targeted genes [30], U6 or GAPDH as an internal control. The used primer sequences are presented in Table I.
Table I.

Primer sequences used for reverse transcription-quantitative PCR.

GenePrimer sequence(5’-3’)
miR-331-3pGCCCCUGGGCCUAUCCUAGAA
MGAT1Forward: GAGCTGCTCTACCGCACCGACTTTReverse: CGGTCATTGGTCCTCACTTTCTCCA
U6Forward: CTCGCTTCGGCAGCACAReverse: AACGCTTCACGAATTTGCGT
GAPDHForward: CACCATCTTCCAGGAGCGAGReverse: TCACGCCACAGTTTCCCGGA
Primer sequences used for reverse transcription-quantitative PCR.

Cell apoptosis analysis

Following transfection, trypsin was used to digest cells, followed by three washes with PBS. After adding 195 µl binding solution to each sample, 5 µl Annexin V-FITC reagent was added, mixed gently and placed in the dark for 30 min. Subsequently, 10 µl PI was added, gently mixed, and the samples were incubated at room temperature for 15 min. The apoptotic rate was determined using flow cytometry (BD Biosciences) and an Annexin V-FITC Detection Kit (Beyotime Institute of Biotechnology). FlowJo software (version 10; FlowJo, LLC) was utilized to analyze the data [31].

Cell cycle analysis

Transfected OS cells were digested and washed twice. Cells were subsequently fixed using ethanol overnight. The fixed cells were resuspended in PBS after being washed twice. Then cells were stained with 10 µl PI containing RNase for 30 min at 4 °C. The cell cycle was determined using flow cytometry (BD Biosciences). Data analysis was performed by ModFitLT software (version 4.1; Verity Software House, Inc.) [32].

Dual‑luciferase reporter assay

This assay was conducted based on a previous study [33]. Using the H343 pmirGLO vector, MGAT1 fragments encompassing the miR-331-3p wild-type (WT) or mutant (MUT) target sequences were used to create MGAT1-WT/MUT and miR-331-3p-WT/MUT constructs. The miR-331-3p mimic and control were co-transfected into 293 T cells with the aforementioned MGAT1 constructs. Luciferase activity was detected using the Dual-Luciferase Reporter Assay System (cat. no. E1960; Promega Corporation).

Statistical analysis

Statistical analysis was performed using GraphPad Prism (version 8.0 for Windows; GraphPad Software, Inc., La Jolla, CA, USA) and SPSS statistical software (version 25.0; IBM Corp.). The unpaired student’s t test was used to draw a comparison between the two groups. Each experiment was repeated three times. P value < 0.05 was regarded as statistically significant.

Results

Herein, miR-331-3p was assumed to inhibit progression by targeting MGAT1 in OS cells. Firstly, miR-331-3p and MGAT1 were identified as the key genes via bioinformatics analysis. Further, we found that miR-331-3p and MGAT1 were expressed abnormally in the OS cell lines when compared with hFOB1.19. In addition, we explored the influence of miR-331-3p and MGAT1 on the phenotypes of OS cells. Overexpressed miR-331-3p inhibited the proliferation, migration, and invasion, and promoted apoptosis of U2OS cells, whereas miR-331-3p knockdown had the opposite effect on Saos-2 cells. It’s worth noting that MGAT1 could partially reduce the biological influence of miR-331-3p on U2OS. We also validated the targeted binding site between miR-331-3p and MGAT1. Lastly, the mechanism how miR-331-3p/MGAT1 axis regulated OS progression was illustrated by Wnt/β-Catenin and Bcl-2/Bax pathways and the EMT.

