Literature DB >> 35731090

Activation of transient receptor potential vanilloid 4 is involved in pressure overload-induced cardiac hypertrophy.

Yan Zou1,2, Miaomiao Zhang1, Qiongfeng Wu3, Ning Zhao3, Minwei Chen4, Cui Yang4, Yimei Du3, Bing Han1.   

Abstract

Previous studies, including our own, have demonstrated that transient receptor potential vanilloid 4 (TRPV4) is expressed in hearts and implicated in cardiac remodeling and dysfunction. However, the effects of TRPV4 on pressure overload-induced cardiac hypertrophy remain unclear. In this study, we found that TRPV4 expression was significantly increased in mouse hypertrophic hearts, human failing hearts, and neurohormone-induced hypertrophic cardiomyocytes. Deletion of TRPV4 attenuated transverse aortic constriction (TAC)-induced cardiac hypertrophy, cardiac dysfunction, fibrosis, inflammation, and the activation of NFκB - NOD - like receptor pyrin domain-containing protein 3 (NLRP3) in mice. Furthermore, the TRPV4 antagonist GSK2193874 (GSK3874) inhibited cardiac remodeling and dysfunction induced by TAC. In vitro, pretreatment with GSK3874 reduced the neurohormone-induced cardiomyocyte hypertrophy and intracellular Ca2+ concentration elevation. The specific TRPV4 agonist GSK1016790A (GSK790A) triggered Ca2+ influx and evoked the phosphorylation of Ca2+/calmodulin-dependent protein kinase II (CaMKII). But these effects were abolished by removing extracellular Ca2+ or GSK3874. More importantly, TAC or neurohormone stimulation-induced CaMKII phosphorylation was significantly blocked by TRPV4 inhibition. Finally, we show that CaMKII inhibition significantly prevented the phosphorylation of NFκB induced by GSK790A. Our results suggest that TRPV4 activation contributes to pressure overload-induced cardiac hypertrophy and dysfunction. This effect is associated with upregulated Ca2+/CaMKII mediated activation of NFκB-NLRP3. Thus, TRPV4 may represent a potential therapeutic drug target for cardiac hypertrophy and dysfunction after pressure overload.
© 2022, Zou, Zhang et al.

Entities:  

Keywords:  TRPV4; ca2+/calmodulin-dependent protein kinase ii; cardiac hypertrophy; cell biology; mouse

Mesh:

Substances:

Year:  2022        PMID: 35731090      PMCID: PMC9224988          DOI: 10.7554/eLife.74519

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.713


Introduction

In response to pathological stimuli such as hypertension, valvular heart disease, and neurohumoral overactivation, the heart undergoes hypertrophy. Initially, the hypertrophy response is adaptive, yet sustained cardiac hypertrophy results in increased heart mass, cardiac fibrosis, and eventually heart failure (Bui et al., 2011; Nakamura and Sadoshima, 2018). Although significant advances in the treatment of pathological hypertrophy, heart failure is still a leading cause of death worldwide (Neubauer, 2007). Thus, deeply uncovering the molecular mechanism of pathological cardiac hypertrophy continues to be important for developing novel therapeutic strategies for the prevention of cardiac remodeling and dysfunction (Kalman et al., 2019). Increased mechanical stress plays a key role in cardiac hypertrophy. The transient receptor potential vanilloid (TRPV) channels are ubiquitous ion channels that function as essential mechanical sensors (Clapham, 2003). Interestingly, those channels are upregulated in the hearts of mice after transverse aortic constriction (TAC), as shown for TRPV1, TRPV2, and TRPV3 (Chen et al., 2016; Zhang et al., 2018). Furthermore, the genetic deletion of functional TRPV2 significantly ameliorates TAC-induced cardiac hypertrophy and dysfunction (Koch et al., 2017). These findings suggest that the role of TRPV is critical in the development of cardiac remodeling in response to pressure overload. TRPV4, a member of the TRPV subfamily, is widely expressed in the cardiovascular system (Hof et al., 2019; White et al., 2016). Its functional expression is increased under certain pathological conditions, such as pressure overload (Morine et al., 2016), aging (Jones et al., 2019), ischemia-reperfusion (Dong et al., 2017; Wu et al., 2017b), and pericarditis (Liao et al., 2020). Inhibition of TRPV4 attenuates intracellular calcium concentration ([Ca2+]i) (Wu et al., 2017b), cardiac fibrosis (Adapala, et al.,2020), and cardiac inflammation (Liao et al., 2020), which improves cardiac function (Wu et al., 2019). In addition, a potent and selective TRPV4 inhibitor recently revealed a positive efficacy trend in a Phase 2a trial in patients with heart failure (Goyal et al., 2019; Stewart et al., 2020). Moreover, Adapala et al. have reported that endothelial TRPV4 deletion protects TAC-induced-structure remodeling in a conference abstract (Adapala et al., 2019). However, the role of TRPV4 in the development of pressure overload-induced cardiac hypertrophy is not well understood. Therefore, in the present study, we aim to investigate the role and the underlying mechanism of TRPV4 in pathological cardiac hypertrophy subjected to pressure overload.

Results

TRPV4 expression is increased in pathological cardiac hypertrophy

To evaluate the potential role of TRPV4 in cardiac hypertrophy, we first measured TRPV4 protein and mRNA expression levels in left ventricle (LV) tissue from wild-type (WT) TAC versus sham mice at different time points (2, 7, 14, and 28 days) after surgery. Consistent with the previous observation (Guo et al., 2021b), we did not detect significant cardiac hypertrophy on day 2 after TAC. The 1 week TAC time point gave a sample in which the heart was undergoing compensated cardiac hypertrophy, while the 2- and 4-week TAC showed signs of decompensated cardiac hypertrophy with heart failure (Appendix 1—table 1). Similar findings have been previously reported (Wu et al., 2017a). Nonetheless, there are conflicting results for changes in cardiac function, particularly 2 weeks after TAC, likely caused by differences in the severity of constriction. As shown in Figure 1A–C and Source data 1, the protein and mRNA level of TRPV4 began to increase 1 week after TAC and maintained a higher level on week 4. We also assessed the TRPV4 expression level in LV tissue from human hearts and found that TRPV4 protein was significantly upregulated in failing hearts compared with non-failing (Figure 1D–E, Source data 1). Our results indicate that TRPV4 may be implicated in pathological cardiac hypertrophy and heart failure.
Appendix 1—table 1.

Anatomical parameters, early markers of cardiac hypertrophy and fibrosis, and echocardiographic parameters were measured in wild-type (WT) mice after subjected to TAC versus sham-operated controls (n=6–7/group).

