MicroRNA-30c-2-3p represses malignant progression of gastric adenocarcinoma cells via targeting ARHGAP11A.

MicroRNAs are crucial tumor regulators to tumor development and progression. MiR-30c-2-3p can suppress malignant progression of tumor cells, but no study has reported the modulatory process of miR-30c-2-3p in gastric adenocarcinoma (GA). We herein investigated role of miR-30c-2-3p in GA cells. Here, we evaluated gene level in cancer cells by qRT-PCR. CCK-8, colony formation, flow cytometry, and transwell assays revealed biological functions of miR-30c-2-3p and ARHGAP11A. Genes downstream of miR-30c-2-3p were acquired through bioinformatics analysis. Our results suggested a low level of miR-30c-2-3p in GA tissue and cells, while its high expression could repress the malignant progression and promote cell cycle arrest and apoptosis of GA cells. Besides, ARHGAP11A was downstream of miR-30c-2-3p, with up-regulated ARHGAP11A facilitating malignant progression and repressing cell cycle arrest and apoptosis of GA cells. In addition, changes in GA cell functions caused by high ARHGAP11A expression could be partially offset by enhancing miR-30c-2-3p. Thus, our observations indicated that miR-30c-2-3p was a tumor repressor that could inhibit GA progression via modulating ARHGAP11A.

Hi ghli ghts

MiR-30c-2-3p was prominently downregulated in gastric cancer (GA);

MiR-30c-2-3p was ectopically expressed in GA, repressed cell progression, and impelled apoptosis and cell cycle arrest;

ARHGAP11A was a direct target and negatively correlated with miR-30c-2-3p;

MiR-30c-2-3p modulated GA malignant progression via ARHGAP11A.

Introduction

Gastric adenocarcinoma (GA) cases occupy 95% of all malignant gastric cancer (GC) cases and ranks the highest in all malignant cancers in China [1,2]. Surgery, chemoradiotherapy, and immunotherapy are developed for GC treatment [3]; however, 5-year survival is unsatisfactory due to recurrent and distant metastasis of GC [4,5]. Therefore, understanding the mechanisms of GA progression facilitates the development of more effective targeted therapies.

The Rho GTPases family is a class of intracellular signaling molecules. Rho GTPases are usually activated and up-regulated in tumors [6,7]. Normally, Rho GTPases are regulated by GTPase-activating proteins (GAPs), which accelerates GTPases hydrolysis to inactivate Rho GTPases [8]. Nevertheless, little is known about ARHGAP11A as one of the Rho GTPases family. ARHGAP11A level is up-regulated in copious cancers and contributes to malignant progression [9,10]. Chen et al [11]. denoted that ARHGAP11A is conducive to the maintenance of GC cell stemness. A recent report indicated that ARHGAP11A correlates with the immune infiltration in GC [12]. In sum, ARHGAP11A is pivotal to tumor progression, with inadequate study on GA mechanism.

MicroRNAs (miRNAs) are non-coding regulatory RNAs encoded by endogenous genes. MiRNAs negatively modulate the gene expression via pairing with target mRNA at 3’ UTR to repress the translation and stability of mRNAs [13]. Moreover, miRNAs control genes that participate in cellular processes like stress response, cell cycle regulation, differentiation, inflammation, apoptosis, and migration [14]. MiRNAs are a party in almost all intracellular signaling circuits. Studies reported that the dysregulated miRNAs are crucial to cancer progression. MiR-30c-2-3p is one of them. Its level is strikingly low in pancreatic ductal adenocarcinoma (PDAC) and suppresses malignant cancer progression by repressing TOP2A [15]. MiR-30c-2-3p has been demonstrated to be prominently decreased in breast cancer (BC), clear cell renal carcinoma (ccRCC), as well as PDAC, while its ectopic expression remarkably represses cancer cell proliferation and invasion, and is linked to dismal prognosis [15-17]. Similarly, miR-30c-2-3p is demonstrated as lowly expressed in GC and can facilitate cell cycle transition to abate apoptosis [18]. In addition, miR-30c-2-3p suppresses proliferation and apoptosis of GC cells via targeting RAB31 via GL1 signaling. Fan et al [5]. implied that METTL14-mediated modification of m6circOCR5 abates the proliferation and invasion of GC cells via miR-30c-2-3p/AKT1S1 axis. However, it is never seen on publication whether miR-30c-2-3p manipulates GA progression by targeting ARHGA11A.