OS tissues and cell lines exhibited low-expressed miR-331-3p but highly expressed MGAT1

miRNA expression data (GSE65071) were investigated, including 20 OS tissues and 15 healthy controls from the GEO public database, to identify putative tumor-related miRNAs in OS. The top 25 substantially differently downregulated expressed miRNAs were determined (Figure 1(c)). We identified miR-331-3p as the miRNA of interest via literature research because the function of other miRNAs in OS has been studied. Volcano plot analysis illustrated the variation of miRNA expression levels between normal and OS tissues (Figure 1(a)). Furthermore, based on miRNA expression levels, a cluster heap map was used to depict up- and downregulated miRNAs (Figure 1(b)). Using the data extracted from GSE65071, miR-331-3p expression levels were found to be markedly decreased in OS tissues (Figure 1(d)). To further validate this, the miR-331-3p levels in hFOB1.19 and OS cell lines were analyzed. Compared with hFOB1.19, miR-331-3p was significantly decreased in OS cell lines (Figure 1(e)). Moreover, miR-331-3p expression was lowest in U2OS cells and highest in Saos-2 cells. (Figure 1(e)). Therefore, U2OS cells were used in experiments where miR-331-3p expression was up-regulated and utilization of Saos-2 cells in experiments where miR-331-3p expression was down-regulated. MGAT1 expression levels were markedly higher in OS tissues than normal tissues, according to the GEPIA bioinformatics analysis (Figure 1(f)). To determine MGAT1 mRNA and protein expression levels in OS cell lines, RT-qPCR and Western blotting were utilized, respectively. The results verified that increased MGAT1 mRNA and protein expression levels were exhibited in OS cell lines (Figure 1(g,h)).
Figure 1.

OS tissues and cell lines exhibited low-expressed miR-331-3p but highly expressed MGAT1. (a) Differentially expressed miRNAs between OS and normal tissues were analyzed using volcano plots. (b) Upregulated and downregulated miRNAs from the GSE65071 dataset were compared using a clustered heat map. (c) Top 25 down-regulated miRNAs. (d) Using the GSE65071 dataset, the expression levels of miR-331-3p were determined in OS tissues. (e) Utilization of RT-qPCR to quantify miR-331-3p in OS cell lines, respectively. (f) OS tissues (n = 262) and non-tumor tissues (n = 2) MGAT1 mRNA expression levels were determined using GEPIA bioinformatics analysis. (g) MGAT1 mRNA expression levels were determined in hFOB1.19, MG-63, Saos-2, and U2OS cells using RT-qPCR. (h) WB was utilized to determine MGAT1 protein expression in hFOB1.19, MG63, Saos-2 and U2OS cells. *P < 0.05, **P < 0.01 and ***P < 0.001.

OS tissues and cell lines exhibited low-expressed miR-331-3p but highly expressed MGAT1. (a) Differentially expressed miRNAs between OS and normal tissues were analyzed using volcano plots. (b) Upregulated and downregulated miRNAs from the GSE65071 dataset were compared using a clustered heat map. (c) Top 25 down-regulated miRNAs. (d) Using the GSE65071 dataset, the expression levels of miR-331-3p were determined in OS tissues. (e) Utilization of RT-qPCR to quantify miR-331-3p in OS cell lines, respectively. (f) OS tissues (n = 262) and non-tumor tissues (n = 2) MGAT1 mRNA expression levels were determined using GEPIA bioinformatics analysis. (g) MGAT1 mRNA expression levels were determined in hFOB1.19, MG-63, Saos-2, and U2OS cells using RT-qPCR. (h) WB was utilized to determine MGAT1 protein expression in hFOB1.19, MG63, Saos-2 and U2OS cells. *P < 0.05, **P < 0.01 and ***P < 0.001.

Malignancy of OS cells was affected by miR-331-3p

The biological functions of miR-331-3p in OS were investigated further. For overexpression and suppression of miR-331-3p, U2OS cells and Saos-2 cells were transfected with miR-331-3p mimic or inhibitor, respectively. The miR-331-3p expression levels were elevated in U2OS cells by the miR-331-3p mimic and repressed in Saos-2 cells by the miR-331-3p inhibitor, according to RT-qPCR analysis (Figure 2(a)). After that, the MTT assay was conducted to determine whether miR-331-3p affected OS cells proliferation. The findings showed that miR-331-3p overexpression decreased U2OS cells proliferation whereas miR-331-3p knockdown enhanced Saos-2 cells proliferation (Figure 2(b)). Furthermore, the Transwell and wound healing tests were used to see whether miR-331-3p affected U2OS or Saos-2 cells migration and invasion, which are both vital factors in cancer metastasis. U2OS cells treated with miR-331-3p mimic exhibited decreased migratory and invasive abilities than the negative control. Furthermore, compared with the negative control, Saos-2 cells treated with miR-331-3p inhibitor exhibited increased migration and invasion capacity (Figure 2(c, d)). Wound healing indicated that miR-331-3p up-regulation decreased the migratory ability in U2OS cells (Figure 2(e)). These findings implied that miR-331-3p may act as a tumor suppressor in OS cells malignant abilities like proliferation, invasion and migration.
Figure 2.