2 d1 w2 w4 w
ShamTACShamTACShamTACShamTAC
Anatomical parameter
n77777766
HW/BW4.4±0.14.5±0.15.1±0.27.3±0.7***4.5±0.37.1±1.1***4.5±0.37.1±0.8**
HW/TL6.0±0.26.0±0.16.7±0.68.4±0.6***6.0±0.39.3±1.4***6.3±0.59.7±1.6***
Early markers of cardiac hypertrophy and fibrosis
n66666677
ANP1.0±0.31.1±0.21.0±0.59.1±3.9***1.0±0.428.1±11.5***1.0±0.27.3±1.9***
BNP1.0±0.20.7±0.11.0±0.411.5±2.0***1.0±0.35.2±1.1***1.0±0.42.7±0.4**
Collagenase-11.0±0.41.4±0.71.0±0.41.1±0.31.0±1.31.0±0.71.0±0.26.8±2.5**
Collagenase-31.0±0.21.0±0.51.0±0.41.30±0.251.0±1.12.5±2.11.0±0.33.8±1.2**
Echocardiographic parameters
n77777766
EF (%)66.4±7.265.0±8.971.0±5.968.7±3.575.7±4.460.2±3.9***68.8±3.352.8±10.6**
FS (%)36.0±5.134.2±6.739.8±6.636.1±3.543.4±4.031.3±2.6***37.6±2.726.9±6.5**

HW/BW: heart weight to body weight ratio, HW/TL: heart weight to tibia length ratio, EF: ejection fraction, FS: fractional shortening, Data represent means ± SD, **P<0.01, ***P<0.001, compared between sham- and TAC operated groups.

Figure 1.

TRPV4 expression is upregulated in pathological cardiac hypertrophy.

Representative immunoblot image (A) and statistics (B) of TRPV4 protein level in the LV from sham or TAC mice at indicated time points after the operation (n=6 per group). All results represent mean ± SD, an unpaired two-tailed Student’s t-test. (C) Statistical data of Trpv4 mRNA level in the LV from sham or TAC mice at indicated time points after the operation (n=6 per group). All results represent mean ± SD, an unpaired two-tailed Student’s t-test. Representative immunoblot image (D) and statistical data (E) of TRPV4 protein level in human non-failing hearts (n=3) and failing hearts (n=5). All results represent mean ± SD, an unpaired two-tailed Student’s t-test. LV, left ventricle; TAC, transverse aortic constriction.

TRPV4 expression is upregulated in pathological cardiac hypertrophy.

Representative immunoblot image (A) and statistics (B) of TRPV4 protein level in the LV from sham or TAC mice at indicated time points after the operation (n=6 per group). All results represent mean ± SD, an unpaired two-tailed Student’s t-test. (C) Statistical data of Trpv4 mRNA level in the LV from sham or TAC mice at indicated time points after the operation (n=6 per group). All results represent mean ± SD, an unpaired two-tailed Student’s t-test. Representative immunoblot image (D) and statistical data (E) of TRPV4 protein level in human non-failing hearts (n=3) and failing hearts (n=5). All results represent mean ± SD, an unpaired two-tailed Student’s t-test. LV, left ventricle; TAC, transverse aortic constriction.

TRPV4 deficiency attenuates cardiac hypertrophy induced by pressure overload in vivo

To further investigate the role of TRPV4 in cardiac hypertrophy induced by pressure overload, we performed TAC or sham surgery in WT and TRPV4 knockout (Trpv KO) mice. The hypertrophic response was evaluated 1 and 4 weeks after TAC. We used the ratios of heart weight/body weight (HW/BW) and HW/tibial length (TL) to assess changes in LV mass (Figure 2A). As expected, both values were significantly increased after TAC in WT mice. However, this hypertrophic response to TAC was attenuated in Trpv4 KO mice at 1 or 4 weeks. Next, we measured the cross-sectional area of myocytes in all groups. As shown in Figure 2B, Trpv4 KO mice significantly attenuated TAC-induced enlargement of myocytes size 1 and 4 weeks after TAC. In order to confirm our findings at the molecular level, we then determined cardiac hypertrophic marker genes expression. Both ANP (Nppa) and BNP (Nppb) mRNA expression were significantly higher in WT hearts compared with Trpv4 KO hearts 1 and 4 weeks after TAC. There was no significant difference between WT and Trpv4 KO in the sham group (Figure 2C). These results suggest that TRPV4 activation plays a critical role in pressure overload-induced cardiac hypertrophy.
Figure 2.

TRPV4 deficiency attenuates pressure overload-induced cardiac hypertrophy.

(A) Representative images of the heart and statistical results for the ratios of HW/BW and HW/TL of WT and Trpv4 KO mice 1 or 4 weeks after sham or TAC operation (n=7 per group in WT mice, n=5 per group at 1 week in TRPV4−/− mice, n=7 per group at 4 weeks in Trpv4 KO mice) (B) Hematoxylin & eosin staining, wheat germ agglutinin staining, and cross-section area in WT and Trpv4 KO mice 1 or 4 weeks after sham or TAC operation (n=3 per group at 1 week, n=7 per group at 4 weeks). (C) Statistics of hypertrophy-related genes ANP (Nppa) (E) and BNP (Nppb) (F) mRNA levels in mouse hearts from WT or Trpv4 KO 1 or 4 weeks after sham or TAC operation (n=6 per group at 1 week, n=7 per group at 4 weeks). All results represent mean ± SD, a two-way ANOVA followed by the Bonferroni test. BW, body weight; HW, heart weight; TAC, transverse aortic constriction; TL, tibial length; WT, wild-type.

TRPV4 deficiency attenuates pressure overload-induced cardiac hypertrophy.

(A) Representative images of the heart and statistical results for the ratios of HW/BW and HW/TL of WT and Trpv4 KO mice 1 or 4 weeks after sham or TAC operation (n=7 per group in WT mice, n=5 per group at 1 week in TRPV4−/− mice, n=7 per group at 4 weeks in Trpv4 KO mice) (B) Hematoxylin & eosin staining, wheat germ agglutinin staining, and cross-section area in WT and Trpv4 KO mice 1 or 4 weeks after sham or TAC operation (n=3 per group at 1 week, n=7 per group at 4 weeks). (C) Statistics of hypertrophy-related genes ANP (Nppa) (E) and BNP (Nppb) (F) mRNA levels in mouse hearts from WT or Trpv4 KO 1 or 4 weeks after sham or TAC operation (n=6 per group at 1 week, n=7 per group at 4 weeks). All results represent mean ± SD, a two-way ANOVA followed by the Bonferroni test. BW, body weight; HW, heart weight; TAC, transverse aortic constriction; TL, tibial length; WT, wild-type.

TRPV4 deficiency attenuates cardiac dysfunction and cardiac fibrosis induced by pressure overload

Echocardiography was performed to monitor the progression of cardiac structure and functional changes (Figure 3A). A reduction in ejection fraction (EF, 52.83±10.62% vs. 73.44±6.05%, p<0.001, Figure 3B) and fractional shortening (FS, 26.87±6.46% vs. 41.34±4.83%, p<0.001, Figure 3C) in WT mice were reversed in Trpv4 KO mice at 4 weeks after TAC. Consistently, LV internal dimension systole and LV mass were significantly increased in WT TAC mice, but these effects were not found in Trpv4 KO TAC mice (Figure 3D–E). Other parameters of LV remodeling, including LV posterior end-diastolic wall thickness (LVPW), LV end-diastolic diameter (LVEDD), and LV end-diastolic volume (LVEDV), were also well preserved in Trpv4 KO mice compared with WT mice after TAC (Table 1).
Figure 3.

