Literature DB >> 35749304

Baicalein inhibits macrophage lipid accumulation and inflammatory response by activating the PPARγ/LXRα pathway.

Zi-Zhen Zhang1, Xiao-Hua Yu2, Wei-Hua Tan3.   

Abstract

Lipid accumulation and inflammatory response are two major risk factors for atherosclerosis. Baicalein, a phenolic flavonoid widely used in East Asian countries, possesses a potential atheroprotective activity. However, the underlying mechanisms remain elusive. This study was performed to explore the impact of baicalein on lipid accumulation and inflammatory response in THP-1 macrophage-derived foam cells. Our results showed that baicalein up-regulated the expression of ATP binding cassette transporter A1 (ABCA1), ABCG1, liver X receptor α (LXRα), and peroxisome proliferator-activated receptor γ (PPARγ), promoted cholesterol efflux, and inhibited lipid accumulation. Administration of baicalein also reduced the expression and secretion of TNF-α, IL-1β, and IL-6. Knockdown of LXRα or PPARγ with siRNAs abrogated the effects of baicalein on ABCA1 and ABCG1 expression, cholesterol efflux, lipid accumulation as well as pro-inflammatory cytokine release. In summary, these findings suggest that baicalein exerts a beneficial effect on macrophage lipid accumulation and inflammatory response by activating the PPARγ/LXRα signaling pathway.
© The Author(s) 2022. Published by Oxford University Press on behalf of the British Society for Immunology.

Entities:  

Keywords:  LXRα; PPARγ; baicalein; inflammatory response; lipid accumulation

Mesh:

Substances:

Year:  2022        PMID: 35749304      PMCID: PMC9521661          DOI: 10.1093/cei/uxac062

Source DB:  PubMed          Journal:  Clin Exp Immunol        ISSN: 0009-9104            Impact factor:   5.732


Introduction

Atherosclerosis is a lipid-driven inflammatory disease and constitutes the pathological basis of coronary artery disease and cerebrovascular disease. As the most abundant immune cell type in atherosclerotic lesions, macrophages play a critical role throughout all stages of this disease, from lesion formation to plaque rupture. After accumulating large amounts of lipids, macrophages become foam cells, a hallmark of early-stage atherosclerotic lesions [1]. ATP binding cassette transporter A1 (ABCA1) and G1 (ABCG1) belong to transmembrane proteins and their major function is to mediate intracellular cholesterol efflux. Previous studies from our group and others have demonstrated that promoting ABCA1- and ABCG1-dependent cholesterol release inhibits lipid accumulation in THP-1 macrophages and reduces atherosclerotic lesion area in apolipoprotein E-deficient (apoE−/−) mice [2-4]. Interestingly, macrophage foam cells can also generate multiple pro-inflammatory cytokines, such as tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, and IL-6. The release of these inflammatory mediators not only further exacerbates lipid accumulation but also contributes to the expansion of the necrotic core [5, 6]. Despite the use of statins has considerably improved the clinical outcomes of hyperlipidemia patients, the residual risk is still higher due to the unsolved inflammation [7, 8]. Thus, seeking novel drugs with anti-inflammatory and lipid-lowering effects is of critical importance to effectively prevent and treat atherosclerotic cardiovascular disease. Baicalein (5,6,7-trihydroxyflavone, Fig. 1A) is a major flavonoid extracted from the root of Scutellaria baicalensis Georgi, a medicinal plant traditionally used in oriental medicine. This compound has a variety of pharmacological activities, including anti-inflammation, anti-oxidative stress, and anti-infection [9-11]. Administration of baicalein has been shown to protect against acute ischemia/reperfusion injury, hypertension, heart failure, and myocardial infarction in animal models [12-15]. Recently, Chan et al. reported that baicalein ameliorates oxidized low-density lipoprotein (ox-LDL)-induced endothelial dysfunction by inhibiting the inflammatory response and cell apoptosis [16]. In addition, baicalein treatment markedly suppresses the proliferation of vascular smooth muscle cells (VSMCs), a critical event during atherogenesis [17]. These findings suggest that baicalein may exert an atheroprotective role. However, the molecular mechanisms for its anti-atherogenic action remain largely unknown.
Figure 1

effects of baicalein on cell viability and intracellular lipid accumulation. (A) Chemical structure of baicalein. (B) THP-1 macrophage-derived foam cells were treated with the indicated concentrations of baicalein for 24 h or with 100 μM baicalein for various times. MTT assay was employed to evaluate cell viability. (C–D) THP-1 macrophage-derived foam cells were incubated with PBS or 100 μM baicalein for 24 h. (C) The cells were fixed and then stained with Oil Red O to assay intracellular lipid deposition. The magnification of each panel is 200×. (D) Intracellular TC, FC, and CE amounts were detected by HPLC. Data are expressed as mean ± SD from three independent experiments. *P < 0.05 vs 0 μM or 0 h groups.