We posited that miR-30c-2-3p might abate malignant GA progression via ARHGA11A. Accordingly, we aimed to dissect miR-30c-2-3p functions on progression, apoptosis, and cell cycle of GA cell lines, and to further explore its target genes as well as potential mechanisms by which GA progression was affected. Eventually, as experiments suggested, downregulated miR-30c-2-3p in GA abated malignant progression of GA by negatively manipulating ARHGA11A.

Materials and methods

Bioinformatics analysis

MiR-30c-2-3p and ARHGAP11A levels in tissue of GC were dissected via bioinformatics approaches [18]. The expression data of miRNAs (Normal: 45, Tumor: 446) and mRNAs (Normal: 32, Tumor: 375) in GA were obtained from The Cancer Genome Atlas (TCGA, https://portal.gdc.cancer.gov/). Target miRNA and mRNA were selected through differential analysis. The target genes which had binding sites on the miRNA were predicted based on TargetScan (http://www.targetscan.org/vert_72/), mirDIP (http://ophid.utoronto.ca/mirDIP/index_confirm.jsp), miRWalk (http://mirwalk.umm.uni-heidelberg.de/). A Venn diagram based on the above sets created an intersected set. By performing Pearson correlation analysis on the intersected set and miRNA, ARHGAP11A was selected for its highest correlation coefficient with the miRNA. Gene set enrichment analysis (GSEA) software was adopted for target mRNA. The Kaplan–Meier survival curves based on miRNAs were predicted via TCGA database.

Cell culture

Cell cultivation was as previously described [19]. Human gastric mucosal cells GES1 (BNCC337970), GA cells AGS (BNCC352001), and HGC-27 (BNCC338546) were procured from BeNa Culture Collection. The above cells were placed in Roswell Park Memorial Institute (RPMI) −1640 medium (ATCC, USA) with 10% fetal bovine serum (FBS, Thermo Fisher Scientific, USA) in an incubator (Thermo Fisher Scientific, USA) with 5% CO2 at 37°C.

Cell transfection

The miR-30c-2-3p mimic was acquired from Shanghai GenePharma Co Ltd, China. cDNA of ARHGAP11A was introduced into pcDNA3.1 (Honor Gene, China) to generate the ARHGAP11A-overexpressed plasmid (oe-ARH). 30 nM miR-30c-2-3p mimic and its negative control (NC), as well as 1 μg over-expressed plasmid and blank plasmid were transfected into GA cell lines. Transfection was done with Lipofectamine 3000 transfection reagent (Invitrogen, USA) in accordance with instructions [20].

Flow cytometry

Cell cycle and apoptosis were revealed via a flow cytometer [21]. For cell cycle determination, 5 × 104 transfection GA cells were plated on 24-well plates at 37°C for 48 h. Subsequently, cells were put into 70% ethanol for fixation and into propidium iodide (BD Biosciences, USA) for staining. Apoptosis analyses were determined with Annexin V/propidium iodide (BD Biosciences, USA). Cell cycle and apoptosis were analyzed via flow cytometer BD FACSCanto II (BD Biosciences, USA).

Quantitative real-time polymerase chain reaction (qRT-PCR)

qRT-PCR was conducted as described earlier [1]. Total RNA in cells was isolated by Trizol reagent (Thermo Fisher Scientific, USA) and treated with DNAse. Thereafter, cDNA was extracted applying High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, USA). qPCR was conducted by a PCR amplifier of SYBRA Green PCR Master Mix (Takara, Japan) in QuantStudio 3 (Thermo Fisher Scientific, USA) (primers are displayed in Table 1). U6 and GAPDH were the internal references for miR-30c-2-3p and ARHGAP11A, respectively.

Table 1.

Primers of qRT-PCR.