TRPV4 deficiency improves cardiac function and attenuates cardiac fibrosis induced by pressure overload.

Representative images of M-mode echocardiography of WT and Trpv4 KO mice 4 weeks after sham or TAC operation (A). Statistics of EF (B), FS (C), LV mass (D), and LVIDs (E) in mice 4 weeks after sham or TAC operation (n=6 per group). Representative images (F) and statistics (G) of Masson’s trichrome-stained hearts from mice 4 weeks after sham or TAC operation. The statistics were from the panoramic scanning pictures (n=4 per group). Statistics of fibrosis-related genes collagenase-1 (Col1a1) (H), collagenase-3 (Col1a1) (I), and galectin-3 (LGALS3) (J) mRNA levels in mouse hearts 4 weeks after sham or TAC operation (n=7 per group). All results represent mean ± SD, a two-way ANOVA followed by the Bonferroni test. EF, ejection fraction; FS, fractional shortening; LV, left ventricle; TAC, transverse aortic constriction.

Table 1.

Echocardiographic measurements 4 weeks after TAC.

WTTrpv4 KO
ShamTACShamTAC
Heart rate (bpm)457.61±11.77463.11±16.96463.11±18.86443.78±10.38
LVAW,s (mm)1.29±0.141.41±0.181.21±0.21.48±0.17
LVID,d (mm)3.32±0.123.81±0.592.92±0.383.11±0.47
LVPW,d (mm)0.70±0.081.08±0.460.92±0.391.02±0.37
LVPW,s (mm)1.17±0.111.41±0.571.33±0.341.59±0.31
Diameter,s (mm)2.05±0.132.67±0.571.69±0.321.80±0.37##
Diameter,d (mm)3.29±0.123.62±0.482.87±0.423.04±0.45
Volume,s (μl)13.73±2.1728.01±14.43*8.79±4.0010.36±5.41##
Volume,d (μl)43.88±3.8456.39±17.4132.23±11.0237.38±12.30
Stroke volume (μl)30.14±2.4328.39±4.6723.44±7.1927.02±7.52

LVAW,s: systolic left ventricular anterior wall, LVID,s: systolic left ventricular internal diameter, LVPW,d: diastolic left ventricular posterior wall, LVPW,s.: systolic left ventricular posterior wall, Data represent means ± SD, n=6 per group, ⁎P<0.05 WT TAC vs WT sham group. ## P<0.01 Trpv4 KO TAC vs WT TAC group.

TRPV4 deficiency improves cardiac function and attenuates cardiac fibrosis induced by pressure overload.

Representative images of M-mode echocardiography of WT and Trpv4 KO mice 4 weeks after sham or TAC operation (A). Statistics of EF (B), FS (C), LV mass (D), and LVIDs (E) in mice 4 weeks after sham or TAC operation (n=6 per group). Representative images (F) and statistics (G) of Masson’s trichrome-stained hearts from mice 4 weeks after sham or TAC operation. The statistics were from the panoramic scanning pictures (n=4 per group). Statistics of fibrosis-related genes collagenase-1 (Col1a1) (H), collagenase-3 (Col1a1) (I), and galectin-3 (LGALS3) (J) mRNA levels in mouse hearts 4 weeks after sham or TAC operation (n=7 per group). All results represent mean ± SD, a two-way ANOVA followed by the Bonferroni test. EF, ejection fraction; FS, fractional shortening; LV, left ventricle; TAC, transverse aortic constriction.

Echocardiographic measurements 4 weeks after TAC.

LVAW,s: systolic left ventricular anterior wall, LVID,s: systolic left ventricular internal diameter, LVPW,d: diastolic left ventricular posterior wall, LVPW,s.: systolic left ventricular posterior wall, Data represent means ± SD, n=6 per group, ⁎P<0.05 WT TAC vs WT sham group. ## P<0.01 Trpv4 KO TAC vs WT TAC group. Cardiac interstitial and perivascular fibrosis were assessed in Masson’s Trichrome stained sections 4 weeks after TAC surgery (Figure 3F). There was no significant difference in the extent of fibrosis in WT and Trpv4 KO mice in the sham groups. However, both interstitial and perivascular fibrosis increased in WT hearts after TAC, with more pronounced perivascular changes. The increase in interstitial and perivascular fibrosis was significantly blunted in Trpv4 KO hearts after TAC (2.48±0.95% vs. 0.51±0.05%, p<0.001, Figure 3G). In addition, quantitative real-time PCR revealed a marked reduction in fibrosis markers (collagenase-1, collagenase-3, and galectin-3, Figure 3H–J).

TRPV4 deficiency attenuates the inflammation induced by pressure overload

Chronic inflammation promotes cardiac fibrosis (Adamo et al., 2020). Thus, we detected the protein and mRNA levels of pro-inflammatory cytokines 4 weeks after TAC. As shown in Figure 4A–D and Source data 1, TAC significantly upregulated the protein levels of IL-1β, IL-6, and TNF-α in WT mice, and TRPV4 deletion diminished this elevation. Consistent with these observations, the TAC-induced increases in mRNA expression of IL-1β (Il1b), IL-6 (Il6), TNF-α (Tnfa), MIP-2 (Mip2), and MCP-1 (Mcp1p) were significantly attenuated in Trpv4 KO mice (Figure 4E–I).
Figure 4.

TRPV4 deficiency attenuates cardiac fibrosis induced by pressure overload.

Representative immunoblot image (A) and statistics of IL-1β (B), IL-6 (C), and TNF-α (D) protein levels in WT and Trpv4 KO mice 4 weeks after sham or TAC operation (n=6 per group). Statistical data of IL-1β (Il1b) (E), IL-6 (Il6) (F), TNF-α (Tnfa) (G), MCP-1 (Mcp1p) (H), and MIP-2 (Mip2) (I) mRNA levels in mouse hearts 4 weeks after sham or TAC operation (n=7 per group). Representative immunoblot image (J) and statistics of ASC (K), NLRP3 (L), Caspase 1-p20 (M), and p-NFκB p65 (N) protein levels in WT and TRPV4−/− mice at 4 weeks after sham or TAC operation (n=6 per group). All results represent mean ± SD, a two-way ANOVA followed by the Bonferroni test. TAC, transverse aortic constriction; WT, wild-type.

TRPV4 deficiency attenuates cardiac fibrosis induced by pressure overload.