effects of baicalein on cell viability and intracellular lipid accumulation. (A) Chemical structure of baicalein. (B) THP-1 macrophage-derived foam cells were treated with the indicated concentrations of baicalein for 24 h or with 100 μM baicalein for various times. MTT assay was employed to evaluate cell viability. (C–D) THP-1 macrophage-derived foam cells were incubated with PBS or 100 μM baicalein for 24 h. (C) The cells were fixed and then stained with Oil Red O to assay intracellular lipid deposition. The magnification of each panel is 200×. (D) Intracellular TC, FC, and CE amounts were detected by HPLC. Data are expressed as mean ± SD from three independent experiments. *P < 0.05 vs 0 μM or 0 h groups. Peroxisome proliferator-activated receptor γ (PPARγ) and liver X receptor α (LXRα) belong to the members of the nuclear receptor superfamily. LXRα interacts with retinoid X receptor to form an obligate heterodimer that can recognize LXR response elements in the ABCA1 and ABCG1 promoter region to stimulate gene transcription [18]. There is increasing evidence that activation of the PPARγ/LXRα signaling pathway mitigates lipid accumulation in THP-1 macrophages and protects against atherosclerosis in apoE−/− mice by up-regulating ABCA1 and ABCG1 expression [19-21]. Of note, activation of this pathway can also inhibit the production and secretion of pro-inflammatory cytokines [22, 23]. Several lines of evidence have demonstrated that baicalein serves as an activator of PPARγ in human colon cancer cells [24] and hepatic stellate cells [25]. It is still unclear, however, whether baicalein can activate the PPARγ/LXRα pathway to increase ABCA1 and ABCG1 expression and antagonize inflammatory response in macrophages. The present study aimed to observe the influence of baicalein on macrophage lipid accumulation and inflammatory response and to explore the underlying mechanisms. We found that baicalein enhanced ABCA1- and ABCG1-dependent cholesterol efflux and reduced pro-inflammatory cytokine secretion from THP-1 macrophage-derived foam cells by activating the PPARγ/LXRα pathway.

Materials and methods

Reagents and antibodies

Baicalein (HPLC>98%) was purchased from Sigma–Aldrich (St. Louis, MO, USA), solved in dimethyl sulfoxide (DMSO), and then stored at −20°C in the dark. Ox-LDL and dil dye-labeled ox-LDL (Dil-ox-LDL) were provided by Yiyuan Biotechnologies (Guangzhou, China). Rabbit antibodies against ABCA1, ABCG1, CD36, LXRα, and PPARγ, β-actin, and histone H3 are the products of Abcam (Cambridge, UK). Mouse antibody against scavenger receptor class A (SR-A; R&D systems), and horseradish peroxidase (HRP)-conjugated goat anti-rabbit or mouse IgG (Proteintech Group, Chicago, IL, USA) were obtained as indicated.

Cell culture

THP-1 monocytes (Cell Bank of Chinese Academy of Science, Shanghai, China) were cultured in RPMI 1640 medium (Sigma–Aldrich) containing 10% fetal bovine serum (Sigma–Aldrich) and 2% penicillin–streptomycin in a humidified atmosphere of 5% CO2 at 37°C. After 24 h of incubation with 160 nM phorbol-12-myristate acetate (Sigma–Aldrich), THP-1 monocytes were differentiated into macrophages. Then, THP-1 macrophages were cultured in the fresh 10% FBS/RPMI 1640 medium for 12 h. To induce foam cell formation, THP-1 macrophages were treated with 50 μg/ml ox-LDL for 48 h in a serum-free medium.

Detection of cell viability

Cell viability was measured by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) method as previously described [26]. Briefly, THP-1 macrophage-derived foam cells were seeded in 96-well plates at a density of 2 × 106 cells/well. When the cells were 80% confluent, the cells were treated with various concentrations of baicalein (0, 25, 50, 100, or 200 μM) for 24 h or 100 μM baicalein for the indicated time (0, 6, 12, 24, or 48 h). Then, cells were incubated with 10 μl of 5 mg/ml MTT (Sigma–Aldrich) at 37°C for 4 h. The medium was carefully removed and 100 μL DMSO was added to each well to dissolve the formazan crystals. The absorbance was detected at 570 nm using a synergy H1 hybrid microplate reader (Winooski, VT, USA).

Oil Red O staining

THP-1 macrophage-derived foam cells were treated with phosphate-buffered saline (PBS) or 100 μM baicalein for 24 h. After washing with PBS, cells were fixed with 4% paraformaldehyde for 10 min. Subsequently, cells were stained with Oil Red O solution (Solarbio, Beijing, China) in the dark for 20 min, washed with 60% isopropanol for 10 s, and photographed using an inverted fluorescent microscope (Olympus, Tokyo, Japan).

