| Literature DB >> 35734439 |
Yuxin Lin1,2,3, Hui Sun1, Aftab Shaukat1, Tingxian Deng4, Hamdy Abdel-Shafy5, Zhaoxuan Che1, Yang Zhou1, Changmin Hu1, Huazhao Li1, Qipeng Wu1, Liguo Yang1,6, Guohua Hua1,2,3,6.
Abstract
Understanding the genetic mechanisms underlying milk production traits contribute to improving the production potential of dairy animals. Long-chain acyl-CoA synthetase 1 (ACSL1) plays a key role in fatty acid metabolism and was highly expressed in the lactating mammary gland epithelial cells (MGECs). The objectives of the present study were to detect the polymorphisms within ACSL1 in Mediterranean buffalo, the genetic effects of these mutations on milk production traits, and understand the gene regulatory effects on MGECs. A total of twelve SNPs were identified by sequencing, including nine SNPs in the intronic region and three in the exonic region. Association analysis showed that nine SNPs were associated with one or more traits. Two haplotype blocks were identified, and among these haplotypes, the individuals carrying the H2H2 haplotype in block 1 and H5H1 in block 2 were superior to those of other haplotypes in milk production traits. Immunohistological staining of ACSL1 in buffalo mammary gland tissue indicated its expression and localization in MGECs. Knockdown of ACSL1 inhibited cell growth, diminished MGEC lipid synthesis and triglyceride secretion, and downregulated CCND1, PPARγ, and FABP3 expression. The overexpression of ACSL1 promoted cell growth, enhanced the triglyceride secretion, and upregulated CCND1, PPARγ, SREBP1, and FABP3. ACSL1 was also involved in milk protein regulation as indicated by the decreased or increased β-casein concentration and CSN3 expression in the knockdown or overexpression group, respectively. In summary, our present study depicted that ACSL1 mutations were associated with buffalo milk production performance. This may be related to its positive regulation roles on MGEC growth, milk fat, and milk protein synthesis. The current study showed the potential of the ACSL1 gene as a candidate for milk production traits and provides a new understanding of the physiological mechanisms underlying milk production regulation.Entities:
Keywords: ACSL1; buffalo; genetic mutation; mammary gland epithelial cells; milk production traits
Year: 2022 PMID: 35734439 PMCID: PMC9207818 DOI: 10.3389/fgene.2022.896910
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
Primer information for the buffalo ACSL1 gene.
| Primer | Sequence (5′-3′) | Region | Start and end position | Product length [bp] |
|---|---|---|---|---|
| 1 | F: GTGGTTGAAGGTGGAAGACACGA | promoter | −330–90 | 339 |
| R: GGTCCCCGATGCTATTTAAGGG | ||||
| 2 | F: CTCCTAGGCTGCAGCGAGTGGCTGGA | 5‘UTR | 12–250 | 239 |
| R: TGGCCGGCAGGGTAGCCTTAGATC | ||||
| 3 | F: GTTTGTCACAGCATCCCTCCT | exon 1 | 22,036–22,823 | 788 |
| R: AATTTGGGGATGAGCCTCTGC | ||||
| 4 | F: GTGGAGGATTTATGTCAGACGC | exon 2 | 35,590–35,967 | 378 |
| R: AAGTTACAGGAGGAGATAGGGAG | ||||
| 5 | F: AGCAAAACTCAGACCCAAACC | exon 3 | 36,387–37,069 | 683 |
| R: AGCACCCCTCAAGACAGAAAG | ||||
| 6 | F: TTTGTGTCCCTGGATTGCTTT | exon 4 | 39,708–40,127 | 420 |
| R: ATTCTCTGTGCTTTGGTTGCC | ||||
| 7 | F: GGCAAGTGTTTTGTTCATTAGG | exon 5 and exon 6 | 42,551–43,165 | 615 |
| R: GTGTTCAGGGAAGGGGGCAGGG | ||||
| 8 | F: CTTGGAATCAGTCCTGTTTC | exon 7 and exon 8 | 45,470–46,200 | 731 |
| R: GTCTTAGAGGGTGCGTGTAG | ||||
| 9 | F: AAAGACATCAGCCCTGGGATTT | exon 9 | 46,378–47,145 | 768 |
| R: TTGGGGATCAGGTCCATAGTG | ||||
| 10 | F: TGCTCTGAAATAAATGGAGAAT | exon 10 | 49,297–49,530 | 234 |
| R: TGCAAGCGGTAAAAATGAAATG | ||||
| 11 | F: ACCGCAACTAGAGAAAAGCC | exon 11 | 51,069–52,013 | 945 |