Representative immunoblot image (A) and statistics of IL-1β (B), IL-6 (C), and TNF-α (D) protein levels in WT and Trpv4 KO mice 4 weeks after sham or TAC operation (n=6 per group). Statistical data of IL-1β (Il1b) (E), IL-6 (Il6) (F), TNF-α (Tnfa) (G), MCP-1 (Mcp1p) (H), and MIP-2 (Mip2) (I) mRNA levels in mouse hearts 4 weeks after sham or TAC operation (n=7 per group). Representative immunoblot image (J) and statistics of ASC (K), NLRP3 (L), Caspase 1-p20 (M), and p-NFκB p65 (N) protein levels in WT and TRPV4−/− mice at 4 weeks after sham or TAC operation (n=6 per group). All results represent mean ± SD, a two-way ANOVA followed by the Bonferroni test. TAC, transverse aortic constriction; WT, wild-type. The NOD-like receptor pyrin domain-containing protein 3 (NLRP3) inflammasome consists of ASC, NLRP3, and caspase-1 (Martinon and Tschopp, 2004). Its activation contributes to the development of cardiac hypertrophy by cleaving pro-caspase-1 and promoting the release of proinflammatory cytokine IL-β (Suetomi et al., 2019; Suetomi et al., 2018). NFκB represents a family of inducible transcription factors, which regulate various genes involved in inflammatory responses. We then assessed the activation of the NLRP3 inflammasome and the phosphorylation of NFκB (Figure 4J, Source data 1). As shown in Figure 4K–L, TAC significantly upregulated the protein levels of ASC, NLRP3, and cleaved caspase-1 (p20) in WT mice. We also found that the expression of p-NFκB p65 (ser536) was greatly upregulated in WT mice after TAC surgery (Figure 4N). Interestingly, TRPV4 deletion efficiently reduced the ASC, NLRP3, cleaved caspase-1, and p-NFκB p65 protein levels.

TRPV4 antagonist attenuates the pathological cardiac remodeling induced by TAC

We further evaluated the effects of TRPV4 inhibition with a specific antagonist GSK2193874 (GSK3874) on pathological cardiac hypertrophy and dysfunction induced by pressure overload. WT mice received intragastric administration of GSK3874 at a dose of 10 mg/kg/d or vehicle from the day of TAC operation (Thorneloe et al., 2012; Liao et al., 2020). After 4 weeks, GSK3874 treatment substantially suppressed the increase in heart size induced by TAC (Figure 5A). Moreover, HW/BW and HW/TL ratios significantly decreased in GSK3874-treated mice (Figure 5B–C). The cross-sectional area of cardiomyocytes was also markedly reduced after treatment with GSK3874 (Figure 5D). The mRNA expression of hypertrophy marker genes ANP (Nppa) and BNP (Nppb) was significantly reduced (Figure 5E–F). Echocardiography showed that EF% and FS% were also significantly higher in GSK3874- than in the vehicle-treated group (Figure 5G–H). LV internal dimension systole and LV mass were significantly smaller following GSK3874 treatment (Figure 5I–J). Finally, the fibrosis area significantly decreased in GSK3874-treated mice (Figure 5K). In summary, these results indicate that GSK3874 treatment effectively reduces cardiac remodeling and dysfunction induced by TAC.
Figure 5.

Treatment with TRPV4 antagonist prevents TAC-induced cardiac hypertrophy and dysfunction in mice.

(A) Representative images of heart photo and WGA staining 4 weeks after TAC. Statistical results for HW/BW ratio (n=6 per group) (B), HW/TL ratio (n=6 per group) (C), cross-section area (n=4 per group) (J), ANP (Nppa) (n=6 per group) (E), BNP (Nppb) (n=6 per group) (F), EF (n=6 per group) (G), FS (n=6 per group) (H), LV mass (n=6 per group) (I), and LVIDs (n=6 per group) (J). All results represent mean± SD, an unpaired two-tailed Student’s t-test. Representative images and statistics (K) of Masson’s trichrome-stained hearts 4 weeks after TAC (n=3 per group). All results represent mean ± SD, an unpaired two-tailed Student’s t-test. EF, ejection fraction; FS, fractional shortening; LV, left ventricle; TAC, transverse aortic constriction; WGA, wheat germ agglutinin.

Treatment with TRPV4 antagonist prevents TAC-induced cardiac hypertrophy and dysfunction in mice.

(A) Representative images of heart photo and WGA staining 4 weeks after TAC. Statistical results for HW/BW ratio (n=6 per group) (B), HW/TL ratio (n=6 per group) (C), cross-section area (n=4 per group) (J), ANP (Nppa) (n=6 per group) (E), BNP (Nppb) (n=6 per group) (F), EF (n=6 per group) (G), FS (n=6 per group) (H), LV mass (n=6 per group) (I), and LVIDs (n=6 per group) (J). All results represent mean± SD, an unpaired two-tailed Student’s t-test. Representative images and statistics (K) of Masson’s trichrome-stained hearts 4 weeks after TAC (n=3 per group). All results represent mean ± SD, an unpaired two-tailed Student’s t-test. EF, ejection fraction; FS, fractional shortening; LV, left ventricle; TAC, transverse aortic constriction; WGA, wheat germ agglutinin.

The TRPV4 antagonist improves neonatal rat ventricular myocytes hypertrophy in vitro

Next, we sought to determine whether TRPV4 activation contributes to cardiomyocyte hypertrophy in vitro. Neonatal rat ventricular myocytes (NRVMs) were isolated from neonatal Sprague-Dawley (SD) rats and treated with angiotensin II (Ang II) or phenylephrine (PE) for 48 h. We found that AngII-stimulated cardiac hypertrophy, as indicated by increases in cell surface area (Figure 6A–B) and the expression of ANP (Nppa) and BNP (Nppb) (Figure 6C–D), was largely inhibited by the TRPV4 specific antagonist GSK3874. Similarly, PE-induced CM hypertrophy was also attenuated by GSK3874 (Figure 6E–H). Taken together, our results confirm that TRPV4 activation contributes to cardiac hypertrophy in vitro.
Figure 6.

TRPV4 blockade attenuates AngII/PE-induced hypertrophy in NRVMs in vitro.

Representative images (A) and statistics of the cell-surface areas (B) in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=20 cells from three animals). Statistics of ANP (Nppa) (C) and BNP (Nppb) (D) mRNA levels in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=6 per group). Representative images (E) and statistics of the cell-surface areas (F) in NRVMs treated with DMSO, PE, and PE plus GSK3874 (n=20 cells from three animals). Statistics of ANP (Nppa) (G) and BNP (Nppb) (H) mRNA levels in NRVMs treated with DMSO, PE, and PE plus GSK3874 (n=6 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. NRVM, neonatal rat ventricular myocyte.

TRPV4 blockade attenuates AngII/PE-induced hypertrophy in NRVMs in vitro.

Representative images (A) and statistics of the cell-surface areas (B) in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=20 cells from three animals). Statistics of ANP (Nppa) (C) and BNP (Nppb) (D) mRNA levels in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=6 per group). Representative images (E) and statistics of the cell-surface areas (F) in NRVMs treated with DMSO, PE, and PE plus GSK3874 (n=20 cells from three animals). Statistics of ANP (Nppa) (G) and BNP (Nppb) (H) mRNA levels in NRVMs treated with DMSO, PE, and PE plus GSK3874 (n=6 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. NRVM, neonatal rat ventricular myocyte.

