Objective: To determine the level of expression and clinical importance of serum miR-204 and miR-451 in patients with pulmonary arterial hypertension caused by congenital heart disease (CHD-PAH). Methods: From July 2019 to January 2021, 114 infants with congenital heart disease (CHD) were hospitalized at Qingdao's Fuwai Cardiovascular Hospital. They were grouped into categories: CHD (53 cases) and CHD-PAH (61 cases) based on whether they had pulmonary hypertension (PAH). In addition, 60 healthy children were selected as the control group. All children underwent routine biochemical examination, echocardiography, and pulmonary arterial pressure examination. By using an enzyme-linked immunosorbent assay (ELISA), the levels of brain natriuretic peptide (BNP) and asymmetric dimethylarginine (ADMA) in the blood were measured. Additionally, reverse transcription-polymerase chain reaction (RT-PCR) was used to determine the expression levels of miR-204 and miR-451 in peripheral blood. The correlation between miR-204, miR-451, BNP, ADMA, and mPAP was investigated using Pearson correlation analysis. Results: Consequently, the TC, BNP, and ADMA serum levels were considerably higher in the CHD and CHD-PAH groups than in the control group (P < 0.05), whereas BNP and ADMA serum levels were significantly higher in the CHD-PAH group than in the CHD group (P < 0.05). According to RT-PCR data, the expression levels of miR-204 and miR-451 in the peripheral blood of children in the CHD and CHD-PAH groups were significantly lower (P < 0.05) when compared to the control group. The expression levels of miR-204 and miR-451 in the peripheral blood of children in the CHD-PAH group were substantially lower (P < 0.05) than in the CHD group. Significantly, the findings of the ROC curve revealed that the area under the curve (AUC) of CHD-PAH diagnosed by miR-204 and miR-451 alone was 0.737 and 0.725, respectively, and the AUC of joint diagnosis was 0.840, which was greater than that of single diagnosis (P < 0.05). Patients with CHD-PAH had lower levels of miR-204 and miR-451 in their blood, and this was found to be associated with BNP, ADMA, and mPAP, analyzed by Pearson correlation. Conclusions: Children with CHD-PAH can be diagnosed based on aberrant expressions of miR-204 and miR-451 in their peripheral blood serum. Moreover, CHD-PAH can be diagnosed if the combination of miR-204 and miR-451 is detected as a biomarker, which has a higher diagnostic value.
Objective: To determine the level of expression and clinical importance of serum miR-204 and miR-451 in patients with pulmonary arterial hypertension caused by congenital heart disease (CHD-PAH). Methods: From July 2019 to January 2021, 114 infants with congenital heart disease (CHD) were hospitalized at Qingdao's Fuwai Cardiovascular Hospital. They were grouped into categories: CHD (53 cases) and CHD-PAH (61 cases) based on whether they had pulmonary hypertension (PAH). In addition, 60 healthy children were selected as the control group. All children underwent routine biochemical examination, echocardiography, and pulmonary arterial pressure examination. By using an enzyme-linked immunosorbent assay (ELISA), the levels of brain natriuretic peptide (BNP) and asymmetric dimethylarginine (ADMA) in the blood were measured. Additionally, reverse transcription-polymerase chain reaction (RT-PCR) was used to determine the expression levels of miR-204 and miR-451 in peripheral blood. The correlation between miR-204, miR-451, BNP, ADMA, and mPAP was investigated using Pearson correlation analysis. Results: Consequently, the TC, BNP, and ADMA serum levels were considerably higher in the CHD and CHD-PAH groups than in the control group (P < 0.05), whereas BNP and ADMA serum levels were significantly higher in the CHD-PAH group than in the CHD group (P < 0.05). According to RT-PCR data, the expression levels of miR-204 and miR-451 in the peripheral blood of children in the CHD and CHD-PAH groups were significantly lower (P < 0.05) when compared to the control group. The expression levels of miR-204 and miR-451 in the peripheral blood of children in the CHD-PAH group were substantially lower (P < 0.05) than in the CHD group. Significantly, the findings of the ROC curve revealed that the area under the curve (AUC) of CHD-PAH diagnosed by miR-204 and miR-451 alone was 0.737 and 0.725, respectively, and the AUC of joint diagnosis was 0.840, which was greater than that of single diagnosis (P < 0.05). Patients with CHD-PAH had lower levels of miR-204 and miR-451 in their blood, and this was found to be associated with BNP, ADMA, and mPAP, analyzed by Pearson correlation. Conclusions: Children with CHD-PAH can be diagnosed based on aberrant expressions of miR-204 and miR-451 in their peripheral blood serum. Moreover, CHD-PAH can be diagnosed if the combination of miR-204 and miR-451 is detected as a biomarker, which has a higher diagnostic value.