| R: ATTGTCAAGGTGAGAAAACG | ||||
| 12 | F: AGTGGGGTTGTTTCCTCTTT | exon 12 | 53,396–54,116 | 721 |
| R: TCTCGCTGACCTTCTCTTTTA | ||||
| 13 | F: CGGAACCAAACCCGTCAGGTGT | exon 13 | 54,519–54,860 | 342 |
| R: CCGAAGAAAAGAAGGGGCACAT | ||||
| 14 | F: TTGTGGTATTGTCTTCTGTGTG | exon 14 | 55,444–55,891 | 448 |
| R: CTCTGAACCTAGTATAAGGGGC | ||||
| 15 | F: TTGTTGGAGATCAAAGCAATCT | exon 15 | 58,616–58,930 | 315 |
| R: CATGCCCCCACCCCCTGAGACT | ||||
| 16 | F: ATAGAACTGACCCCAGCCCT | exon 16 | 59,516–60,154 | 639 |
| R: TCAAACCAGAAGCAGCAACC | ||||
| 17 | F: CTCATCCCTTCTCTGTCTCACT | exon 17 | 61,116–61,562 | 447 |
| R: CCTGGACGTCTTATAATATTGT | ||||
| 18 | F: TATCTATCCCATTATTTGCG | exon 18 and exon 19 | 63,025–63,816 | 792 |
| R: GACAGAATCAGGACCACAGC | ||||
| 19 | F: CTCCCTACCCTATGTTGAGATG | exon 20 | 63,870–64,229 | 360 |
| R: GGTGGCTGTAAGGCAGTGTTCC | ||||
| 20 | F: TTCGGAATTATTTCAGGTCACAGA | 3‘UTR | 63,845–65,550 | 1706 |
| R: GCAACTGGAAGTGGCGGGAT |
F: forward primer. R: reverse primer.
FIGURE 1Linkage disequilibrium of the twelve SNPs was detected in the ACSL1 gene in buffalo. The red squares represent high pairwise linkage disequilibrium, coloring down to white squares of low pairwise linkage disequilibrium, and the linkage disequilibrium is shown as D′.
Assocation analysis between haplotypes of block 1 in the ACSL1 gene and milk production traits.
| block1 | Frequency (no.) | Sequence | Peak milk yield (kg) | 270 days milk yield (kg) | Milk fat yield (kg) | Milk fat percentage (%) | Milk protein yield (kg) | Milk protein percentage (%) |
|---|---|---|---|---|---|---|---|---|
| H1H1 | 0.58 (191) | GA/GA | 14.71 ± 0.10 | 2814.27 ± 22.22 | 231.37 ± 2.05 | 8.23 ± 0.04 | 129.74 ± 0.96 | 4.63 ± 0.01b |
| H1H2 | 0.35 (116) | GA/AG | 14.62 ± 0.15 | 2810.01 ± 28.99 | 228.17 ± 2.63 | 8.13 ± 0.05 | 130.98 ± 1.33 | 4.67 ± 0.02ab |
| H2H2 | 0.06 (20) | AG/AG | 14.70 ± 0.29 | 2725.47 ± 63.67 | 221.94 ± 5.80 | 8.17 ± 0.13 | 128.10 ± 2.72 | 4.72 ± 0.04a |
| P value | 0.9993 | 0.5661 | 0.3419 | 0.3555 | 0.4354 | 0.0149 |
The values of milk production traits in each genotype are represented as mean ± SE.,. The values with different superscripts within the same column differed significantly at p < 0.05.
Assocation analysis between haplotypes of block 2 in the ACSL1 gene and milk production traits.
| block2 | Frequency (no.) | Sequence | Peak milk yield (kg) | 270 days milk yield (kg) | Milk fat yield (kg) | Milk fat percentage (%) | Milk protein yield (kg) | Milk protein percentage (%) |
|---|---|---|---|---|---|---|---|---|
| H1H1 | 0.2030 (67) | CTGAGCCAA/CTGAGCCAA | 14.89 ± 0.20 | 2802.20 ± 39.06 | 224.72 ± 3.66 | 8.03 ± 0.08 | 131.05 ± 1.78 | 4.69 ± 0.02abc |
| H2H1 | 0.1636 (54) | TCAGCCCAA/CTGAGCCAA | 14.98 ± 0.21 | 2869.15 ± 38.36 | 234.24 ± 3.42 | 8.19 ± 0.08 | 131.96 ± 1.67 | 4.61 ± 0.02c |
| H3H1 | 0.1515 (50) | TCAGCATCG/CTGAGCCAA | 14.38 ± 0.19 | 2796.19 ± 42.92 | 233.22 ± 3.98 | 8.34 ± 0.08 | 129.50 ± 1.92 | 4.64 ± 0.02bc |
| H2H3 | 0.0758 (25) | TCAGCCCAA/TCAGCATCG | 14.40 ± 0.26 | 2650.07 ± 56.45 | 221.82 ± 5.71 | 8.33 ± 0.11 | 123.55 ± 2.57 | 4.67 ± 0.02abc |
| H4H1 | 0.0697 (23) | TCGACCCAA/CTGAGCCAA | 14.54 ± 0.36 | 2745.29 ± 60.81 | 229.84 ± 5.77 | 8.38 ± 0.10 | 129.79 ± 2.74 | 4.74 ± 0.04ab |
| H5H1 | 0.0515 (17) | CTGACCCAA/CTGAGCCAA | 14.49 ± 0.31 | 2674.64 ± 68.12 | 219.56 ± 6.94 | 8.20 ± 0.14 | 128.5 ± 3.41 | 4.81 ± 0.04a |
| P value | 0.1446 | 0.0849 | 0.2029 | 0.2611 | 0.1299 | 0.0364 |
The values of milk production traits in each genotypes are represented as mean ± SE.,. The values with different superscripts within the same column differed significantly at p < 0.05.