Gene	Primer sequence (5’→ 3’)
miR-30c-2-3p	F:TCCTTTTACAGTTGACCTCAGAAAC
	R:GGCGAATATTTTGAAACCCTTTTGG
ARHGAP11A	F:GCCAAGCTCGGAAAAGAACG
	R:GCATCGACAAGAAAGCTTGGAA
U6	F:CTCGCTTCGGCAGCACA
	R:AACGCTTCACGAATTTGCGT
GAPDH	F:GAACGGGAAGCTCACTGG
	R:GCCTGCTTCACCACCTTCT

Western blot

Western blot analysis was introduced as described previously [22]. After transfection, the cells were lysed with radioimmunoprecipitation assay lysis buffer (Sigma, USA) and protein samples were harvested. After determining the protein concentration by BCA protein assay kit (Thermo Fisher Scientific, USA), we separated 20 μg of each protein sample on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and then moved proteins onto polyvinylidene fluoride membranes (Bio-Rad Laboratories, Inc, USA). After being sealed in 5% skim milk at room temperature for 1 h, membranes were cultivated with primary antibodies at 4°C overnight. Subsequently, membranes were cultured in secondary antibody (goat anti-rabbit IgG H&L and anti-mouse IgG HRP-linked antibodies; 1:500, Cell Signaling Technology). Primary antibodies: anti-ARHGAP11A (1:1000, PA5-101,840, Thermo Fisher Scientific), anti-vimentin (1:1000, 5741, Cell Signaling Technology), anti-N-cadherin (1:1000, 13,116, Cell Signaling Technology), anti-fibronectin (1:1000, 26,836, Cell Signaling Technology), anti-E-cadherin (1:1000, 3195, Cell Signaling Technology) and GAPDH (1:1000, 5174, Cell Signaling Technology). Finally, protein bands were analyzed via enhanced chemiluminescence detection kit (Biovision, USA) and exposure to chemiluminescent film. The band intensities were quantified by Image LabTM imaging software (BIO-RAD, USA).

Cell-Counting kit (CCK-8) assay

Cell proliferation was assessed hereby [23]. AGS and HGC-27 cells were transfected with miR-30c-2-3p mimic or NC, and then cells were plated onto 96-well plates (2 × 103 per well) and cultivated in the culture medium with 10 uL CCK-8 solution (MedChem Express, USA) at the 0, 1, 2, 3, and 4 d of cultivation. After every introduction, the system was incubated in an incubator at 37°C for 3 h. The optical density was tested by a microplate reader (Bio-Rad Laboratories, Inc, USA) at 450 nm.

Colony formation assay

Procedure of this assay was per previous description [24]. After transfection-AGS or transfection-HGC-27 cells plated in 6-cm plates with 2 × 103 cells per well, and then cultivated with 10% FBS-supplemented RPMI-1640 at 37°C for 2 weeks. Cell transfection with miR-30c-2-3p mimic or NC was then rinsed by PBS. During the cloning period, the medium was replaced every three days. Following fixing with ethanol for 15 min, cells were stained for 20 min with crystal violet, followed by imaging and calculation.

Transwell assay

This assay was the tool for assessment of cell migration and invasion [23]. Briefly, for invasion assay, the transfected AGS and HGC-27 cells (1 × 105 per well) were resuspended in medium without serum and seeded on the upper counterpart, which was coated with a growth factor reduced Matrigel. The culture medium with 10% FBS (Thermo Fisher Scientific, USA) was introduced to the lower chamber. After being cultivated at 37°C for 24 h, the cell fixation and staining were in 4% paraformaldehyde and 0.1% crystal violet, respectively. Imaging was visualized on a microscope (XDS-800D, Shanghai Caikon Optical Instrument Co., Ltd., China) and analyzed using ImageJ software. For migration assay, the upper chamber was free from Matrigel, and the remaining steps were similar with invasion assay.

Dual-luciferase assay

Dual-luciferase reporter assay was done per instruction from the manufacturer [25]. 3’ UTR of both wild (wt) and mutant (mut) ARHGAP11A was introduced into the pMiR-Reporter vector (Addgene, USA) to generate reporter plasmids. AGS cells were then plated on 96-well plates for co-transfection with reporter plasmids and miR-30c-2-3p mimic or NC mimic for 24 h. After 48 h, cells were lysed. Finally, the renilla luciferase activity was tested by luciferase activity assay kit (Promega, USA).