Congenital heart diseases (CHD) are the most common birth defect. A variety of reasons can lead to abnormal development of the heart and great blood vessels during embryonic development or incomplete closure of neonatal cardiac channels after birth [1]. CHD is a growing burden for healthcare systems, and statistics show that the incidence of CHD in China is about 2.9‰ [2, 3]. One of the most common and deadly side effects of coronary artery disease (CAD) is a condition known as pulmonary arterial hypertension (PAH). PAH is a hemodynamic and pathophysiological condition in which pulmonary artery pressure increases beyond a certain threshold. It is characterized by distinctive alterations in the pulmonary arterioles that lead to right-sided heart failure, increasing pulmonary arterial pressures, and a high mortality rate [4]. According to a study, about 47.5% of CHD patients in China have PAH [5]. There is no natural way to mend CHD-PAH, which necessitates surgery to rectify the malformation; however, the presence of PAH makes the procedure more challenging. The postoperative recovery time of children is long, which is easy to cause complications such as cardiac cavity and pleural effusion and even cause respiratory failure of children [6]. As a result, children with CHD-PAH must receive prompt diagnosis and treatment. There are no conventional clinical signs in the early stages of CHD-PAH, thus finding specific indicators for diagnosis and therapy is crucial.MicroRNAs (miR) are a type of highly conserved endogenous nonprotein coding RNA molecule that is involved in the expression of a variety of essential genes and the process of cell evolution, and it can regulate gene posttranscriptional expression by binding the 3′-UTR of mRNA [7]. miRNA can play a significant role in the onset and progression of cardiovascular disease by coordinating various disease pathways. MiR-204 is a newly discovered miRNA with multiple protective effects on cardiovascular diseases [8]. It has been found that miR-204 can protect myocardial cells from ischemia/reperfusion injury by regulating apoptosis, and the serum miR-204 expression considerably reduced in patients with chronic obstructive pulmonary disease (COPD) accompanied with PAH [9, 10]. Reportedly, in atherosclerotic plaque tissue and blood samples, the expression level of miR-204-5p was markedly downregulated. Moreover, the overexpression of miR-204-5p may also reduce human vascular smooth muscle cell (hVSMCs) proliferation and migration while increasing hVSMC apoptosis [11]. Another study confirmed that miR-204 was downregulated in hypoxic-ischemic encephalopathy (HIE) [12]. MiR-451 is mainly expressed in cardiac myocytes and is upregulated in PHA patients and hypoxia-induced PAH rat models, and changes in its serum content affect the function of pulmonary artery smooth muscle cells [13]. Long et al. found that the miR-451 expression was decreased in serum of patients with CHD-PAH [14].To identify novel targets and a better theoretical foundation for the diagnosis and treatment of CHD-PAH, this study is aimed at assessing the expression of miR-204 and miR-451 in CHD-PAH and their clinical significance.
2. Data and Methods
2.1. General Data
A prospective analysis was performed on 114 children with CHD admitted to Qingdao Fuwai Cardiovascular Hospital from July 2019 to January 2021. The inclusion criteria were as follows: (1) CHD was confirmed by routine examination, cardiac auscultation, and echocardiography; 2 experienced clinicians and 2 experienced sonographers to conduct examinations, and the final diagnosis was obtained through discussion; (2) perfect clinical data; (3) the children families accepted the participation in the study and completed the informed consent; and (4) the CHD-PAH group conformed to the diagnostic criteria for PAH [15]: pulmonary capillary wedge pressure (PCWP) 15 ≤ mmHg, pulmonary vascular resistance (PVR) > 3 WU, and mean pulmonary arterial pressure (mPAP) determined by right heart catheter in resting state ≥ 25 mmHg. The exclusion criteria were as follows: (1) PAH caused by other etiologies, (2) patients complicated with malignant tumor, (3) patients with dysfunction of other vital organs (liver, kidney, etc.), and (4) patients whose family members not agree to participate in this study. According to the complexity of PAH, the children were split into two groups: CHD (n = 53) and CHD-PAH (n = 61). There were 27 men and 26 females in the CHD group, ranging in age from 2 to 62 months, with an average age of 18.42 ± 10.25 months. The average age of the CHD-PAH group was 17.58 ± 11.34 months, with 33 males and 28 females aged 3-66 months. In addition, as a control group, 60 healthy children of matched gender and age were gathered in our hospital's physical examination department, comprising 30 boys and 30 girls, ranging in age from 2 to 70 months, with an average age of 18.50 ± 10.68 months. The Medical Ethics Committee of Qingdao Fuwai Cardiovascular Hospital gave its approval to this investigation.
