| Literature DB >> 35755440 |
Konrad Schoettner1, Mariana Alonso1, Margo Button1, Cassandra Goldfarb1, Juliana Herrera1, Nour Quteishat1, Christiane Meyer1, Andreas Bergdahl2, Shimon Amir1.
Abstract
The expression of circadian clock genes, either centrally or in the periphery, has been shown to play an integral role in the control of behavior. Brain region-specific downregulation of clock genes revealed behavioral phenotypes associated with neuropsychiatric disorders and neurodegenerative disease. The specific function of the clock genes as well as the underlying mechanisms that contribute to the observed phenotypes, however, are not yet fully understood. We assessed anxiety- and depressive-like behavior and motor functions in male and female mice with a conditional ablation of Bmal1 or Per2 from medium spiny neurons (MSNs) of the striatum as well as mice lacking one copy of Gpr88. Whereas the conditional knockout of Bmal1 and Per2 had mild effects on affective behaviors, a pronounced effect on motor functions was found in Bmal1 knockout mice. Subsequent investigation revealed an attenuated response of Bmal1 knockout mice to dopamine receptor type 1 agonist treatment, independently of the expression of targets of the dopamine signaling pathway or mitochondrial respiration in MSNs. The study thus suggests a potential interaction of Bmal1 within the direct dopamine signaling pathway, which may provide the link to a shared, MSN-dependent mechanism regulating affective behavior and motor function in mice.Entities:
Keywords: clock genes; medium spiny neurons; mitochondrial respiration; mood-and anxiety-like behavior; motor coordination
Year: 2022 PMID: 35755440 PMCID: PMC9216244 DOI: 10.3389/fphys.2022.922080
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Primer list for quantitative real-time PCR.
| Target gene | Forward primer | Reverse primer | Efficiency (%) |
|---|---|---|---|
| Gapdh | CATCTTCCAGGAGCGAGACC | GGCGGAGATGATGACCCTTT | 100.9 |
| Ppib | GGAGATGGCACAGGAGGAAA | CCGTAGTGCTTCAGCTTGAAGTTCT | 100.9 |
| Bmal1 | GGACACAGACAAAGATGACCCT | ATTTTGTCCCGACGCCTCTT | 107.7 |
| Per1 | CCTTCCTCCACACCGACAAA | GCTGCATGGCTCCTAACTGA | 102.9 |
| Per2 | ACAGAAGGAAGAGCAAGCCT | GCTTTAGATCGGCAGTGGTG | 110.9 |
| Cry1 | GAGCAGGTTGAGGGCATTAC | AGGCGTCCTTCTTACAGTGA | 96.6 |
| Dbp | TGTCAAGCATTCCAGGCCAT | TCCGGCTCCAGTACTTCTCA | 106.5 |
| Drd1 | CTGCTGGCTCCCTTTCTTCA | GGGGTTCAGGGAGGAATTCG | 101.2 |
| Drd2 | CATTGTCTGGGTCCTGTCCT | GAACGAGACGATGGAGGAGT | 99.3 |
| Maoa | TGGAGTGGCTACATGGAAGG | CCTTGGACTCAGGCTCTTGA | 101.7 |
| Gad67 | GGAGCTGGCTGATTACCTCT | GCTATCTGGAACCCCTCGAA | 97.4 |
| Sirt1 | TCGTGGAGACATTTTTAATCAGG | GCTTCATGATGGCAAGTGG | 100.8 |
Statistical analysis of affective behaviours and motor function.