High-performance liquid chromatography (HPLC) analysis

After the indicated treatments, THP-1 macrophage-derived foam cells were broken in 1 ml of 0.9% NaCl by an ultrasonic processor after washing. BCA Protein Assay Kit (Beyotime, Shanghai, China) was employed to detect the protein concentration of cell lysates. Cholesterol was extracted by n-hexane-isopropanol (3:2, V/V), dissolved in isopropanol (50 mg/ml), and stored at −20 °C. Meanwhile, cholesterol standard calibration solution ranging from 0 to 50 mg/ml was prepared. The reaction mixture containing MgCl2 (500 mM), Tris–HCl (500 mM, pH = 7.4), dithiothreitol (10 mM) and 5% NaCl, was added to 100 μl of cholesterol standard calibration solution and cell solution. Then, 0.4 U cholesterol oxidase was supplemented to detect free cholesterol (FC) content, and 0.4 U cholesterol oxidase combined with 0.4 U cholesterol esterase (CE) was supplemented for measurement of total cholesterol (TC) amount. After incubating at 37°C for 30 min, the reaction was terminated, and the supernatant was collected to measure the absorbance at 216 nm. CE was estimated by subtracting FC from TC. Data were analyzed using Total Chrom software (Perkin Elmer, Waltham, MA, USA).

Transfection of small interfering RNAs (siRNAs)

LXRα siRNA (forward, 5ʹ-GGCUGCAAGUGGAAUUCAUTT-3ʹ; reverse, 5ʹ-AUGAAUUC CACUUGCAGCCTT-3ʹ), PPARγ siRNA (forward, 5ʹ-GGAUGCAAGGGUUUCUUCCTT-3ʹ; reverse, 5ʹ-GGAAGAAACCCUUGCAUCCTT-3ʹ), and scrambled siRNA as negative control (forward, 5ʹ-UUCUCCGAACGUGUCACGUTT-3ʹ; reverse, 5ʹ-ACGUGACACGUUCGGAGAA TT-3’) were designed and synthesized by GenePharma (Shanghai, China). The siRNAs (40 nM) were transfected into THP-1 macrophage-derived foam cells (2 × 106 cells/well) using lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. After 48 h, transfection efficiency was measured by western blot.

Detection of intracellular cholesterol efflux

Cholesterol efflux was determined as described elsewhere [27]. In brief, THP-1 macrophage-derived foam cells were incubated with PBS or 100 μM baicalein for 24 h and then labelled with 5 µCi/ml [3H]-cholesterol for an additional 24 h. Cells were washed three times with PBS, followed by incubation with serum-free RPMI 1640 medium for 2 h at 37°C. Serum-free medium was removed, and cells were cultured in 2 ml of RPMI 1640 medium containing 20 μg/ml apoA-I (Sigma-Aldrich) or 50 μg/ml HDL (Sigma–Aldrich) overnight. The radioactivity of [3H]-cholesterol in the medium and cells was detected using a liquid scintillation counter, respectively. The percent cholesterol efflux was calculated as the ratio of radioactivity in the medium to total radioactivity (medium + cells).

Dil-ox-LDL uptake assay

For visualization of ox-LDL uptake, THP-1 macrophage-derived foam cells were treated with PBS or 100 μM baicalein for 24 h and then incubated with 10 μg/ml Dil-ox-LDL for 4 h at 37°C. After washing three times with PBS, cells were viewed and imaged by an inverted fluorescence microscopy. Fluorescence intensity was detected using Image Pro Plus software (Diagnostic Instruments, USA).

Enzyme-linked immunosorbent assay (ELISA)

At the end of treatment, a cell culture supernatant was collected to detect IL-1β, IL-6, and TNF-α amounts using the commercial ELISA kits (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions. The absorbance at 450 nm was determined by the iMark™ microplate reader (Bio-Rad, Hercules, CA, USA).

RNA isolation and quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from THP-1 macrophage-derived foam cells using TRIzol reagent (Invitrogen). RNA (500 ng) from each sample was reverse-transcribed into cDNA using a high-capacity cDNA reverse transcription kit (Takara, Kyoto, Japan). Then, qRT-PCR was performed using SYBR Green Real-Time PCR Master Mix (Promega) and the Mx3005P system (Agilent Technologies, US). The samples were incubated at 95°C for 10 min, followed by 40 cycles under the following conditions: 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s. The primers for qRT-PCR were synthesized by Sangon Biotech (Shanghai, China), and their sequences are presented in Table 1. The 2−ΔΔCt method was used to analyze the relative expression levels of target genes, with GAPDH as an internal control.
Table 1

primer sequences for qRT-PCR

GenesSequences (5ʹ-3ʹ)
ABCA1ACCCACCCTAT GAACAACATGA (forward)
GAGTCGGGTAACGGAAACAGG (reverse)
ABCG1ATTCAGGG ACCTTTCCTATTCGG (forward)
CTCACCACTATTGAACTTCCCG (reverse)
CD36AAGCCAG GTATTGCAGTTCTTT (forward)
GCATTTGCTGATGT CTAGCAC A (reverse)
SR-AGCAGTG GGATCACTTTCACAA (forward)
AGCTGTCATTGAGCGAGCA TC (reverse)
LXRαCCTTCAG AACCCACAGAGATCC (forward)
ACGCTGCATAGCTCGTT CC (reverse)
PPARγTGGAATTAGATG ACAGCGACTTGG (forward)
CTGGAGCAGCTTGGCAAACA (reverse)
TNF-αCTCTTCTGCCTGCTGCACTTTG (forward)
ATGGGCTACAGGCTTGTCACTC (reverse)
IL-1βCCACAGACCTTCCAGGAGAATG (forward)
GTGCAGTTCAGTGATCGTACAGG (reverse)
IL-6AGACAGCCACTCACCTCTTCAG (forward)
TTCTGCCAGTGCCTCTTTGCTG (reverse)
GAPDHTGTGGGCATC AATGGATTTGG (forward)
ACACCATGTATTCCGG GTCAAT (reverse)
primer sequences for qRT-PCR