2.2. Methods
2.2.1. Biochemical Indices
Six mL of fasting venous blood was collected from each of the three groups of individuals and centrifuged (3,000 rpm, 10 min) in an EDTA vacuum vasculature for 60 min. The upper serum was taken and frozen at -20°C for storage. Biochemical indicators such as serum total cholesterol (TC), triacylglycerol (TG), aspartate aminotransferase (AST), blood urea nitrogen (BUN), alanine aminotransferase (ALT), and serum creatinine (SCr) were measured by automatic biochemical analyzer (Beck Mancoulter), AST, and other. The serum levels of asymmetric dimethylarginine (ADMA) and brain natriuretic peptide (BNP) were evaluated through ELISA kit (Shanghai Jianglai Biotechnology Co., Ltd.).
2.2.2. Echocardiography and Pulmonary Arterial Pressure (PAP)
All the children were subjected to echocardiography to confirm the types of congenital heart disease, including ventricular septal defect (VSD), patent ductus arteriosus (PDA), and atrial septal defect (ASD). All the children were examined by right heart catheterization under basic anesthesia. The mPAP and PCWP were measured, and PVR was calculated.
2.2.3. Serum miR-204 and miR-451Expression Detection by PT-PCR
Six mL blood was taken from the three fasting groups of subjects and placed in EDTA vacuum vasculature for centrifugation within 60 min (3,000 r/min, 10 min). The upper serum was taken and frozen at -80°C for testing. Total RNA from serum was extracted using the TRIzol technique in strict accordance with the operation instructions of RNA extraction kit (Invitrogen Company, USA). According to the reverse transcription kit's instructions (purchased from Takara Company, Japan), 1 μg total RNA was reversely transcribed into cDNA and stored in the refrigerator at -20°C for use. RT-PCR kit (Tiangen Biotech (Beijing) Co., Ltd.) was used to determine the relative expression levels of miR-204 and miR-451 in the serum of the children. The RT-PCR reaction system was 20 μl in volume, including 2 μl template, 1 μl upstream primer, 1 μl downstream primer, 10 μl SYBR Green Premix, and 6 μl double distilled water. RT-PCR reaction conditions were as follows: predenaturation was performed at 95°C for 5 min, denaturation at 95°C for 15 s, annealing at 62°C for 60 s, and extension was carried at 72°C for 12 s for a total of 35 cycles. In this study, U6 was used as the internal reference. Sangon Bioengineering Co., Ltd. has developed and synthesized the primers and internal reference indicated in Table 1. Furthermore, 2- was used to determine the relative expression levels of miR-204 and miR-451. Schematic diagram of the research process as shown in Figure 1.
Table 1
Primer sequences.
Gene
Location
Sequence (5′-3′)
miR-204
Upstream
AACCUGAUCCCGUCUGAGAUUG
Downstream
CCGGAUCAAGAUUAGUUCGGUU
miR-451
Upstream
CACCTATCGTGGTGAAGTT
Downstream
GAATGCACTGCACAATATT
U6
Upstream
GCTTCGGCAGCACATATACTAAAAT
Downstream
CGCTTCACGAATTTGCGTGTCAT
Figure 1
Schematic diagram of the research process.