Data analysis

All the assays herein were repeated three times independently with three replicates each time. Analyzed and plotted by GraphPad Prism 8.0 software (GraphPad Software, Inc., USA), all data in the figures were presented in the form of mean ± standard deviation. Pearson’s correlation analysis was applied to examine the expression relationship between miR-30c-2-3p and ARHGAP11A in GA patients. Survival analysis was conducted by Kaplan–Meier method. Student’s t-tests were introduced to evaluate two-group difference. While differences among groups were performed via one-way analysis of variance followed by Tukey post hoc tests. P-values represented the significance of differences, with * corresponding to their significance level. * P < 0.05.

Results

Herein, to comprehensively reveal the mechanism where miR-30c-2-3p affected GA, we determined its expression and the way it affected cell function in GA. As the results implied, miR-30c-2-3p was remarkably underexpressed in GA tumor tissue and cells. Further, miR-30c-2-3p repressed progression, cell cycle transition, while facilitated apoptosis of GA cells. Besides, as implied by dual-luciferase assay, ARHGA11A was a target of miR-30c-2-3p, which repressed EMT process as well as malignant progression of GA cells via ARHGA11A and served as a new target offered for GA treatment.

MiR-30c-2-3p expression status in GA tissue/cells

Down-regulated miR-30c-2-3p was found in BC and liver cancer [26,27]. It was also a part of reason why we selected it for further evaluation. We detected a relative low miR-30c-2-3p level in GA tissue (Figure 1(a)). MiR-30c-2-3p was strikingly less expressed in both two GA cell lines relevant to normal gastric mucosal cell GES1 (Figure 1(b)). In addition, we also performed clinicopathological characteristics and Kaplan–Meier survival curve analysis of miR-30c-2-3p level (Supplementary Figure 1). As results suggested, miR-30c-2-3p was less expressed in GA.

Figure 1.

MiR-30c-2-3p expression is low in GA tissue/cells. a: On the basis of TCGA database, miR-30c-2-3p level in GA tissue and normal tissue. b: MiR-30c-2-3p level in GA cell lines and normal cell line.

Effects of miR-30c-2-3p on proliferation, colony formation, apoptosis, migration, and invasion of GA cells

First, we transfected miR-30c-2-3p to construct a corresponding experimental group (mimic), and transfection efficiency was assayed through qRT-PCR (Figure 2(a)). Next, CCK-8 and colony formation assays illustrated that cell proliferation and colony formation were remarkably abated in miR-20c-2-3p mimic group in contrast to the control group (Figure 2(b-c)). To confirm that miR-30c-2-3p affected apoptosis, flow cytometry was conducted. The result proved that apoptotic GA cells increased with the presence of over-expressed miR-30c-2-3p, indicating that miR-30c-2-3p stimulation facilitated cancer cell apoptosis (Figure 2(d)). Finally, the cell motility was evaluated through transwell migration and invasion assays. Over-expressed miR-30c-2-3p remarkably down-regulated migratory and invasive abilities of GA cells (Figure 2(e)). Cell cycle experiments further indicated that over-expressed miR-30c-2-3p prevented cell proliferation through inducing G0/G1 arrest in GA cells (figure 2(f)). Based on analysis above, miR-30c-2-3p repressed malignant progression and facilitated cell apoptosis of GA cells.

Figure 2.

MiR-30c-2-3p suppresses GA cell malignant progression, and promotes apoptosis. a: Overexpression efficiency of miR-30c-2-3p in GA cells. b-c: The impacts of over-expressed miR-30c-2-3p on AGS and HGC-27 cell proliferation. d: The apoptosis rate of GA cells transfected with over-expressed miR-30c-2-3p or NC vectors. e: Migration and invasion of GA cells transfected with over-expressed miR-30c-2-3p or NC vectors (magnification: 100×). f: Cell cycle distribution of AGD and HGC-27 cells following transfection of miR-30c-2-3p mimic or NC. * P < 0.05.