Protein extraction and western blot

After the indicated treatments, cells were harvested and then lysed by the RIPA buffer (Beyotime) containing 0.1 mmol/l PMSF on ice for 30 min to extract total proteins. The cytoplasmic and nuclear proteins were extracted by the corresponding protein extraction kits (Beyotime). After centrifugation, the supernatant was collected and protein concentrations were determined using BCA Protein Assay Kit (Beyotime). Protein samples (20 µg/well) were subjected to SDS-PAGE and then transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA). After blocking with 5% skim milk for 2 h, PVDF membranes were incubated with antibodies against ABCA1 (ab7360, 1:200), ABCG1 (ab52617, 1:1000), CD36 (ab133625, 1:500), SR-A (AF1797, 1:1000), LXRα (ab176323, 1:2000), PPARγ (ab178860, 1:500), β-actin (ab115777, 1:3000), or histone H3 (ab176842, 1:3000) overnight at 4°C. The membranes were washed and further incubated with HRP-conjugated goat anti-rabbit IgG (SA00001-2, 1:5000) or mouse IgG (SA00001-1, 1:5000) at room temperature for 2 h. The protein bands were visualized with the BeyoECL Plus kit (Beyotime) and quantified using Gel-Pro software (version 4.0). β-actin was used as an internal control.

Statistical analysis

All data are expressed as the mean ± SD from three independent experiments and analyzed by GraphPad Prism 8.0 software. An unpaired two-tailed Student’s t-test was used to compare the differences between the two groups. Multiple comparisons were made among ≥ three groups using one-way ANOVA followed by the Bonferroni post hoc test. A P value less than 0.05 was considered statistically significant.

Results

Baicalein inhibits lipid accumulation in THP-1 macrophage-derived foam cells

To determine the effects of baicalein on cell viability, THP-1 macrophage-derived foam cells were exposed to various concentrations of baicalein (0, 25, 50, 100, or 200 μM) for 24 h or 100 μM baicalein for the indicated time (0, 6, 12, 24, or 48 h). The MTT results showed that there was no cytotoxicity when cells were treated with 25–100 μM baicalein for 6–24 h (Fig. 1B). We thus selected 100 μM baicalein to treat cells for 24 h in the subsequent experiments. By using Oil Red O staining, we found that lipid droplets were smaller and fewer in the baicalein group compared with the control group (Fig. 1C). Consistently, administration of baicalein markedly reduced intracellular TC, FC, and CE amounts (Fig. 1D). These data suggest that baicalein exerts an inhibitory effect on macrophage lipid accumulation.

Baicalein up-regulates ABCA1 and ABCG1 expression and promotes cholesterol efflux in THP-1 macrophage-derived foam cells

Decreased cholesterol efflux mediated by ABCA1 and ABCG1 is a major cause leading to macrophage lipid accumulation. To reveal the underlying mechanism by which baicalein protects against lipid accumulation, we examined the effects of baicalein on these two transporter expressions and cholesterol efflux. The qRT-PCR and western blot results demonstrated that treatment with baicalein dramatically enhanced the mRNA and protein levels of ABCA1 and ABCG1 in THP-1 macrophage-derived foam cells (Fig. 2A). Moreover, baicalein up-regulated the protein expression of ABCA1 and ABCG1 in a time- and concentration-dependent manner (Supplementary Fig. 1A and B). Accordingly, the efficiency of cholesterol efflux to apoA-I and HDL was significantly increased in response to baicalein (Fig. 2B). CD36- and SR-A-mediated cholesterol influx also contributes to intracellular lipid deposition [28]. However, administration of baicalein had no influence on CD36 and SR-A expression (Fig. 2C) as well as Dil-ox-LDL uptake (Fig. 2D). To summarize, promoting ABCA1- and ABCG1-dependent cholesterol efflux is necessary for baicalein-induced prevention of macrophage lipid accumulation.
Figure 2

Baicalein facilitates ABCA1- and ABCG1-dependent cholesterol efflux. (A–D) THP-1 macrophage-derived foam cells were exposed to PBS or 100 μM baicalein for 24 h. (A) The mRNA and protein levels of ABCA1 and ABCG1 were determined by qRT-PCR and western blot, respectively. (B) Cholesterol efflux to apoA-I and HDL was analyzed by the liquid scintillation counting method. (C) Detection of CD36 and SR-A expression using qRT-PCR and western blot. (D) Representative fluorescent images of Dil-ox-LDL uptake. The magnification of each panel is 200×. All data are presented as the mean ± SD from three independent experiments. **P < 0.01 vs. control group.