2.3. Statistical Analysis
For statistical analysis, the SPSS 22.0 program was employed. The counting data was expressed in n (%) and compared between groups by χ2 test. The measuring data accorded with the normal distribution were expressed in the form of . The t-test of independent samples was used to compare data between two groups, and the one-way ANOVA was used to examine at differences in data between three groups. The diagnostic utility of miR-204 and miR-451 in CHD-PAH was studied using a ROC curve. The correlation of miR-204 and miR-451 with BNP, ADMA, and mPAP was investigated using Pearson correlation analysis with a statistical significance of P < 0.05.
3. Results
3.1. A Comparison of the Patients' General Data
In the CHD group, 22 cases were ASD, 19 cases were VSD, and 12 cases were PDA. In the CHD-PAH group, 26 cases were ASD, 21 cases were VSD, and 14 cases were PDA. There were no significant differences in CHD type, age, serum TG, gender, AST, ALT, BUN, and SCr levels among the three groups (all P > 0.05), indicating comparability. Between the CHD and CHD-PAH groups, there were statistically significant (all P < 0.05) differences in mPAP, PCWP, and PVR. Table 2 shows that blood levels of TC, BNP, and ADMA in the CHD and CHD-PAH groups were considerably higher than the control group (both P < 0.05), while serum BNP and ADMA levels in the CHD-PAH group were significantly higher than the CHD group (both P < 0.01).
Table 2
Comparison of general data of included subjects.
Indicator
Control group (n = 60)
CHD group (n = 53)
CHD-PAH group (n = 61)
F/t/χ2 value
P value
Age (month)
18.50 ± 10.68
18.42 ± 10.25
17.58 ± 11.34
0.617
0.542
Gender (male/female)
30/30
27/26
33/28
0.222
0.895
TC (mmol/L)
3.86 ± 0.48
4.05 ± 0.73∗
4.39 ± 0.64∗
3.448
0.036
TG (mmol/L)
0.82 ± 0.20
0.88 ± 0.17
0.90 ± 0.24
2.710
0.071
AST (U/L)
19.65 ± 6.58
19.85 ± 8.43
20.72 ± 8.23
0.617
0.541
ALT (U/L)
22.03 ± 7.55
22.52 ± 8.37
23.25 ± 10.46
1.609
0.205
BUN (mmol/L)
4.97 ± 1.42
5.10 ± 1.56
5.31 ± 1.12
0.675
0.512
SCr (μmol/L)
55.03 ± 9.17
53.58 ± 7.88
56.42 ± 10.76
1.666
0.194
BNP (μg/L)
68.36 ± 12.41
135.47 ± 14.16∗∗
376.62 ± 47.53∗∗##
973.765
0.001
ADMA (μmol/L)
3.69 ± 0.16
4.34 ± 0.32∗∗
6.37 ± 0.22∗∗##
1235.665
0.001
mPAP (mmHg)
—
19.05 ± 3.26
49.75 ± 6.59##
-25.134
0.001
PCWP (mmHg)
—
21.79 ± 4.63
9.83 ± 2.64##
13.275
0.001
PVR (WU)
—
2.03 ± 0.19
11.14 ± 6.03##
-9.945
0.001
Note: compared with the control group, ∗P < 0.05, ∗∗P < 0.01; compared with the CHD group, #P < 0.05, ##P < 0.01.
3.2. Comparison of Serum miR-204and miR-451 Levels among Three Groups of Children
Eventually, the RT-PCR revealed that the expression of miR-204 and miR-451 in the peripheral blood of the CHD and CHD-PAH groups was substantially lower compared to the control group (both P < 0.05). As demonstrated in Figure 2, the expression of miR-204 and miR-451 in the peripheral blood of the CHD-PAH group was substantially lower (P < 0.05) than that of the CHD group.
Figure 2
Comparison of serum miR-204and miR-451 levels among three groups of children. Note: compared with the control group, ∗P < 0.05, ∗∗P < 0.01; compared with the CHD group, #P < 0.05, ##P < 0.01.
3.3. Diagnostic Value of miR-204 and miR-451 Alone or Combined Detection in CHD-PAH
The area under the curve (AUC) of miR-204 alone for diagnosing CHD-PAH was 0.737, and 95% CI was 0.702~0.787, as seen in the ROC curve, while sensitivity and specificity were 73.48% and 70.29%, respectively; the AUC of miR-451 alone for diagnosing CHD-PAH was 0.725, 95% CI was 0.698~0.752, and sensitivity and specificity were 71.40% and 60.26%, respectively; the AUC of combined diagnosis was 0.840, 95% CI was 0.803-0.882, and sensitivity and specificity were 86.79% and 68.85%, respectively. As demonstrated in Figure 3, the differences were statistically significant (all P < 0.05).