| Assay | Mouse line | Three-way ANOVA factors | |||
|---|---|---|---|---|---|
| Genotype | Time point | Sex | Interaction | ||
| EPM open arm time |
| F (1, 59) = 5.784, | n.s. | n.s. | n.s. |
|
| n.s. | n.s. | n.s. | n.s. | |
|
| n.s. | F (1, 54) = 9.463, | n.s. | n.s. | |
| EPM open arm entries |
| F (1, 59) = 7.553, | n.s. | n.s. | n.s. |
|
| F (1, 32) = 4.174, | F (1, 32) = 7.399, | n.s. | n.s. | |
|
| n.s. | F (1, 54) = 8.104, | n.s. | n.s. | |
| EPM distance travelled |
| n.s. | F (1, 59) = 6.395, | F (1, 59) = 4.390, | n.s. |
|
| n.s. | n.s. | n.s. | n.s. | |
|
| n.s. | F (1, 54) = 15.92, | n.s. | n.s. | |
| OFT center time |
| F (1, 57) = 5.802, | F (1, 57) = 20.86, | F (1, 57) = 5.275, | n.s. |
|
| n.s. | F (1, 36) = 12.76, | F (1, 36) = 7.836, | genotype X sex, F (1, 36) = 4.677, | |
|
| n.s. | F (1, 54) = 23.36, | n.s. | n.s. | |
| OFT distance travelled |
| F (1, 57) = 25.96, | F (1, 57) = 6.718, | F (1, 57) = 5.747, | n.s. |
|
| F (1, 36) = 19.50, | n.s. | n.s. | n.s. | |
|
| F (1, 54) = 16.37, | F (1, 54) = 13.99, | n.s. | n.s. | |
| OFT rearing |
| F (1, 57) = 12.35, | F (1, 57) = 19.59, | n.s. | n.s. |
|
| n.s. | n.s. | n.s. | n.s. | |
|
| F (1, 54) = 5.915, | F (1, 54) = 15.65, | n.s. | n.s. | |
| MBT # marbles buried |
| n.s. | n.s. | n.s. | |
|
| n.s. | n.s. | n.s. | ||
|
| n.s. | F (1, 45) = 13.95, | n.s. | ||
| TST immobility time |
| F (1, 38) = 5.146, | n.s. | n.s. | |
|
| n.s. | n.s. | n.s. | ||
|
| n.s. | n.s. | n.s. | ||
| HBT bar performance |
| F (1, 38) = 5.206, | n.s. | n.s. | |
|
| n.s. | n.s. | n.s. | ||
|
| n.s. | n.s. | n.s. | ||
| FSSR time on rod |
| F (1, 38) = 15.67, | n.s. | n.s. | |
|
| n.s. | n.s. | n.s. | ||
|
| n.s. | n.s. | n.s. | ||
FIGURE 1Anxiety-like behavior in mice with a striatal-specific clock gene knockout. Time spent in the open arm of the elevated plus-maze and time spent in the center of an open field was investigated during the light (ZT2–6, light grey bar) and the dark period (ZT 14–18, dark grey bar). Mice with a conditional Bmal1 knockout (n = 6–13 per genotype, sex, and time point) displayed decreased anxiety-like behavior in the elevated plus-maze compared to controls (A), whereas increased anxiety-like behavior was observed in the open field test (B). The conditional knockout of Per2 (n = 3–8 per genotype, sex, and time point) did not affect anxiety-like behavior in the elevated plus-maze and open field (C,D). Results are depicted as mean ± standard error of the mean (S.E.M.). # … p ≤ 0.05, ## … p ≤ 0.05, ### … p ≤ 0.05, three-way ANOVA. *** … p ≤ 0.0005, Šídák’s multiple comparisons test. Details of the statistical analysis are shown in Table 2.
FIGURE 2Anxiety- and depressive-like behavior in mice with a conditional Bmal1 or Per2 knockout and control animals. No genotype effects on the number of buried marbles were found in male and female mice of the two mouse lines (n = 3–13 per genotype, sex, and mouse line) (A,B). Depressive-like behavior indicated by immobility time in the tail suspension test is decreased in mice with a striatal Bmal1 knockout (n = 8–13 per genotype and sex) (C) but unaffected in mice with a conditional ablation of Per2 (n = 6–11 per genotype and sex) from striatal MSNs (D). Results are depicted as mean ± standard error of the mean (S.E.M.). # … p ≤ 0.05, three-way ANOVA. Details of the statistical analysis are shown in Table 2.