Malignancy of OS cells was affected by miR-331-3p. (a) RT-qPCR was utilized to quantify miR-331-3p expression in miR-331-3p mimic and miR-331-3p inhibitor group. (b) Following treatment with the miR-331-3p mimic or inhibitor, U2OS and saos-2 cells proliferation ability were assessed. (c and d) Migration and invasion abilities were quantified in U2OS and saos-2 cells transfected with the miR-331-3p mimic or miR-331-3p inhibitor, respectively. (e) Cell migration was observed at 0, 24, 48, 72 hours after scratching the cell layers. *P < 0.05, **P < 0.01 and ***P < 0.001.

Malignancy of OS cells was affected by miR-331-3p. (a) RT-qPCR was utilized to quantify miR-331-3p expression in miR-331-3p mimic and miR-331-3p inhibitor group. (b) Following treatment with the miR-331-3p mimic or inhibitor, U2OS and saos-2 cells proliferation ability were assessed. (c and d) Migration and invasion abilities were quantified in U2OS and saos-2 cells transfected with the miR-331-3p mimic or miR-331-3p inhibitor, respectively. (e) Cell migration was observed at 0, 24, 48, 72 hours after scratching the cell layers. *P < 0.05, **P < 0.01 and ***P < 0.001.

MiR-331-3p targeted MGAT1

Two binding sites for miR-331-3p were discovered using TargetScan, located at 190–196 and 1244–1251 of MGAT1-3’UTR (Figure 3(a)). Utilization of MGAT1-3’UTR-WT and MGAT1-3’UTR-MUT luciferase reporter plasmids, overexpression of miR-331-3p markedly reduced the MGAT1-3’UTR-WT firefly luciferase reporter activity, whereas MGAT1-3’UTR-MUT luciferase activity remained unchanged (Figure 3(b)). Subsequently, the influence of miR-331-3p on MGAT1 was evaluated employing RT-qPCR and WB. The findings exhibited that overexpressed miR-331-3p decreased the expression of MGAT1, whereas under-expressed miR-331-3p boosted MGAT1 expression (Figure 3(c, d)).
Figure 3.

MiR-331-3p targeted MGAT1 (a) The binding site between miR-331-3p and the MGAT1 3’UTR was identified using Targetscan. (b) Confirmation of interaction between miR-331-3p and MGAT1 by dual-luciferase reporter assay. (c) RT-qPCR was used to quantify MGAT1 mRNA in U2OS and saos-2 cells treated with the miR-331-3p mimic or inhibitor, respectively. (d) WB showed MGAT1 expression in U2OS and saos-2 cells after transfected with the miR-331-3p mimic or inhibitor, respectively. *P < 0.05, **P < 0.01 and ***P < 0.001.

MiR-331-3p targeted MGAT1 (a) The binding site between miR-331-3p and the MGAT1 3’UTR was identified using Targetscan. (b) Confirmation of interaction between miR-331-3p and MGAT1 by dual-luciferase reporter assay. (c) RT-qPCR was used to quantify MGAT1 mRNA in U2OS and saos-2 cells treated with the miR-331-3p mimic or inhibitor, respectively. (d) WB showed MGAT1 expression in U2OS and saos-2 cells after transfected with the miR-331-3p mimic or inhibitor, respectively. *P < 0.05, **P < 0.01 and ***P < 0.001.