TRPV4 antagonist alleviates AngII/PE-induced Ca2+ overload in NRVMs

It is well known that [Ca2+]i increases in response to sustained hypertrophy. We have previously shown that TRPV4 is functionally expressed in cardiomyocytes and mediates Ca2+ influx upon activation (Wu et al., 2017b). Here, we found that TRPV4 protein and mRNA expression were significantly increased in NRVMs after being treated with AngII (Figure 7A–C and Source data 1). To correlate TRPV4 expression to functional channel, changes in [Ca2+]i in response to the specific TRPV4 agonist GSK1016790A (GSK790A, 500 nM), were measured in NRVMs after AngII stimulation. As shown in Figure 7D–E, GSK790A induced robust Ca2+ influx, which was further enhanced after stimulation with AngII. However, pre-incubation of GSK3874 could inhibit this enhanced response. Note that treatment with AngII or AngII+GSK3874 did not affect Ca2+ influx induced by A23187 (Figure 7F). Similar results were also obtained from NRVMs after PE stimulation (Figure 7G–I). Our results indicate that TRPV4 activation may be implicated in the [Ca2+]i rise induced by sustained hypertrophy.
Figure 7.

TRPV4 blockade attenuates AngII/PE-induced Ca2+ overload in NRVMs.

Representative immunoblot image (A) and statistics (B) of TRPV4 protein level in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=6 per group). (C). Statistical data of Trpv4 mRNA level in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=6 per group). Representative recording of changes in intracellular Ca2+ induced by 500 nM GSK 790A and 1 μM A23187 in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (D). Quantification of [Ca2+]i response induced by GSK790A (E) and A23187 (F) -induced in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=18 per group). Representative recording of changes in intracellular Ca2+ induced by 500 nM GSK 790A and 1 μM A23187 in NRVMs treated with DMSO, PE, and PE plus GSK3874 (G). Quantification of [Ca2+]i response induced by GSK790A (H) and A23187 (I)-induced in NRVMs treated with DMSO, PE, and PE plus GSK3874 (n=12 per group). The arrow indicates the time of addition of GSK1016790A and A21387. F0 represents the average fluorescence intensity before GSK1016790A stimulation. All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. NRVM, neonatal rat ventricular myocyte.

TRPV4 blockade attenuates AngII/PE-induced Ca2+ overload in NRVMs.

Representative immunoblot image (A) and statistics (B) of TRPV4 protein level in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=6 per group). (C). Statistical data of Trpv4 mRNA level in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=6 per group). Representative recording of changes in intracellular Ca2+ induced by 500 nM GSK 790A and 1 μM A23187 in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (D). Quantification of [Ca2+]i response induced by GSK790A (E) and A23187 (F) -induced in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=18 per group). Representative recording of changes in intracellular Ca2+ induced by 500 nM GSK 790A and 1 μM A23187 in NRVMs treated with DMSO, PE, and PE plus GSK3874 (G). Quantification of [Ca2+]i response induced by GSK790A (H) and A23187 (I)-induced in NRVMs treated with DMSO, PE, and PE plus GSK3874 (n=12 per group). The arrow indicates the time of addition of GSK1016790A and A21387. F0 represents the average fluorescence intensity before GSK1016790A stimulation. All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. NRVM, neonatal rat ventricular myocyte.

TRPV4 activation contributes to CaMKII phosphorylated

Ca2+/calmodulin-dependent protein kinase II (CaMKII) is upregulated after pressure overload and plays an essential role in cardiac hypertrophy and the progression of heart failure (Ljubojevic-Holzer et al., 2020; Zhang et al., 2003). More importantly, Ca2+ entry via TRPV4 can activate CaMKII in many other cells (Lyons et al., 2017; Woolums et al., 2020; Zhou et al., 2021). Therefore, we hypothesized that TRPV4 activation contributes to cardiac hypertrophy through CaMKII. We first investigated the role of TRPV4 on CaMKII activation. Using NRVMs in vitro, we found that treatment with TRPV4 agonist GSK790A for 30 min markedly increased the expression of p-CaMKII (Thr287) compared with the DMSO group. However, GSK790A-induced activation of CaMKII was significantly blocked by either pretreating with TRPV4 antagonist GSK3874 or removing extracellular Ca2+, demonstrating that TRPV4-mediated Ca2+ influx promotes the activation of CaMKII (Figure 8A–D and Source data 1).
Figure 8.

TRPV4 activation induces CaMKII phosphorylation.

Representative immunoblot image (A) and statistics (B) of p-CaMKII/CaMKII in NRVMs treated with DMSO, GSK790A, and GSK790A plus GSK3874 (n=4 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. Representative immunoblot image (C) and statistics (D) of p-CaMKII/CaMKII in NRVMs treated with GSK790A in the absence and presence of Ca2+ medium (n=6 per group). All results represent mean ± SD, an unpaired two-tailed student’s t-test. Representative immunoblot image (E) and statistics (F) of p-CaMKII/CaMKII in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=4 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. Representative immunoblot image (G) and statistics (H) of p-CaMKII/CaMKII in the LV from sham or TAC WT mice at indicated time points after the operation (n=6 per group). All results represent mean ± SD, an unpaired two-tailed student’s t-test. Representative immunoblot image (I) and statistics (J) of p-CaMKII/CaMKII in Trpv4 KO mice 1 week or 4 weeks after sham or TAC operation (n=6 per group). All results represent mean ± SD, an unpaired two-tailed student’s t-test. NRVM, neonatal rat ventricular myocyte.

TRPV4 activation induces CaMKII phosphorylation.

Representative immunoblot image (A) and statistics (B) of p-CaMKII/CaMKII in NRVMs treated with DMSO, GSK790A, and GSK790A plus GSK3874 (n=4 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. Representative immunoblot image (C) and statistics (D) of p-CaMKII/CaMKII in NRVMs treated with GSK790A in the absence and presence of Ca2+ medium (n=6 per group). All results represent mean ± SD, an unpaired two-tailed student’s t-test. Representative immunoblot image (E) and statistics (F) of p-CaMKII/CaMKII in NRVMs treated with DMSO, AngII, and AngII plus GSK3874 (n=4 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. Representative immunoblot image (G) and statistics (H) of p-CaMKII/CaMKII in the LV from sham or TAC WT mice at indicated time points after the operation (n=6 per group). All results represent mean ± SD, an unpaired two-tailed student’s t-test. Representative immunoblot image (I) and statistics (J) of p-CaMKII/CaMKII in Trpv4 KO mice 1 week or 4 weeks after sham or TAC operation (n=6 per group). All results represent mean ± SD, an unpaired two-tailed student’s t-test. NRVM, neonatal rat ventricular myocyte. Consistent with previous studies (Xiao et al., 2018), NRVMs-stimulated AngII for 48 h showed a twofold increase in p-CaMKII, and this response was largely abrogated by pretreatment with GSK3874 (Figure 8E–F, Source data 1). We also examined the phosphorylation of CaMKII at 2 days, 1 week, 2 weeks, and 4 weeks after TAC in WT mice. Similar to our observation of TRPV4 expression, p-CaMKII began to increase 1 week after the operation and remained at a high level 4 weeks after TAC (Figure 8G–H, Source data 1). More interestingly, the TAC-induced upregulation of p-CaMKII in WT mice 1 or 4 weeks was not observed in Trpv4 KO mice (Figure 8I–J and Source data 1). Our results indicate that TRPV4 activation is required for the phosphorylation of CaMKII in response to pressure overload.