Baicalein facilitates ABCA1- and ABCG1-dependent cholesterol efflux. (A–D) THP-1 macrophage-derived foam cells were exposed to PBS or 100 μM baicalein for 24 h. (A) The mRNA and protein levels of ABCA1 and ABCG1 were determined by qRT-PCR and western blot, respectively. (B) Cholesterol efflux to apoA-I and HDL was analyzed by the liquid scintillation counting method. (C) Detection of CD36 and SR-A expression using qRT-PCR and western blot. (D) Representative fluorescent images of Dil-ox-LDL uptake. The magnification of each panel is 200×. All data are presented as the mean ± SD from three independent experiments. **P < 0.01 vs. control group.

LXRα is involved in baicalein-induced enhancement of ABCA1 and ABCG1 expression

LXRα is known to play a key role in stimulating ABCA1 and ABCG1 transcription. To determine whether baicalein-induced up-regulation of ABCA1 and ABCG1 expression is mediated by LXRα, we first measured the expression of LXRα in THP-1 macrophage-derived foam cells treated with baicalein using qRT-PCR and western blot. As expected, baicalein dramatically augmented the mRNA and protein levels of LXRα (Fig. 3A). Further, baicalein time- and concentration-dependently increased LXRα protein expression (Supplementary Fig. 1A and B). We then used siRNA to silence the endogenous expression of LXRα in THP-1 macrophage-derived foam cells. In comparison with the control group, the LXRα protein levels were inhibited by 72% in the LXRα siRNA group (Fig. 3B). In the presence of LXRα knockdown, baicalein partially restored ABCA1 and ABCG1 expression (Fig. 3C and D) as well as cholesterol efflux (Fig. 3E). The decrease in intracellular TC, FC, and CE levels by baicalein was suppressed by pretreatment with LXRα siRNA (Supplementary Fig. 2A). These findings suggest that baicalein increases ABCA1 and ABCG1 expressions, promotes cholesterol efflux, and inhibits macrophage lipid accumulation in an LXRα-dependent manner.
Figure 3

involvement of LXRα in the induction of ABCA1 and ABCG1 expression by baicalein. (A) THP-1 macrophage-derived foam cells were incubated with PBS or 100 μM baicalein for 24 h, followed by measurement of LXRα expression using qRT-PCR and western blot. (B–E) THP-1 macrophage-derived foam cells were transfected with scrambled siRNA or LXRα siRNA for 48 h and then incubated with or without 100 μM baicalein for 24 h. (B) Cell lysates were subjected to western blot analysis to assess the protein levels of LXRα. (C–D) The expression of ABCA1 and ABCG1 were evaluated using qRT-PCR and western blot. (E) Cholesterol efflux to apoA-I and HDL was detected by the liquid scintillation counting method. Data are expressed as mean ± SD from three independent experiments. **P < 0.01 vs control group; #P < 0.05, ##P < 0.01 vs baicalein group.

involvement of LXRα in the induction of ABCA1 and ABCG1 expression by baicalein. (A) THP-1 macrophage-derived foam cells were incubated with PBS or 100 μM baicalein for 24 h, followed by measurement of LXRα expression using qRT-PCR and western blot. (B–E) THP-1 macrophage-derived foam cells were transfected with scrambled siRNA or LXRα siRNA for 48 h and then incubated with or without 100 μM baicalein for 24 h. (B) Cell lysates were subjected to western blot analysis to assess the protein levels of LXRα. (C–D) The expression of ABCA1 and ABCG1 were evaluated using qRT-PCR and western blot. (E) Cholesterol efflux to apoA-I and HDL was detected by the liquid scintillation counting method. Data are expressed as mean ± SD from three independent experiments. **P < 0.01 vs control group; #P < 0.05, ##P < 0.01 vs baicalein group.

PPARγ is required for induction of LXRα, ABCA1, and ABCG1 expression by baicalein

PPARγ is an upstream effector of LXRα. Our results showed that baicalein treatment dramatically up-regulated the mRNA and protein expression of PPARγ in THP-1 macrophage-derived foam cells (Fig. 4A). Moreover, baicalein up-regulated PPARγ protein expression in a time- and concentration-dependent manner (Supplementary Fig. 1A and B). The nuclear translocation of PPARγ was also promoted by baicalein (Fig. 4B). We then transfected THP-1 macrophage-derived foam cells with PPARγ siRNA or scrambled siRNA and found that PPARγ siRNA treatment reduced PPARγ protein levels by 68% (Fig. 4C). This indicates that PPARγ siRNA can effectively silence endogenous PPARγ expression. Importantly, the expression LXRα, ABCA1, and ABCG1 and intracellular cholesterol export were partially restored when THP-1 macrophage-derived foam cells were treated with PPARγ siRNA and baicalein (Fig. 4D and E). Pretreatment with PPARγ siRNA also reduced the impact of baicalein on intracellular TC, FC, and CE contents (Supplementary Fig. 2B). Interestingly, the double knockdown of PPARγ and LXRα fully reversed baicalein-induced enhancement of cholesterol efflux from THP-1 macrophage-derived foam cells (Supplementary Fig. 3). These results suggest that baicalein increases LXRα, ABCA1, and ABCG1 levels, facilitates cholesterol efflux and inhibits macrophage lipid accumulation by up-regulating PPARγ expression.
Figure 4