MiR-331-3p promoted the cell cycle transition and apoptosis of OS cells

To further elucidate the suppressive function of miR-331-3p, we transfected miR-331-3p mimic into U2OS and miR-331-3p inhibitor into Saos-2. The findings stated that the proportion of G0/G1 phase cells in miR-331-3p-overexpressing U2OS cells was significantly higher than the control group. However, the G0/G1 phase proportion was markedly reduced in miR-331-3p-downexpressing Saos-2 cells (Figure 4(a)). Furthermore, the percentage of Annexin V-FITC positive and PI negative cells (apoptotic cells) increased markedly in the miR-331-3p mimic group (Figure 4(b)). Taken together, miR-331-3p inhibited OS cells progression by arresting cells in the G0/G1 phase and inducing apoptosis.
Figure 4.

MiR-331-3p promoted the cell cycle transition and apoptosis of OS cells. (a) Cell cycle analysis was performed in OS cells using flow cytometry 72 h following transfection with the control inhibitor, miR-331-3p inhibitor, control mimic and miR-331-3p mimic. (b) Flow cytometry was performed to detect apoptotic cells 72 h following transfection with the control mimic and miR-331-3p mimic.*P < 0.05, **P < 0.01 and ***P < 0.001.

MiR-331-3p promoted the cell cycle transition and apoptosis of OS cells. (a) Cell cycle analysis was performed in OS cells using flow cytometry 72 h following transfection with the control inhibitor, miR-331-3p inhibitor, control mimic and miR-331-3p mimic. (b) Flow cytometry was performed to detect apoptotic cells 72 h following transfection with the control mimic and miR-331-3p mimic.*P < 0.05, **P < 0.01 and ***P < 0.001.

MGAT1 knockdown partially reduced the effect of miR-331-3p on U2OS cells

MGAT1 was previously demonstrated to be highly expressed in OS cell lines (U2OS, MG63 and Saos-2), and MGAT1 expression levels were highest in U2OS cells (Figure 1(g)). Therefore, the following assays were performed using U2OS cells only. To decrease the expression level of MGAT1, MGAT1 siRNA was transfected into U2OS cells. Following transfection, MGAT1 expression was demonstrated to be successfully reduced (Figure 5(a)). The MTT assay demonstrated that MGAT1 knockdown decreased U2OS cells viability, whereas miR-331-3p knockdown improved cells viability. Furthermore, lowly expressed MGAT1 reduced the growth of U2OS cells induced by under-expressed miR-331-3p. (Figure 5(b)). Transwell experiment was used to evaluate the capacity of U2OS cells to migrate and invade, resemble impacts were observed (Figure 5(c,d)). MGAT1 knockdown decreased, while miR-331-3p inhibitor raised wound closure percentage. The effect of miR-331-3p knockdown was counteracted by MGAT1 knockdown (Figure 5(e)). These results indicated that MGAT1 may interact with miR-331-3p in U2OS cells.
Figure 5.

MGAT1 knockdown partially reduced the effect of miR-331-3p on U2OS cells. (a) Following MGAT1 siRNA transfection, RT-qPCR was utilized to quantify MGAT1 mRNA in U2OS cells. (b) U2OS cells proliferation following transfection with miR-331-3p inhibitor, MGAT1 siRNA, or miR-331-3p inhibitor and MGAT1 siRNA co-transfection, was assessed using the MTT assay. (c and d) Utilization of transwell for assessment of U2OS cells migration and invasion capacities 72 hours after treated with the miR-331-3p inhibitor, MGAT1 siRNA and miR-331-3p inhibitor, or MGAT1 siRNA and miR-331-3p inhibitor co-transfection. (e) Cell migration was observed 48 hours after scratching the cell layers. *P < 0.05, **P < 0.01 and ***P < 0.001.

MGAT1 knockdown partially reduced the effect of miR-331-3p on U2OS cells. (a) Following MGAT1 siRNA transfection, RT-qPCR was utilized to quantify MGAT1 mRNA in U2OS cells. (b) U2OS cells proliferation following transfection with miR-331-3p inhibitor, MGAT1 siRNA, or miR-331-3p inhibitor and MGAT1 siRNA co-transfection, was assessed using the MTT assay. (c and d) Utilization of transwell for assessment of U2OS cells migration and invasion capacities 72 hours after treated with the miR-331-3p inhibitor, MGAT1 siRNA and miR-331-3p inhibitor, or MGAT1 siRNA and miR-331-3p inhibitor co-transfection. (e) Cell migration was observed 48 hours after scratching the cell layers. *P < 0.05, **P < 0.01 and ***P < 0.001.