FIGURE 3Motor functions in mice with a conditional Bmal1 or Per2 knockout and controls. Mice with a striatal-specific Bmal1 knockout (n = 9–13 per genotype and sex) performed worse in the horizontal bar test compared to controls (A), whereas no differences were found in mice with a knockout of Per2 (n = 6–11 per genotype and sex) (B) from striatal MSNs. Likewise, Bmal1 knockout mice (n = 8–13 per genotype and sex) (C) had deficits in motor coordination assessed in the rotarod in contrast to mice with a conditional ablation of Per2 (n = 6–11 per genotype and sex) (D) from striatal MSNs. Results are depicted as mean ± standard error of the mean (S.E.M.). # … p ≤ 0.05, ### … p ≤ 0.0005, three-way ANOVA. * … p ≤ 0.05, Tukey’s multiple comparisons test. Details of the statistical analysis are shown in Table 2.
FIGURE 4Locomotor response to DRD1 and DRD2 agonist administration in mice with a conditional Bmal1 knockout. Changes in activity relative to baseline levels are depicted in 10-min intervals. Males and females with a conditional knockout of Bmal1 (n = t3–5 per sex and treatment) displayed an attenuated response to SKF-81297 compared to controls (n = 4–7 per sex and treatment) (A). Activity was inhibited in males and females with a conditional knockout of Bmal1 (n = 3–4 per sex and treatment) and controls (n = 4–8 per sex and treatment) following Quinpirole administration compared to saline injections (B). Results are depicted as mean ± standard error of the mean (S.E.M.). Only genotype and treatment main effects are displayed in the graph. # … p ≤ 0.05, ### … p ≤ 0.0005, three-way ANOVA. Letters indicate levels of statistical difference between genotype and treatment post-hoc comparison: a … treatment effect CTRL group, b … treatment effect cKO group, c … genotype effect for SKF or Quinpirole treatment; one letter … p ≤ 0.05, two letters … p ≤ 0.005, three letters … p ≤ 0.0005, Tukey’s multiple comparisons test. Details of the statistical analysis are displayed in Table 3.
Statistical analysis of dopamine receptor agonist treatment and mitochondrial respiration.
| Assay/mouse line | Sex | Three-way ANOVA factors | |||
|---|---|---|---|---|---|
| Genotype | Interval | Treatment | Interaction | ||
| D1 agonist SKF-81297 | Males | F (1, 18) = 8.890, | F (2.710, 48.78) = 14.01, | F (1, 18) = 32.14, | Interval X treatment |
| F (6, 108) = 6.509, | |||||
|
| Females | F (1, 12) = 5.213, | F (2.272, 27.26) = 3.229, | n.s. | Interval X genotype |
| F (6, 72) = 2.719, | |||||
| D2 agonist Quinpirole | Males | n.s. | F (3.106, 55.92) = 104.7, | F (1, 18) = 88.74, | Interval X treatment |
| F (6, 108) = 8.006, | |||||
|
| Females | F (1, 11) = 5.461, | F (3.208, 35.28) = 47.70, | F (1, 11) = 10.83, | Interval X treatment |
| F (6, 66) = 6.584, | |||||
| D1 agonist SKF-81297 | Males | n.s. | F (1.918, 26.85) = 6.800, | F (1, 14) = 11.37, | Interval X treatment |
| F (6, 84) = 3.481, | |||||
|
| Females | n.s. | F (2.470, 51.86) = 9.164, | F (1, 21) = 6.176, | Interval X treatment |
| F (6, 126) = 2.713, | |||||
| D2 agonist Quinpirole | Males | n.s. | F (3.727, 55.91) = 145.3, | F (1, 15) = 35.34, | Interval X treatment |
| F (6, 90) = 9.159, | |||||
| Interval X genotype | |||||
| F (6, 84) = 3.242, | |||||
| Interval X treatment | |||||
| F (6, 84) = 6.930, | |||||
|
| Females | n.s. | F (3.239, 45.34) = 86.79, | F (1, 14) = 86.72, | |
| Mitochondrial respiration | Males | n.s. | n.s. | F (7, 64) = 176.5, | n.s. |
|
| Females | n.s. | n.s. | F (7, 64) = 174.8, | n.s. |
| Mitochondrial respiration | Males | n.s. | n.s. | F (7, 32) = 34.32, | n.s. |
|
| Females | n.s. | n.s. | F (7, 32) = 17.20, | n.s. |
FIGURE 5Striatal mitochondrial respiration in mice with a conditional knockout of Bmal1 and control animals. Sequential substrate addition to assess mitochondrial coupled and uncoupled oxygen consumption, as well as leak and membrane integrity, revealed no differences between male and female mice with a conditional Bmal1 knockout and controls (n = 4–6 per genotype, sex, and time point) (A,B). Likewise, the degree of coupling between oxidation and phosphorylation did not differ between genotypes within the Bmal1 mouse line (C). Results are depicted as mean ± standard error of the mean (S.E.M.). Details of the statistical analysis are displayed in Table 3.