involvement of PPARγ in the baicalein-induced enhancement of LXRα, ABCA1, and ABCG1 expression. (A–B) THP-1 macrophage-derived foam cells were treated with or without 100 μM baicalein for 24 h. (A) PPARγ expression was analyzed by qRT-PCR and western blot. (B) Western blot analysis of PPARγ levels in the cytoplasm and nucleus. (C–E) THP-1 macrophage-derived foam cells were transfected with scrambled siRNA or PPARγ siRNA for 48 h, followed by treatment with or without 100 μM baicalein for 24 h. (C) Detection of PPARγ protein expression using western blot. (D) The expression of LXRα, ABCA1, and ABCG1 was determined by qRT-PCR and western blot. (E) The liquid scintillation counting method was used to measure the efflux of cholesterol onto apoA-I and HDL. The results are shown as the mean ± SD from three independent experiments. **P < 0.01 vs. control group; #P < 0.05, ##P < 0.01 vs. baicalein group.

involvement of PPARγ in the baicalein-induced enhancement of LXRα, ABCA1, and ABCG1 expression. (A–B) THP-1 macrophage-derived foam cells were treated with or without 100 μM baicalein for 24 h. (A) PPARγ expression was analyzed by qRT-PCR and western blot. (B) Western blot analysis of PPARγ levels in the cytoplasm and nucleus. (C–E) THP-1 macrophage-derived foam cells were transfected with scrambled siRNA or PPARγ siRNA for 48 h, followed by treatment with or without 100 μM baicalein for 24 h. (C) Detection of PPARγ protein expression using western blot. (D) The expression of LXRα, ABCA1, and ABCG1 was determined by qRT-PCR and western blot. (E) The liquid scintillation counting method was used to measure the efflux of cholesterol onto apoA-I and HDL. The results are shown as the mean ± SD from three independent experiments. **P < 0.01 vs. control group; #P < 0.05, ##P < 0.01 vs. baicalein group.

Baicalein suppresses inflammatory response by activating the PPARγ/LXRα pathway in THP-1 macrophage-derived foam cells

Ox-LDL is also a stimulus of inflammation [29]. Activation of the PPARγ/LXRα pathway not only inhibits intracellular lipid accumulation but also alleviates inflammatory response. Given baicalein as an activator of this signaling cascade, we next tested its influence on pro-inflammatory cytokine production and secretion in THP-1 macrophage-derived foam cells. As shown in Fig. 5A, the mRNA expression of TNF-α, IL-1β, and IL-6 was significantly up-regulated in ox-LDL-challenged THP-1 macrophages compared with unstimulated cells, whereas this up-regulation was inhibited by baicalein treatment. Incubation with ox-LDL also dramatically increased the levels of TNF-α, IL-1β, and IL-6 in the cell culture supernatant, which was alleviated by baicalein (Fig. 5B). Importantly, pretreatment with siRNAs against LXRα or PPARγ significantly reversed the inhibitory effect of baicalein on the expression and secretion of these cytokines (Fig. 5C–F). These observations indicate that baicalein activates the PPARγ/LXRα pathway to antagonize inflammation.
Figure 5

Baicalein inhibits inflammatory response through the PPARγ/LXRα signaling pathway. (A–F) THP-1 macrophages were incubated with or without 50 μg/ml ox-LDL for 48 h, transfected with or without siRNAs against LXRα or PPARγ for 48 h, and then treated with 100 μM baicalein for 24 h. (A, C–E) The mRNA levels of TNF-α, IL-1β, and IL-6 were determined using qRT-PCR. (B, D–F) The cell culture supernatant was collected and then subjected to ELISA for detecting the levels of TNF-α, IL-1β, and IL-6. Data are the mean ± SD from three independent experiments. ***P < 0.001 vs. control group; ##P < 0.01 vs. ox-LDL group; &&P < 0.01 vs. ox-LDL + baicalein group.

Baicalein inhibits inflammatory response through the PPARγ/LXRα signaling pathway. (A–F) THP-1 macrophages were incubated with or without 50 μg/ml ox-LDL for 48 h, transfected with or without siRNAs against LXRα or PPARγ for 48 h, and then treated with 100 μM baicalein for 24 h. (A, C–E) The mRNA levels of TNF-α, IL-1β, and IL-6 were determined using qRT-PCR. (B, D–F) The cell culture supernatant was collected and then subjected to ELISA for detecting the levels of TNF-α, IL-1β, and IL-6. Data are the mean ± SD from three independent experiments. ***P < 0.001 vs. control group; ##P < 0.01 vs. ox-LDL group; &&P < 0.01 vs. ox-LDL + baicalein group.