MiR-331-3p/MGAT1 axis regulated OS malignant behavior via the EMT and the Wnt/β-Catenin and Bcl-2/Bax signaling pathways

The aforementioned findings suggested that miR-331-3p inversely regulated MGAT1. Subsequently, the regulatory mechanism of the miR-331-3p/MGAT1 axis was investigated. The western blotting results demonstrated that β-Catenin, c-Myc and Cyclin D1 levels in miR-331-3p-overexpressing U2OS cells were reduced. However, in miR-331-3p knockdown Saos-2 cells, these proteins were significantly increased (Figure 6(a)). Overexpression of miR-331-3p also decreased Bcl-2, Vimentin and N-Cadherin proteins and increased Bax and E-Cadherin proteins in both U2OS and Saos-2 cells (Figure 6(b)). Moreover, MGAT1 knockdown partially suppressed the Wnt/β-Catenin pathway activated by miR-331-3p inhibitor, as well as the EMT (Figure 6(c)). These findings suggested that the malignant phenotypes of OS cells may be mediated by the miR-331-3p/MGAT1 axis via the Wnt/β-Catenin pathway, which regulated OS proliferation, via the EMT, which modulated OS migration and invasion, and via the Bcl-2/Bax signaling pathway, which modified OS apoptosis (Figure 7).
Figure 7.

Graphic representation of the role of the miR-331-3p/MGAT1 axis in OS malignancy. MiR-331-3p suppressed MGAT1 expression, which resulted in decreased c-myc and Cyclin D1 proteins and decreased OS cells proliferation ability. MiR-331-3p decreased MGAT1 expression, which resulted in an increase in Bax and a decrease in Bcl-2, which was associated with an increase in OS cells apoptosis. Furthermore, miR-331-3p reduced MGAT1 expression levelby interacting with MGAT1 3’UTR, which resulted in decreased EMT, leading to a reduction in OS cells migration, invasion and metastasis capacities.

MiR-331-3p/MGAT1 axis regulated OS malignant behavior via the EMT and the Wnt/β-Catenin and Bcl-2/Bax signaling pathways. (a) Evaluation of Wnt/β-Catenin signaling pathway related proteins, in control/miR-331-3p mimic transfected U2OS cells and control/miR-331-3p inhibitor transfected Saos-2 cells by WB assay. (b) WB exhibited EMT-related proteins, Bcl-2 and Bax, in control/miR-331-3p mimic transfected U2OS and saos-2 cells. (c) WB exhibited Wnt/β-Catenin pathway and the EMT related proteins after treated with the MGAT1 siRNA, miR-331-3p inhibitor, and miR-331-3p inhibitor or MGAT1 siRNA co-transfection. Continued. Graphic representation of the role of the miR-331-3p/MGAT1 axis in OS malignancy. MiR-331-3p suppressed MGAT1 expression, which resulted in decreased c-myc and Cyclin D1 proteins and decreased OS cells proliferation ability. MiR-331-3p decreased MGAT1 expression, which resulted in an increase in Bax and a decrease in Bcl-2, which was associated with an increase in OS cells apoptosis. Furthermore, miR-331-3p reduced MGAT1 expression levelby interacting with MGAT1 3’UTR, which resulted in decreased EMT, leading to a reduction in OS cells migration, invasion and metastasis capacities.