MiR-30c-2-3p targets ARHGAP11A in GA cells

Targets of miR-30c-2-3p were predicted based on TargetScan, mirDIP, miRWalk databases. The predicted genes were overlapped with 1,486 up-regulated differentially expressed mRNAs (DEmRNAs) and 13 DEmRNAs that had binding sites on miR-30c-2-3p were acquired (Figure 3(a)). MiR-30c-2-3p and these 13 mRNAs were subject to Pearson correlation analysis. The highest correlation coefficient lay in ARHGAP11A and miR-30c-2-3p and they were negatively correlated (Figure 3(b)). ARHGAP11A was speculated as targeted by miR-30c-2-3p. ARHGAP11A level was prominently higher in GA tissue over normal tissue (Figure 3(c)). Further, ARHGAP11A level was strikingly higher in GA cell lines (AGS and HGC-27) in comparison with normal gastric mucosal cells (GES 1) (Figure 3(d)). The binding sites were predicted on Targetscan website, suggesting that miR-30c-2-3p may bind to ARHGAP11A (Figure 3(e)). To check the above prediction results, we carried out dual-luciferase assay. The results supported that over-expressed miR-30c-2-3p only lowered the wt luciferase intensity (figure 3(f)), indicating a direct targeting relationship of ARHGAP11A and miR-30c-2-3p. Subsequently, qRT-PCR and western blot detections unveiled a reduced ARHGAP11A mRNA and protein expression by over-expressed miR-30c-2-3p (Figure 3(g-h)). On the basis of the above results, we inferred that miR-30c-2-3p down-regulated ARHGAP11A level in GA cells.

Figure 3.

MiR-30c-2-3p down-regulates ARHGAP11A level. a: Venn diagram based on the predicted target genes of miR-30c-2-3p. b: Correlation of miR-30c-2-3p and DEmRNAs were analyzed via Pearson correlation analysis. c: ARHGAP11A levels in normal tissue and GA tissue. d: MiR-30c-2-3p expression in GA cell lines. e: Binding sites of miR-30c-2-3p on ARHGAP11A. f: AGS cell luciferase intensity of in different transfection groups. g: The over-expressed miR-30c-2-3p affected mRNA and (h) protein expression of ARHGAP11A. * P < 0.05.

MiR-30c-2-3p targets ARHGAP11A to repress the malignant phenotypes of GA cells

We designed following rescue experiments by dividing the following groups according to cell transfection: miR-30c-2-3p mimic+pcDNA3.1 as the mimic group, ARHGAP11A-pcDNA3.1 as the oe-ARH group, miR-30c-2-3p mimic+ARHGAP11A-pcDNA3.1 as the mimic+oe-ARH group. The transfection efficiency of ARHGAP11A was examined through qRT-PCR. Over-expressed miR-30c-2-3p was revealed to partly offset the increased cell proliferation and colony-forming abilities induced by over-expressed ARHGAP11A (Figure 4(a-c)). At the same time, cell function experiments indicated that such enhancement of invasion and migration in the NC+oe-ARH group was inhibited in the mimic+oe-ARH group (Figure 4(d-e)). To confirm how the miR-30c-2-3p/ARHGAP11A axis affected the apoptosis in GA cells, we detected the cell apoptosis via flow cytometry (Figure 4(f)). The proportion of apoptotic cells was revealed to be markedly grown in the mimic group, and down-regulated in the oe-ARH group. The pool of apoptotic cells was expanded in mimic+oe-ARH group in comparison with oe-ARH group, indicating that the pro-apoptotic effect caused by miR-30c-2-3p was inhibited via ARHGAP11A, and this miRNA could partly restore the apoptosis which was originally inhibited by the over-expressed ARHGAP11A. Further, over-expressed ARHGAP11A remarkably repressed the G0/G1 phase cycle arrest in contrast to NC group, while miR-30c-2-3p mimic partially restored cell cycle arrest repressed by the over-expressed ARHGAP11A (Figure 4(g)). ARHGAP11A is over-expressed in different tumor tissue and correlates with tumor malignant progression [10,28]. We therefore reasonably speculated that ARHGAP11A could similarly affect the EMT process in GA cells. Western blot unveiled EMT-related protein levels (Figure 4(h)). We concluded that miR-30c-2-3p hampered the EMT process, while ARHGAP11A could reverse the above effect. Taken together, miR-30c-2-3p abated the malignant progression of GA via mediating ARHGAP11A.