TRPV4 activation promotes NFκB phosphorylation via a CaMKII-dependent manner

As shown in Figure 9A–B and Source data 1, a short-term (30 min) treatment with TRPV4 agonist GSK790A also dramatically increased the level of phosphorylated NFκB p65 in NRVMs. This effect was abolished by pretreatment with TRPV4 antagonist GSK3874. Furthermore, AngII-induced phosphorylation of NFκB p65 was also prevented by pretreatment with GSK3874 (Figure 9C–D and Source data 1). Therefore, TRPV4 activation may promote the phosphorylation of NFκB p65.
Figure 9.

TRPV4 activation induces NFκB phosphorylation via a CaMKII signaling pathway.

Representative immunoblot image (A) and statistics (B) of p-p65 /p65 in NRVMs treated with DMSO, GSK790A, and GSK790A plus GSK3874 (n=6 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. Representative immunoblot image (C) and statistics (D) of p-p65 /p65 in NRVMs treated DMSO, AngII, and AngII plus GSK3874 (n=6 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. Representative immunoblot image (E) and statistics (F) of p-p65 /p65 in NRVMs treated with DMSO, GSK790A, GSK790A plus KN92, and GSK790A plus KN93 (n=6 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test.

TRPV4 activation induces NFκB phosphorylation via a CaMKII signaling pathway.

Representative immunoblot image (A) and statistics (B) of p-p65 /p65 in NRVMs treated with DMSO, GSK790A, and GSK790A plus GSK3874 (n=6 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. Representative immunoblot image (C) and statistics (D) of p-p65 /p65 in NRVMs treated DMSO, AngII, and AngII plus GSK3874 (n=6 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. Representative immunoblot image (E) and statistics (F) of p-p65 /p65 in NRVMs treated with DMSO, GSK790A, GSK790A plus KN92, and GSK790A plus KN93 (n=6 per group). All results represent mean ± SD, a one-way ANOVA followed by the Bonferroni test. We then asked how TRPV4 activation is linked to NFκB signaling. Since the phosphorylation of NFκB could be regulated by the CaMKII signaling pathway (Ling et al., 2013), we examined the involvement of CaMKII. Indeed, the application of the CaMKII inhibitor, KN93 (2 μM), but not its inactive analog KN92 (2 μM), abolished the GSK790A-stimulated NFκB p65 phosphorylation in NRVMs (Figure 9E–F and Source data 1), supporting the role of CaMKII in linking TRPV4-mediated Ca2+ influx to NFκB activation.

Discussion

In this study, we characterized the functional role of TRPV4 in pressure-induced cardiac hypertrophy and heart failure. We showed that TRPV4 activation promoted the development of pathological cardiac hypertrophy and heart failure. This effect was associated with Ca2+-mediated CaMKII phosphorylation and subsequently the activation of NFκB-NLRP3 (Figure 10). These results suggest that TRPV4 may be a potential therapeutic target for cardiac hypertrophy and heart failure.
Figure 10.

Schematic illustration of potential mechanisms through which TRPV4 activation promotes pathological cardiac hypertrophy.

As a non-selective calcium ion channel, TRPV4 is widely expressed in the cardiovascular system and mediates cellular responses to a variety of environmental stimuli including hypo-osmolality, shear stress, and heat (Hof et al., 2019; Randhawa and Jaggi, 2015). Previous studies, including our own, have demonstrated that TRPV4 is functionally expressed in hearts (Chaigne et al., 2021; Peana et al., 2022; Wu et al., 2017a) and its mRNA or protein expression level can be upregulated by pressure overload (Morine et al., 2016), following ischemia-reperfusion (Dong et al., 2017; Jones et al., 2019; Wu et al., 2017a), under inflammation conditions (Kumar et al., 2020; Liao et al., 2020), as well as after the application of TRPV4 agonist GSK790A (Adapala et al., 2016). TRPV4 activation induces Ca2+ influx and increases [Ca2+]i, which may subsequently promote cardiac remodeling and cardiac dysfunction. In the present study, we found that TRPV4 expression was significantly increased in mice hypertrophy hearts, human failing hearts, and AngII-induced hypertrophic cardiomyocytes, suggesting that TRPV4 was implicated in the processes of cardiac hypertrophy and failure. Previous studies have reported that Ang II can enhance TRPV4 activity and increase TRPV4 expression, through the activation of the AT1 receptor involving the PKC and Src kinase pathway, respectively (Mercado et al., 2014; Saxena et al., 2014). Future studies addressing TRPV4 upregulation in the context of cardiac hypertrophy are needed. Furthermore, the inhibition of TRPV4 by genetic deletion or antagonist GSK3874 attenuated TAC-induced cardiac hypertrophy and subsequence heart failure in vivo. Our in vitro experiments showed that TRPV4 blockade protected cardiac hypertrophy induced by AngII. Concomitant with this protection was the downregulation of multiple proteins and transcriptional markers associated with the initiation and the progression of hypertrophy, inflammation, fibrosis, and heart failure. However, the mechanosensitive of TRPV4 remains controversial. TRPV4 has been found to be directly activated by membrane stretch in Xenopus laevis oocytes (Loukin et al., 2010), but membrane stretch fails to open mammalian TRPV4 (Nikolaev et al., 2019). Therefore, TRPV4 could be a downstream signal initiated by a primary mechanoreceptor, such as Piezo1. Following membrane stretch, Piezo1 is activated, causing a transient Ca2+ influx as well as increased phospholipase A2 (PLA2) activity. PLA2-dependent arachidonic acid metabolites then activate TRPV4, which is observed after the osmotic stimulus and shear stress (Gorelick and Nathanson, 2020; Watanabe et al., 2003). Indeed, very recent studies have provided evidence that Piezo1 acts as the primary mechanoreceptor and initiates the cardiac hypertrophic response to pressure overload (Guo et al., 2021a; Yu et al., 2021). However, further studies are required to investigate the close interaction of TRPV4 with Piezo1 in pathological cardiac hypertrophy. Recent studies have suggested that Ca2+ influx through TRPV4 can result in the activation of CaMKII (Lyons et al., 2017; Woolums et al., 2020). CaMKII can be rapidly activated in response to pressure overload and plays an essential role in cardiac hypertrophy and decompensation to heart failure (Baier et al., 2020; Swaminathan et al., 2012). Therefore, we hypothesized that TRPV4 experiences mechanical stress, mediates Ca2+ entry, and subsequently activates pro-hypertrophic signaling responses. Similar to our previous findings (Wu et al., 2017a), the TRPV4 agonist GSK790A induced robust Ca2+ entry in NRVMs. We also found that GSK790A induced rapid phosphorylation of CaMKII, which could be prevented by TRPV4 antagonist and extracellular Ca2+ removal, demonstrating that Ca2+ entry following TRPV4 activation leads to CaMKII phosphorylation. Furthermore, AngII/PE-induced [Ca2+]i rise, as well as the phosphorylation of CaMKII in NRVMs, was significantly reduced by the TRPV4 antagonist. Previous studies have also shown that Ang II/PE promotes the phosphorylation of CaMKII, increases CaMKII activity, and subsequently mediates cardiac hypertrophy (Helmstadter et al., 2021; Nakamura and Sadoshima, 2018; Tonegawa et al., 2017). However, the calcineurin/NFAT pathway may play a more important role in AngII-induced cardiac hypertrophy (Yu et al., 2021). In addition, our in vivo studies showed that the phosphorylation of CaMKII began to increase at 1 week and maintained higher levels 4 weeks after TAC, which was following the same trend of TRPV4 upregulation. More importantly, TAC-induced CaMKII phosphorylation was markedly blunted by genetic TRPV4 deletion. The evidence supports that TRPV4 plays a key role in mediating CaMKII activation during cardiac hypertrophy development. Recent studies have shown that the activation of CaMKII triggers NFκB-NLRP3 activation and leads to inflammation, which is important for the initiation and progression of pathological cardiac hypertrophy (Suetomi et al., 2018; Willeford et al., 2018). We found that TAC induced increases in IL-1β, IL-6, TNF-α, MIP-2, and MCP-1 expression. Meanwhile, the phosphorylation of p-65 and the expression of NLRP3, ASC, and cleaved caspase-1 were upregulated in WT mice. The above-enhanced effects, however, were diminished in Trpv4 KO mice. Similarly, AngII/PE-induced upregulation of p-65 phosphorylation in NRVMs was reduced by pretreatment with a TRPV4 antagonist. These results suggest that TRPV4 activation promotes NFκB-NLRP3 activation and inflammation in response to pressure overload, which further demonstrates a mechanism for TRPV4 in this response. Several other studies have also found that TRPV4 activation induces inflammation through the NFκB-NLRP3 signaling pathway (Wang et al., 2021; Wang et al., 2019b). In addition, we found that GSK790A also induced rapid phosphorylation of NFκB, which could be prevented by KN-93 for CaMKII inhibition, and this implies that CaMKII is involved in TRPV4 activation-induced phosphorylation of NFκB. Therefore, our data continue to highlight the importance of TRPV4-mediated Ca2+ in intracellular signaling pathways and raise the possibility that TRPV4 activation promotes Ca2+ influx, leads to the phosphorylation of CaMKII, and subsequently triggers the activation of NFκB-NLRP3, thus contributing to adverse cardiac remodeling. An important limitation of our investigation is the use of the systemic functional abrogation TRPV4 model. TRPV4 is also expressed in cardiac fibroblasts and endothelial cells. Therefore, the effect of TRPV4 deletion on cardiac remodeling and dysfunction is not limited to cardiomyocytes. Indeed, the deletion of endothelial TRPV4 has been found to suppress TAC-induced cardiac hypertrophy and dysfunction via increased coronary angiogenesis and reduced cardiac fibrosis (Adapala et al., 2019). Interactions with cardiac fibroblasts or endothelial cells will need further study. Although the upregulation of TRPV4 was consistent in mouse hypertrophy hearts and human failing hearts, our data do not provide conclusive evidence about the involvement of TRPV4 in hypertensive cardiac damage in patients. Further human studies are needed to verify our results. Collectively, our findings imply that TRPV4 might be a stress response molecule that is upregulated in cardiac hypertrophy. Activation of TRPV4 induced increases in Ca2+ influx, activated CaMKII, enhanced pro-inflammatory NFκB-NLRP3 signaling, and promoted inflammation response, thus contributing to pathological cardiac remodeling. TRPV4 antagonism provides an exploitable therapeutic advantage for the treatment of cardiac hypertrophy and subsequent heart failure.