Discussion

OS is one of the most common primary malignant tumors of bone, which also ranks as the second highest cause of tumor-related death in children and young adults, whereby the patients have a poor prognosis [34]. Despite the application of aggressive surgical therapy and intensive chemotherapy, the 5-year survival rate of patients with metastatic OS is still only ~20% and ~20% of patients exhibit detectable metastasis on their initial visit to the hospital [35]. In our study, miR-331-3p and MGAT1 were first found as key miRNA and gene involved in OS. Next, miR-331-3p was confirmed as a tumor suppressor and negatively regulated in OS cells. It’s worth noting that miR-331-3p overexpression inhibited proliferation, invasion, and migration in U2OS cells, whereas miR-331-3p knockdown exhibited the opposite results in Saos-2 cells. Further, MGAT1 was identified as a target of miR-331-3p, and the expression of it was markedly decreased in OS, suggesting a negative relationship with miR-331-3p. Moreover, our results demonstrated that miR-331-3p could suppress OS cells malignancy by targeting and decreasing MGAT1, which indicated they could be biomarkers and drug targets for OS in the future. There is accumulating proof suggesting that abnormal miRNA expression is associated with the development of malignancies [36]. Some miRNAs function as tumor suppressors and some as oncogenes in OS [37]. For instance, Ji et al. have proved that miR-223-3p can comprehensively inhibit human OS progression [38]; Chen et al. reported that miR-193a-5p promoted the malignant potential of OS in vitro and in vivo [39]. MiR-331-3p has been demonstrated to express at a high level in some tumors, such as ovarian cancer, lung cancer, and nasopharyngeal carcinoma, while it expresses at a low level in pancreatic cancer [13-16]. In this study, we confirmed for the first time that miR-331-3p is underexpressed in OS tissues and cell lines, and overexpression or knockout of it can markedly inhibit or promote the proliferation, migration, and invasion of OS in vitro. At the same time, we observed that an exogenous miR-331-3p stagnated the cell cycle in G0/G1 phase and induced apoptosis of OS cells. MGAT1 encodes an important enzyme that initiates the synthesis of complex N-glycans, and it has been implicated in carcinogenesis, such as prostate cancer, cervical cancer, hepatocellular carcinoma, glioblastoma, and pancreatic cancer [19-21,40]. In our study, MGAT1 was found to be up-regulated in OS tissues and cells, acting as an oncogene in OS cells. We firstly reported that MGAT1 is a direct target of miR-331-3p and it could also antagonize the inhibition effects of miR-331-3p on OS cells. The Wnt/β-Catenin signaling pathway facilitates cancer cells proliferation and differentiation, which serves a fundamental role in tumorigenesis [41]. Recent evidence shows that several microRNAs could regulate the Wnt/β-Catenin pathway, for instance, by miR-22-3p, miR-30b and miR-377-3p in OS [42-44]. Meanwhile, miR-331-3p up-regulation in pancreatic cancer cells has been shown to activate the Wnt/β-Catenin pathway [13]. However, we found that up-regulated miR-331-3p caused the inhibition of the Wnt/β-Catenin pathway, while down-regulated miR-331-3p led to the activation of the Wnt/β-Catenin pathway in OS cells. At the same time, MGAT1 could partially counteract the inhibitory effect of miR-331-3p on the Wnt/β-Catenin pathway. Taking these together, we drew the conclusion that the miR-331-3p/MGAT1 axis regulated OS cells proliferation via the Wnt/β-Catenin pathway. Traditionally, EMT has been known to be essential for the migratory and invasive abilities of cancer cells [45]. Cancer cells may also exhibit changes in EMT via the low expression of epithelial markers, such as E-cadherin and the high expression of mesenchymal markers, such as N-cadherin and Vimentin [46]. In the present study, E-Cadherin was increased whereas Vimentin and N-Cadherin were significantly decreased in the miR-331-3p overexpression groups in both U2OS and Saos-2 cells. Further, a rescue assay indicated that MGAT1 could partially impair the effect of miR-331-3p on the EMT. Our results suggested that miR-331-3p/MGAT1 axis might regulate migration and invasion of OS cells via the EMT. Among many proteins, Bcl-2 family proteins are regarded as major regulators of cell apoptosis [47]. Bcl-2 can inhibit cell apoptosis and induce tumorigenesis, while Bax can facilitate the apoptosis of cancer cells [48]. In addition, the Bcl-2/Bax signaling pathway has been shown to participate in apoptosis in OS [49,50]. Here, our results suggested that up-regulation of miR-331-3p inhibited Bcl-2 expression but promoted Bax expression in OS cells. Combined with miR-331-3p promoting apoptosis and MGAT1 being a direct target, we concluded that apoptosis in OS cells was regulated via the miR-331-3p/MGAT1/Bcl-2/Bax pathway. Despite the fact that our findings proved that miR-331-3p suppressed OS cells progression by targeting MGAT1, there are some limitations to this work, including the absence of studies in vivo and OS tissues collected by ourselves. Animal studies to explore the role and mechanism of miR-331-3p on OS and the correlation between the expression of miR-331-3p or MGAT1 with the clinical parameters of OS patients, as well as whether they could be biomarkers for OS diagnosis and prognosis, are urgently needed in future work.