Discussion

Atherosclerosis predominantly occurs in large- and medium-arteries. Lipid deposition in the subendothelial space is a major pathogenesis of atherosclerosis. Baicalein is a natural plant flavone originally isolated from the root of Scutellaria baicalensis Georgi, a kind of Chinese herbal medicine. Baicalein has been reported to improve endothelial dysfunction and antagonize VSMC proliferation [16, 17]. Nevertheless, very little is known about its impact on macrophage lipid accumulation. A recent study showed that treatment with baicalein inhibits intracellular lipid accumulation in 3T3-L1 preadipocytes [30]. Baicalein also diminishes TC levels in HepG2 cells [31]. Baicalin, also known as baicalein-7-glucuronide, was shown to restrain lipid deposition in macrophages [32]. Similarly, we found that administration of baicalein decreased intracellular cholesterol contents and the number of lipid droplets in THP-1 macrophage-derived foam cells. Thus, the prevention of macrophage lipid accumulation may be another important mechanism by which baicalein mitigates atherosclerosis. It is generally known that lipid accumulation is caused by increased cholesterol efflux and/or decreased cholesterol uptake. ABCA1 mediates the initial transport of intracellular cholesterol to lipid-poor/free apoA-I for generating nascent HDL particles, while ABCG1 promotes subsequently continued cholesterol efflux to these particles for further maturation [33]. ABCA1 and ABCG1 export intracellular cholesterol to extracellular acceptors in a synergistic manner [34, 35]. The combined deficiency of these two transporters facilitates foam cell formation and increases atherosclerotic lesion area in mice [36, 37]. CD36 and SR-A are responsible for the internalization of modified lipoproteins. Accumulating evidence has demonstrated that down-regulation of CD36 and SR-A expression alleviates lipid deposition in macrophages [38, 39]. In this study, our results showed that baicalein markedly elevated the mRNA and protein levels of ABCA1 and ABCG1, which was accompanied by increased cholesterol efflux to apoA-I and HDL in THP-1 macrophage-derived foam cells. However, baicalein had no effects on CD36 and SR-A expression and Dil-ox-LDL uptake. These findings provide clear evidence that baicalein inhibits macrophage lipid accumulation by promoting ABCA1- and ABCG1-dependent cholesterol efflux. LXRα plays a central role in stimulating the transcription of ABCA1 and ABCG1. PPARγ serves as an upstream molecule of LXRα. There is increasing evidence that inactivation of the PPARγ/LXRα pathway down-regulates ABCA1 and ABCG1 expression and attenuates cholesterol efflux in macrophages [40, 41]. The present study demonstrated that administration of baicalein enhanced PPARγ expression and its nuclear translocation in THP-1 macrophage-derived foam cells, in accordance with previous reports [24, 25]. However, Xu et al. reported that treatment with baicalein decreases PPARγ levels and maintains its cytoplasmic retention in a rat model of cerebral ischemia/reperfusion injury [42]. The regulatory effect of baicalein on PPARγ may be cell-specific, and future research is needed to determine what causes the conflicting findings. LXRα was also significantly up-regulated in response to baicalein. Importantly, the stimulatory effect of baicalein on ABCA1 and ABCG1 expression was reversed by siRNA-mediated knockdown of LXRα and PPARγ. Thus, activation of the PPARγ/LXRα signaling pathway is involved in baicalein-induced up-regulation of ABCA1 and ABCG1 expression. Atherosclerosis is not only a disorder of lipid metabolism dysregulation but also a chronic inflammatory disease [43]. It has been reported that baicalein suppresses inflammatory response in multiple cell types, including mesenchymal stem cells [44], nucleus pulposus cells [45], and pancreatic acinar cells [46]. In the current study, we found that the expression and secretion of IL-1β, IL-6, and TNF-α were significantly decreased in THP-1 macrophage-derived foam cells challenged with baicalein. This finding is consistent with a previous report showing that baicalein suppresses the release of IL-1β, IL-6, and TNF-α in lipopolysaccharide-stimulated RAW264.7 cells [47]. In addition to inhibition of lipid accumulation, the PPARγ/LXRα pathway is involved in the regulation of inflammatory response [22, 23]. Our results revealed that pretreatment with LXRα siRNA and PPARγ siRNA reduced the effects of baicalein on IL-1β, IL-6, and TNF-α expression and secretion, suggesting that this compound activates the PPARγ/LXRα pathway to restrain inflammatory response in THP-1 macrophage-derived foam cells. Several limitations should be considered in this study. On one hand, there is a lack of animal experiments to explore the influence of baicalein on ABCA1 and ABCG1 expression, reverse cholesterol transport efficiency, plasma lipid profile, and atherosclerotic lesion area. On the other hand, we do not clarify how baicalein up-regulates PPARγ expression. Several lines of evidence have identified PPARγ as a direct target of miR-27 [48, 49]. Baicalein serves as a regulator of many miRNAs [50, 51]. Thus, it is possible that baicalein indirectly regulates PPARγ expression through miR-27 or other miRNAs. Future studies are needed to confirm this possibility. In summary, our data reveal a favorable role of baicalein in macrophage lipid accumulation and inflammatory response. Mechanistically, baicalein activates the PPARγ/LXRα pathway to enhance ABCA1- and ABCG1-dependent cholesterol efflux and inhibit pro-inflammatory cytokine release. These findings extend our understanding for the anti-atherogenic action of baicalein, and further support the notion that baicalein may be a promising drug candidate for therapeutic intervention of atherosclerotic cardiovascular disease. Click here for additional data file. Click here for additional data file. Click here for additional data file.
  51 in total

Review 1.  Liver x receptors in atherosclerosis and inflammation.