Materials and methods

Human heart tissues

Explanted, heart failure tissues were obtained from five patients with dilated cardiomyopathy (DCM) undergoing cardiac transplantation. All patients were diagnosed with DCM with EF less than 40% at least 3 months prior to heart transplantation. Non-heart failure tissues were obtained from three organ donors whose hearts could not be placed due to size issues, ABO mismatch, or other factors. The clinical data of patients have been shown in Appendix 1—table 2. The study was in accordance with the Declaration of Helsinki (as revised in 2013). The study was reviewed and approved by the Ethics Committee of Union Hospital, Tongji Medical College, Huazhong University of Science and Technology (Wuhan, China; approval number: UHCT-IEC-SOP-016-03-01). Written informed consent and consent to publish were obtained from all the patients.
Appendix 1—table 2.

Clinical characteristics of patients with advanced heart failure.

PatientAge (y)GenderEFNYHA
DCM 152Male22.5IV
DCM 247Male12.6III
DCM 346Male15.9IV
DCM 420Male15III
DCM 530Female21IV
Control 135MaleI
Control 227MaleI
Control 340MaleI

DCM: dilated cardiomyopathy, EF: ejection fraction, NYHA: New York Heart Association.

Animals

Male C57BL/6 mice and newborn SD rats were purchased from the Laboratory Animal Center, Xuzhou Medical University (Xuzhou, China). Trpv4 KO mice were generated on the C57BL/6 background, as described previously (Dong et al., 2017; Mizuno et al., 2003). Genotyping was performed by PCR using ear punch/tail snip biopsies with the following primers: WT forward primer 5ʹ-TGTTCGGGTGGTTTGGCCAGGATAT-3ʹ and reverse primer 5ʹ-GGTGAACCAAAGGACACTTGCATAG-3ʹ, which produce a 796 bp product from the WT allele; knockout forward primer 5ʹ-GCTGCATACGCTTGATCCGGCTAC-3ʹ and reverse primer 5ʹ-TAAAGCACGAGG AAGCGGTCAGCC-3ʹ, which produce a 366-bp product from the target allele (Appendix 1—figure 1A). RT-PCR of heart mRNA was used to confirm the deletion of TRPV4 sequence, indicated by a 534-bp cDNA fragment of WT mice, but absent in Trpv4 KO mice (Appendix 1—figure 1B), as previously described (Boudaka et al., 2020). All animal protocols were performed in adherence to the National Institutes of Health Guidelines and were approved by the Experimental Animal Ethics Committee of Xuzhou Medical University (Xuzhou, China; approval number: 202204A084). Animals were housed in a temperature-regulated room (12 h day/12 h night cycle) with ad libitum access to food and water.
Appendix 1—figure 1.

Genotyping of TRPV4 wild-type and Trpv4 KO mice and TRPV4 depletion in the heart of Trpv4 KO mice.

A. Representative RT-PCR genotyping gel image of the WT, Trpv4+/-, and Trpv4-/-. B. RT-PCR of total RNA from heart showing Trpv4 mRNA was present in WT mice but absent in Trpv4 KO mice.

TAC surgery and treatment

Eight- to twelve-week-old male WT and Trpv4 KO mice were subjected to TAC to induce pressure overload. Mice were anesthetized by intraperitoneal (i.p.) injection of pentobarbital sodium (50  mg/kg), intubated via the oral cavity, and ventilated at 110 breaths/min. Following a sternotomy, the transverse aorta between the right innominate and left carotid arteries was dissected and banded with a blunt L type 27-gauge needle using a 5-0 silk suture. The needle was then removed. Successful TAC surgery was confirmed by measuring the right carotid/left carotid flow velocity ratio. The sham-operated mice underwent an identical procedure but without aortic constriction. WT mice were treated with vehicle (6% Cavitron) or GSK3874 (10 mg/kg/d) via oral gavage for 4 weeks after TAC (Liao et al., 2020; Thorneloe et al., 2012).