Figure 3
ROC curves of miR-204 and miR-451 alone or in combination for the diagnosis of CHD-PAH.
3.4. Correlation Analysis of miR-204and miR-451 Levels
According to Pearson correlation analysis, the levels of mir-204 and mir-451 in the peripheral blood of patients with CHD-PAH were adversely correlated with BNP, ADMA, and mPAP (P < 0.05), as indicated in Table 3.
Table 3
Correlation analysis of miR-204and miR-451 levels with BNP, ADMA, and mPAP in CHD-PAH patients.
Characteristics
miR-204
miR-451
R value
P value
R value
P value
BNP (μg/L)
-0.424
0.002
-0.326
0.015
ADMA (μmol/L)
-0.535
0.001
-0.628
0.001
mPAP (mmHg)
-0.282
0.041
-0.478
0.005
4. Discussion
CHD is the most prevalent cardiovascular disease in children, ~40000 babies are born in the United States each year with congenital heart disease (CHD), and one-third of these newborns need surgical or catheter-based treatment during the first year of life [16]. PAH is one of the most prevalent consequences in infants with congenital heart disease and is characterized by a remodeling of the tiny pulmonary arteries and raised pulmonary arterial pressure, which may lead to right heart failure or even death if left untreated [17, 18]. miRNA has been widely studied for its abnormal expression in many diseases. In recent years, studies have found that miRNAs play important regulatory roles in the progression of pulmonary vascular diseases, and the pathophysiology of PAH is closely linked to the differential expression of various miRNAs [19].The cardiovascular system is protected by a recently identified miRNA, i.e., miRNA-204. Studies have shown that miR-204 can regulate the autophagy function of cardiomyocytes and participate in the protective mechanism of cardiomyocytes after hypoxia injury [20]. In patients with chronic obstructive pulmonary disease (COPD) accompanied with PAH, Dauriz et al. discovered that the serum miR-204 expression was considerably reduced, and therapy with synthetic miR-204 might reduce PAP [21]. Potus et al. discovered that downregulation of miR-204 in PAH pulmonary artery smooth muscle cells causes a proliferation-apoptosis imbalance, which contributes to distal pulmonary artery vascular remodeling. The miR-204 expression has long been known as a critical player in vascular remodeling in PAH distal pulmonary arteries, specifically via NFAT and HIF-1 activation in pulmonary artery smooth muscle cells [22]. Li et al. found that miR-204 level is negatively correlated with PAP in patients with COPD complicated with PAH [23]. The findings of this study demonstrated that mir-204 levels in the peripheral blood of CHD-PAH patients were negatively linked with mPAP levels, which was consistent with previous research. miRNA-451 is associated with ischemia-reperfusion injury, oxidative stress, cardiovascular injury, and lung injury. MiR-451 expression is significantly down-regulated in carotid arteries of atherosclerotic patients, and up-regulation of miR-451 can relieve intimal thickening after vascular injury in rats [24]. In a rat model of burn-induced acute lung damage, miR-451 expression is increased in lung endothelial cells, which promotes the increase of permeability of lung endothelial cells and inhibits the angiogenesis of lung endothelial cells, showing potential of burn treating [25]. Long et al. found that decreased expression of miR-451 in serum of CHD-PAH patients, which is associated with BNP, ADMA, and disease severity [14]. Muscularization of hitherto nonmuscular arteries and remodeling of the pulmonary vasculature are two of PAH's primary hallmarks [26]. One of the main cell types implicated in this process is smooth muscle cells, and phenotypic dysregulation of PASMC proliferation and migration leads to the complicated remodeling seen in PAH. The overexpression of miR-451 increased pulmonary artery smooth muscle cell migration, as per Grant et al. [27]. The goal of this research was to look into the clinical importance of the miR-204 and miR-451 expression in children with PAH-CHD. The expression of miR-204 and miR-451 in the peripheral blood of children with CHD and CHD-PAH was substantially lower than that of the control group (both P < 0.05). The expression of miR-204 and miR-451 in the peripheral blood of the CHD-PAH group was