Conclusion

Eventually, our work elucidated that miR-331-3p functions as a tumor suppressor in OS cells by binding to MGAT1. Further, MGAT1 could attenuate the effect of miR-331-3p on OS cells. Notably, our evidence illustrated that the miR-331-3p/MGAT1 axis led to suppressed Wnt/β-Catenin pathway and inhibitory EMT, which decreased malignant phenotypes of OS cells. MiR-331-3p downregulates MGAT1 expression, which results in increased apoptosis via the Bcl-2/Bax pathway. Therefore, the results of this research suggest novel mechanism in OS progression and a new target for molecular therapy of OS.
  50 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

Review 2.  Glycans and cancer: role of N-glycans in cancer biomarker, progression and metastasis, and therapeutics.

Authors:  Naoyuki Taniguchi; Yasuhiko Kizuka
Journal:  Adv Cancer Res       Date:  2015-02-07       Impact factor: 6.242

Review 3.  BAX to basics: How the BCL2 gene family controls the death of retinal ganglion cells.

Authors:  Margaret E Maes; Cassandra L Schlamp; Robert W Nickells
Journal:  Prog Retin Eye Res       Date:  2017-01-04       Impact factor: 21.198

4.  MicroRNA‑106a regulates the proliferation and invasion of human osteosarcoma cells by targeting VNN2.

Authors:  Yao Chen; Tao Huang; Xiaofan Yang; Chaowu Liu; Pengcheng Li; Zhihang Wang; Shengpeng Zhi
Journal:  Oncol Rep       Date:  2018-07-26       Impact factor: 3.906

5.  miR-874-3p inhibits cell migration through targeting RGS4 in osteosarcoma.

Authors:  Wei-Gang Liu; Lei Zhuo; Yun Lu; Lin Wang; Yan-Xia Ji; Qing Guo
Journal:  J Gene Med       Date:  2020-06-01       Impact factor: 4.565

6.  miR-331-3p Inhibits Proliferation and Promotes Apoptosis of Nasopharyngeal Carcinoma Cells by Targeting elf4B-PI3K-AKT Pathway.

Authors:  Zhang Xuefang; Zheng Ruinian; Jiang Liji; Zhang Chun; Zheng Qiaolan; Jia Jun; Chen Yuming; Huang Junrong
Journal:  Technol Cancer Res Treat       Date:  2020 Jan-Dec

7.  MicroRNA-886 suppresses osteosarcoma cell proliferation and its maturation is suppressed by long non-coding RNA OXCT1-AS1.

Authors:  Wen Dai; Han Liu
Journal:  Bioengineered       Date:  2022-03       Impact factor: 3.269

8.  MiR-331-3p Links to Drug Resistance of Pancreatic Cancer Cells by Activating WNT/β-Catenin Signal via ST7L.

Authors:  Ting Zhan; Xiaoli Chen; Xia Tian; Zheng Han; Meng Liu; Yanli Zou; Shasha Huang; Aifang Chen; Xueting Cheng; Junsheng Deng; Jie Tan; Xiaodong Huang
Journal:  Technol Cancer Res Treat       Date:  2020 Jan-Dec

9.  Long non-coding RNA (LncRNA) MRPL23-AS1 promotes tumor progression and carcinogenesis in osteosarcoma by activating Wnt/β-catenin signaling via inhibiting microRNA miR-30b and upregulating myosin heavy chain 9 (MYH9).

Authors:  Hanwen Zhang; Shuya Liu; Lian Tang; Jianhua Ge; Xiaobo Lu
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

10.  The miR-193a-5p/NCX2/AKT axis promotes invasion and metastasis of osteosarcoma.

Authors:  Ruiqi Chen; Yichong Ning; Guirong Zeng; Hao Zhou; Lin Zhou; Pei Xiao; Zhihong Li; Jianlin Zhou
Journal:  J Cancer       Date:  2021-08-08       Impact factor: 4.207

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.