Authors:  Seung-Soon Im; Timothy F Osborne
Journal:  Circ Res       Date:  2011-04-15       Impact factor: 17.367

2.  Baicalein Inhibits the IL-1β-Induced Inflammatory Response in Nucleus Pulposus Cells and Attenuates Disc Degeneration In vivo.

Authors:  Haiming Jin; Qingqing Wang; Jianwei Wu; Xuyao Han; Tianchen Qian; Zengjie Zhang; Jianle Wang; Xiangxiang Pan; Aimin Wu; Xiangyang Wang
Journal:  Inflammation       Date:  2019-06       Impact factor: 4.092

3.  Screening of six Ayurvedic medicinal plants for anti-obesity potential: An investigation on bioactive constituents from Oroxylum indicum (L.) Kurz bark.

Authors:  Priyanka Mangal; Pragyanshu Khare; Sneha Jagtap; Mahendra Bishnoi; Kanthi Kiran Kondepudi; Kamlesh Kumar Bhutani
Journal:  J Ethnopharmacol       Date:  2016-07-26       Impact factor: 4.360

4.  12/15-Lipoxygenase inhibitor baicalein suppresses PPAR gamma expression and nuclear translocation induced by cerebral ischemia/reperfusion.

Authors:  Yan-Wei Xu; Li Sun; Hao Liang; Guo-Min Sun; Yan Cheng
Journal:  Brain Res       Date:  2009-10-22       Impact factor: 3.252

5.  Atherogenic dyslipidemia and residual cardiovascular risk in statin-treated patients.

Authors:  Gaia Sirimarco; Julien Labreuche; Eric Bruckert; Larry B Goldstein; Kim M Fox; Peter M Rothwell; Pierre Amarenco
Journal:  Stroke       Date:  2014-04-15       Impact factor: 7.914

6.  Cardioprotective effects of baicalein on heart failure via modulation of Ca(2+) handling proteins in vivo and in vitro.

Authors:  Fali Zhao; Lu Fu; Wei Yang; Yuhui Dong; Jing Yang; Shoubin Sun; Yuling Hou
Journal:  Life Sci       Date:  2015-12-17       Impact factor: 5.037

7.  Anti-atherosclerotic potential of baicalin mediated by promoting cholesterol efflux from macrophages via the PPARγ-LXRα-ABCA1/ABCG1 pathway.

Authors:  Xin-Wei He; Dan Yu; Wei-Ling Li; Zhou Zheng; Chen-Ling Lv; Cai Li; Peng Liu; Chun-Qiang Xu; Xiao-Fei Hu; Xiao-Ping Jin
Journal:  Biomed Pharmacother       Date:  2016-07-04       Impact factor: 6.529

8.  Sterol regulatory element binding protein (SREBP) -1 mediates oxidized low-density lipoprotein (oxLDL) induced macrophage foam cell formation through NLRP3 inflammasome activation.

Authors:  Johnna F Varghese; Rohit Patel; Umesh C S Yadav
Journal:  Cell Signal       Date:  2018-10-31       Impact factor: 4.315

9.  Baicalein, an enteric microbial metabolite, suppresses gut inflammation and cancer progression in ApcMin/+ mice.

Authors:  C-Z Wang; C-F Zhang; Y Luo; H Yao; C Yu; L Chen; J Yuan; W-H Huang; J-Y Wan; J Zeng; W R Sawadogo; C-S Yuan
Journal:  Clin Transl Oncol       Date:  2019-10-24       Impact factor: 3.405

Review 10.  Residual macrovascular risk in 2013: what have we learned?

Authors:  Jean-Charles Fruchart; Jean Davignon; Michel P Hermans; Khalid Al-Rubeaan; Pierre Amarenco; Gerd Assmann; Philip Barter; John Betteridge; Eric Bruckert; Ada Cuevas; Michel Farnier; Ele Ferrannini; Paola Fioretto; Jacques Genest; Henry N Ginsberg; Antonio M Gotto; Dayi Hu; Takashi Kadowaki; Tatsuhiko Kodama; Michel Krempf; Yuji Matsuzawa; Jesús Millán Núñez-Cortés; Carlos Calvo Monfil; Hisao Ogawa; Jorge Plutzky; Daniel J Rader; Shaukat Sadikot; Raul D Santos; Evgeny Shlyakhto; Piyamitr Sritara; Rody Sy; Alan Tall; Chee Eng Tan; Lale Tokgözoğlu; Peter P Toth; Paul Valensi; Christoph Wanner; Alberto Zambon; Junren Zhu; Paul Zimmet
Journal:  Cardiovasc Diabetol       Date:  2014-01-24       Impact factor: 9.951

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.