considerably lower (P < 0.05) when compared to the CHD group. TC and TG are important risk factors in cardiovascular diseases. They participate in changes of atherosclerosis and are closely related to hypertension, coronary heart disease, and cerebrovascular diseases and promote the occurrence and development of cardiovascular and cerebrovascular diseases [28]. BNP is mainly synthesized and secreted by ventricular myocytes. It participates in the regulation of blood pressure, blood volume, and water-salt balance. And more importantly, it can reflect cardiac function [29]. ADMA is an endogenous nitric oxide synthase inhibitor, which could induces endothelial dysfunction, and plays an important role in the occurrence and development of cardiovascular diseases for a new risk factor [30]. The study shows that the levels of TC, BNP, ADMA, and mPAP in the CHD and CHD-PAH groups were considerably higher than the control group (P < 0.05), while the levels of BNP, ADMA, and mPAP in the CHD-PAH group were significantly higher than the CHD group (P < 0.01). Consistent with the results of literature studies, the levels of miR-451 in peripheral blood of CHD-PAH patients were negatively correlated with the levels of BNP, ADMA, and mPAP.Currently, right heart catheterization is now the gold standard for CHD-PAH diagnosis [31]. However, it is somewhat invasive and has limited clinical application in neonates. Finding efficient noninvasive biomarkers for the early identification of CHD-PAH in children is still critical. The diagnostic usefulness of miR-204 and miR-451 alone and in combination with CHD-PAH was investigated in this research. The AUC of individually diagnosed CHD-PAH by miR-204 and miR-451 was 0.737 and 0.725, respectively, while the AUC of the combined diagnosis was 0.840, showing that the combination diagnosis had a higher AUC than the separate diagnosis (P < 0.05). It shows that combined diagnosis has a higher diagnostic value. The AUC of miR-451 in the diagnosis of PAH was 0.710 in literature research, which was comparable to our result [32]. Our findings showed that detecting serum expression levels of miR-204 and miR-451 together might provide a basis for diagnosis of CHD-PAH in children.In conclusion, the low expression of miR-204 and miR-451 in CHD-PAH children's blood might increase the diagnostic efficiency of CHD-PAH and could be employed as biological markers for CHD-PAH diagnosis and assessment. The detection of miRNA is very simple and convenient, and the risk of damage is extremely low, which is conducive to large-scale screening and improving the efficiency of diagnosis and treatment. For primary hospitals, it is more practical and maneuverable. However, we did not investigate the processes of miR-204 and miR-451 in CHD-PAH. As mentioned, the serum miR-204 expression significantly reduced in patients with COPD complicated with PAH, and treatment with synthetic Mir-204 reduced pulmonary arterial pressure. MiR-451 promotes pulmonary hypertension by regulating the ABCA1 expression. In this study, mir-204 and Mir-451 significantly downregulated in CHD-PAH. Therefore, we hypothesized that the occurrence and development of CHD-PAH may be related to the decreased expression of miR-204, and the decreased expression of Mir-451 may play a compensatory and protective role in CHD-PAH. In addition, it was a single-center clinical study with a relatively small sample size and lack of PAH group as a comparison in this clinical trial. These would need further in vivo and in vitro research.
Authors: Nazzareno Galiè; Marc Humbert; Jean-Luc Vachiery; Simon Gibbs; Irene Lang; Adam Torbicki; Gérald Simonneau; Andrew Peacock; Anton Vonk Noordegraaf; Maurice Beghetti; Ardeschir Ghofrani; Miguel Angel Gomez Sanchez; Georg Hansmann; Walter Klepetko; Patrizio Lancellotti; Marco Matucci; Theresa McDonagh; Luc A Pierard; Pedro T Trindade; Maurizio Zompatori; Marius Hoeper Journal: Eur Respir J Date: 2015-08-29 Impact factor: 16.671
Authors: Marco Dauriz; Giovanni Targher; Cécile Laroche; Pier Luigi Temporelli; Roberto Ferrari; Stephan Anker; Andrew Coats; Gerasimos Filippatos; Maria Crespo-Leiro; Alexandre Mebazaa; Massimo F Piepoli; Aldo P Maggioni; Luigi Tavazzi Journal: Diabetes Care Date: 2017-03-02 Impact factor: 19.112