FIGURE 2Expression and localization of ACSL1 in buffalo mammary gland. Immunohistochemistry staining of ACSL1 in buffalo mammary gland tissue. The brown color indicated ACSL1 immuno signal, and the nuclei were counterstained in blue. Scale bar: 100 μm (upper panel, 20 times magnification) and 50 μm (lower panel, 40 times magnification).
FIGURE 3ACSL1 interference inhibited mammary epithelial cell growth. (A) MAC-T cells were transfected with si-ACSL1, and fluorescence quantitative qPCR was used to detect the ACSL1 mRNA levels; (B,C) Western Blot detected the protein expression of ACSL1; (D) CCK-8 assays were applied to check the cell viability after ACSL1 knockdown; (E) Living cell number in control (Ctrl) and ACSL1 knockdown (Si-ACSL1) groups; (F) Flow cytometry was used to detect cell cycle progression; (G) Quantification of apoptosis by flow cytometry; (H) mRNA expression of cell cycle and cell apoptosis–related genes. GAPDH was used as the inner control; *p < 0.05, **p < 0.01, and ***p < 0.001, ns: nonsignificant difference.ACSL1 overexpression was then performed to confirm its regulatory role on mammary epithelial cell growth by using ACSL1-overexpressing plasmid (pcDNA3.1-ACSL1). Transfection of ACSL1-overexpressing plasmid significantly increased ACSL1 mRNA (Figure 4A) and protein abundance (Figures 4B,C). The CCK-8 assay showed that ACSL1 overexpression resulted in a significant promotion in cell viability (p < 0.01) (Figure 4D). The cell counting test showed that MAC-T cells were significantly increased after ACSL1 overexpression (p < 0.01) (Figure 4E). Then, flow cytometric analysis demonstrated a significant difference in cell cycle distribution in ACSL1 overexpression cells (p > 0.05) (Figure 4F). The cell apoptosis rate showed no significant differences between the control and ACSL1 overexpression cells (Figure 4G). The overexpression of ACSL1 upregulated CCND1 expression (p < 0.01), while that of BCL2 and FAS remained unchanged (Figure 4H).
FIGURE 4ACSL1 overexpression promotes cell growth. (A) MAC-T cells were transfected with pcDNA3.1-ACSL1 for 48°h, and fluorescence quantitative qPCR was used to detect the changes of ACSL1 mRNA levels; (B,C) Western blot detects the protein expression of ACSL1; (D) CCK-8 assays were applied to check the cell viability after ACSL1 overexpression; (E) Living cell number in control (Ctrl) and ACSL1 overexpression (OE-ACSL1) groups; (F) Flow cytometry was applied to cell cycle progression; (G) Quantification of apoptosis by flow cytometry; (H) mRNA expression of cell cycle and cell apoptosis–related genes. GAPDH was used as inner control; *p < 0.05, **p < 0.01, and ***p < 0.001, ns: nonsignificant difference.
FIGURE 5ACSL1 regulated lipogenesis and triglyceride synthesis in MAC-T cells. (A) MAC-T cells were transfected either with ACSL1 siRNA or negative control for 72 h. Bodipy staining (green) was used to indicate the lipid distribution, and nuclei were stained by DAPI (blue). Scale bar: 20 µm; (B) Quantification of BODIPY + fluorescent signal density; (C,D) Triglyceride concentration was detected in the cell lysate. Triglyceride concentration was normalized by control (Ctrl); (E,F) mRNA expression of lipid metabolism–related genes after ACSL1 knockdown or overexpression, and GAPDH was used as the inner control. *p < 0.05, **p < 0.01, and ***p < 0.0001, ns: nonsignificant difference.
FIGURE 6ACSL1 regulated β-casein synthesis and κ-casein expression in MAC-T cells. (A,C) Content of β-casein in the MAC-T cell culture supernatant was determined by ELISA, and β-casein concentration was normalized by control (Ctrl); (B–D) mRNA expression of κ-casein (CSN3) after ACSL1 knockdown or overexpression, and GAPDH was used as the inner control. *p < 0.05; **p < 0.01.