FIGURE 6Gene expression analysis of striatal tissue collected from mice with a conditional Bmal1 knockout and control animals (n = 3–4 per genotype, sex, and time point). While expression of Bmal1 was abolished, it did only partially affect the expression of E-box-controlled genes. Whereas Per1 and Per2 gene expression remained largely unaffected, Cry1 expression was upregulated. Despite statistical analysis revealing genotype effects of targets of the dopamine and GABAergic signaling pathways in males, differences appeared to be relatively small between genotypes (for details, see result section and Table 4). Results are depicted as mean ± standard error of the mean (S.E.M.).
Results of the gene expression analysis.
| Target gene | Three-way-ANOVA | Zero-amplitude test | ||
|---|---|---|---|---|
| Sex | Genotype | F-statistics | ||
| Bmal1 | genotype: F1,36 = 366.6, | M | CTRL | n.s. |
| cKO | n.s. | |||
| time point: F3,36 = 10.91, | ||||
| time point X genotype: F3,36 = 7.158, | F | CTRL | n.s. | |
| gender X genotype: F3,36 = 4.244, | cKO | n.s. | ||
| Per1 | genotype: F1,36 = 8.422, | M | CTRL | n.s. |
| cKO | n.s. ( | |||
| time point: F3,36 = 4.063, | F | CTRL | n.s. | |
| cKO | n.s. | |||
| Per2 | time point: F3,36 = 18.65, | M | CTRL | n.s. ( |
| cKO | n.s. | |||
| F | CTRL | n.s | ||
| cKO | n.s. | |||
| Cry1 | genotype: F1,36 = 148.5, | M | CTRL | n.s. |
| time point: F3,36 = 7.081, | ||||
| cKO | n.s. | |||
| F | CTRL | n.s. | ||
| cKO | n.s. | |||
| Dbp | genotype: F1,36 = 162.1, | M | CTRL | n.s. ( |
| time point: F3,36 = 14.81, | ||||
| time point X gender: F3,36 = 4.147, | cKO | n.s. | ||
| time point X genotype: F3,36 = 9.624, | F | CTRL | F2,1 = 200.58, | |
| time point X gender X genotype: F1,36 = 4.018, | cKO | n.s. | ||
| Drd1 | M | CTRL | n.s. | |
| cKO | F2,1 = 311.92, | |||
| F | CTRL | n.s. | ||
| cKO | n.s. | |||
| Drd2 | genotype: F1,36 = 8.375, | M | CTRL | n.s. |
| cKO | n.s. | |||
| F | CTRL | n.s. | ||
| cKO | n.s. | |||
| Maoa | genotype: F1,36 = 4.879, | M | CTRL | F2,1 = 5668.01, |
| cKO | n.s. | |||
| F | CTRL | n.s. | ||
| cKO | n.s. | |||
| Gad67 | genotype: F1,36 = 10.44, | M | CTRL | n.s. |
| cKO | n.s. | |||
| time point X gender X genotype: F1,36 = 2.993, | F | CTRL | n.s. | |
| cKO | n.s. | |||
| Sirt1 | genotype: F1,36 = 6.173, | M | CTRL | n.s. |
| cKO | n.s. | |||
| F | CTRL | n.s. | ||
| cKO | n.s. | |||