Figure 4.

MiR-30c-2-3p represses malignant progression of GA via modulating ARHGAP11A. a: The transfection effects of over-expressed ARHGAP11A. b-c: Impact of the co-transfection of miR-30c-2-3p and ARHGAP11A on AGS cell proliferation. d-e: Motility of GA cells with over-expressed miR-30c-2-3p and ARHGAP11A (magnification: 100×). f: The apoptosis rate of AGS cells with over-expressed miR-30c-2-3p or ARHGAP11A vector. g: Cell cycle distribution of AGD and HGC-27 cells following transfection of over-expressed miR-30c-2-3p and ARHGAP11A. h: EMT-related proteins in AGS cells with over-expressed miR-30c-2-3p or ARHGAP11A. * P < 0.05, # P < 0.05.

Discussion

This study suggested low-level miR-30c-2-3p in GA, which repressed GA cell progression and accelerated apoptosis. We further unveiled that miR-30c-2-3p negatively controlled ARHGAP11A level, and inhibited the malignant progression of GA cells.

GA has high morbidity and mortality in China [1]. The quick development and early metastasis of tumor cells implicated in unfavorable prognosis of GA patients [29]. As an important type of intracellular signaling molecule, changes in Rho GTP/GDP can cause changes in cell migration, division, proliferation, and survival [30]. Herein, we found that as a part of the Rho GTPases family, ARHGAP9 is downregulated in lung cancer and is linked to poor prognosis [31]. Via this study, we found ARHGAP11A was up-regulated in GA cells, and impelled proliferation, invasion and cell cycle transition and inhibited apoptosis of GA cells. Guan et al [32]. reported that ARHGAP11A could facilitate GC cell migration and invasion via TPM1. Some articles stated that after DNA is damaged in glioma, and ARHGAP11A gathers in the nucleus and interacts with p53, thus inducing apoptosis and cell cycle arrest, which suppressing cancer progression [33]. In basal BC cells, ARHGAP11A is highly expressed and involved in p27-mediated cell cycle regulation, thus inducing cancer progression [9]. Nevertheless, the reason for these different results may be related to the different Rho GTPases families studied as well as the types of cancer. Based on our results, it is believed that ARHGAP11A is a likely target for GA therapy.

Herein, miR-30c-2-3p reduction was first identified in GA tissue and cells through bioinformatics analysis and gene expression detection. Cell experiments indicated that over-expressed miR-30c-2-3p attenuated cell growth while promoted apoptosis. Further, the prediction combined with dual-luciferase assay confirmed that ARHGAP11A was the targeted site of miR-30c-2-3p. Rescue assay revealed that over-expressed miR-30c-2-3p attenuated the above-mentioned phenomena of over-expressed ARHGAP11A on GA cells. We inferred that miR-30c-2-3p directly and negatively regulated ARHGAP11A in GA. EMT is a key process in which tumors acquire malignant phenotypes. Tumor cells acquire mesenchymal phenotype through EMT as well as the abilities including invasion, metastasis, and anti-apoptosis to make themselves involved in tumor progression [34]. EMT assay further illustrated miR-30c-2-3p functions in GA cells. Our research progress provides evidence for supporting miR-30c-2-3p/ARHGAP11A axis in GA.

Conclusion

In conclusion, miR-30c-2-3p manipulated EMT process and progression of GA cells by interacting with ARHGAP11A. Nevertheless, a more specific mechanism where miR-30c-2-3p regulated ARHGAP11A and signaling pathways involved in EMT need further studies. So far, the common GA markers in clinical practice mainly include ca199 and ca50. This study stated that over-expressed ARHGAP11A markedly enhanced GA progression. We intend to supplement the clinical experiments and detect ARHGAP11A level to analyze whether it can be a potential GA marker.

Click here for additional data file.