Echocardiography

Echocardiography was performed by using a Vevo 2100 Ultrasound System (Visual Sonics, Toronto, Canada), as described in a previous study (Chen et al., 2019). Briefly, the mice were anesthetized with isoflurane. Parasternal long- and short-axis views in B- and M-Mode were recorded when the heart rate of the mice was maintained at 430–480 beats/min. The EF, FS, left ventricular end-systolic diameter (LVID), LV mass, and other function parameters were calculated with Vevo LAB software (Visual Sonics) by a technician who was blinded to the treatment groups.

Tissue collection

After the echo examination, the heart was harvested and rinsed with cold phosphate-buffered saline. After being weighted, the LV was cut into two parts. The top part was put into 4% paraformaldehyde for histological analysis, and the bottom part was quickly put into liquid nitrogen and transferred to a –80° freezer later. The HW normalized to BW and TL were measured as indicators of cardiac hypertrophy (Zhao et al., 2016).

Histological analyses

For histological analysis, transverse LV sections were cut into 4 μm slices. The hematoxylin and eosin staining was performed to analyze the histological change. Masson’s trichrome stain was performed to assess cardiac fibrosis. FITC-conjugated wheat germ agglutinin was performed to determine cell size. A quantitative digital image analysis system (ImageJ software) was used in image measurement.

Isolation of NRVMs and treatment

NRVMs were isolated according to previously established protocols (Golden et al., 2012). In brief, LV from 1- to 3-day-old SD rats was harvested and digested in the presence of 0.5 mg/ml collagenase II at 37°C. NRVMs were further purified by Percoll gradient centrifugation. Cells were plated at a density of 2.5×105 cells/cm2 on collagen-coated plates and cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 15% fetal bovine serum (FBS; Hyclone, USA), 100 units/ml penicillin, 100 μg/ml streptomycin, and 2 μg/ml cytosine arabinoside. The next morning, the media were changed to FBS-free DMEM for 24 hr. Ventricular myocyte hypertrophy was induced by treatment with Ang II or PE for 48 hr. In another group of experiments, cells were treated with TRPV4 agonist GSK790A (500 nM) according to the time required for the experiment, while TRPV4 antagonist GSK3874 (300 nM), KN92 (2.0 μM), and KN93 (2.0 μM) was applied 30 min earlier.

Assessment of cell surface area

NRVMs were stained with antibodies for sarcomeric α-actinin and cell nuclei were counterstained with DAPI. Cell size was examined by TRITC-phalloidin staining assay and measured with ImageJ software.

Calcium fluorescence

Calcium imaging was performed as previously described ( Wang et al., 2019a; Wu et al., 2017b). NRVMs were loaded with Fluo-4/AM (2 μM) and F‐127 (0.03%) for 30 min. Cells in 96-wells plates were illuminated at 488 nm and fluorescence emissions at 525 nm were captured by a multifunctional microplate reader (TECAN, Infinite 200PRO, Swiss). Cells were stimulated with the TRPV4 agonist GSK790A (500 nM). A21387 (1 μM) was set as a positive control.

RNA extraction, cDNA synthesis, and quantitative PCR

Total RNA was extracted from LV tissues or cultured NRVMs using the Extraction Kit according to the manufacturer’s instructions. For cDNA synthesis, 500 ng RNA was reverse transcribed using a high-capacity cDNA reverse transcription kit. Real-time quantitative PCR (qPCR) was performed with SYBR Green PCR Master Mix Kit on a QuantStudio 3 system (Applied Biosystems, Foster City, CA). GAPDH was used as a housekeeper gene for the normalization of gene expression. The primers used in qPCR were listed in the Key resources table. The result for each gene was obtained from at least six independent experiments.

Western blots

Total protein was extracted from LV tissues or cultured NRVMs with RIPA reagent. Then, protein expression was analyzed by standard western blot as described previously (Wu et al., 2020). Briefly, protein (30 μg for each sample) was separated using 10% SDS-polyacrylamide gel electrophoresis and subsequently transferred onto polyvinylidene difluoride membranes (Millipore, Darmstadt, Germany). After 1 hr of blocking with Western blocking buffer (CWbio, Taizhou, China), the membranes were incubated with primary antibody at 4℃. The next day, the membranes were washed with TBST and incubated with corresponding horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 hr at room temperature. Finally, proteins were visualized with the enhanced chemiluminescence kit (Affinity, Ancaster, ON, Canada). Band intensity was quantified by Tanon image plus software (Tanon, Nanjing, China). GAPDH was used as a loading control. The antibodies used in the study were listed in the Key resources table.

Statistical analysis

All statistical data were presented as mean ± SD and analyzed by Graphpad prism 9. An unpaired two-tailed Student’s t-test was used for comparison between the two groups. The differences among multiple groups were analyzed using one-way ANOVA or two-way ANOVA followed by the Bonferroni adjustment for multiple comparisons. p<0.05 was reported as statistically significant. Zou et al., demonstrate that activation of the TRPV4 ion channel is a novel contributor to cardiac hypertrophy, adding to the number of mechanisms known to trigger pathological left ventricular hypertrophy (LVH), While the exact signaling pathway downstream of TRPV4 leading to pathological hypertrophy still remain to be uncovered, the findings that this ion channel contributes to cardiac hypertrophy and that the Piezo1 channel acts upstream of PLA2 and TRPV4 add to our understanding of the pathogenesis of LVH and heart failure. Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work. Decision letter after peer review: Thank you for submitting your article "Activation of transient receptor potential vanilloid 4 is involved in pressure overload-induced cardiac hypertrophy" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by a Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Boris Martinac (Reviewer #3). The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this letter to help you prepare a revised submission. Essential revisions: Despite providing experimental evidence for involvement of the TRPV4 ion channels in LVH and cardiac failure, this study does not yet provide a clear mechanistic explanation about the role of TRPV4 in the cardiac pathology. Significantly more work is required to clarify this issue. In particular, the TRPV4 protein and mRNA expression should have been determined at earlier time points, i.e. at several days or two weeks rather than only at four weeks. Furthermore, as also pointed out by the authors, examining only the effects of a systemic functional deletion of TRPV4 was considered a limitation whereas a cardiomyocyte-specific deletion of TRPV4 in a mouse model would have strengthened the study. 1) To examine if TRPV4 plays a role in cardiac hypertrophy, the authors measured the TRPV4 protein and mRNA expression levels in LV tissue from WT and sham-operated BL/6 mice at a single time point of four weeks after TAC surgery. However, it has been demonstrated that after the period longer than two weeks the hearts of TAC operated BL/6 mice aged 10 or 12 weeks manifested cardiac dysfunction by progressing from hypertrophy to heart failure when additional signaling pathways become activated compared to LVH only. This is also indicated by the findings of this study showing "the progression of hypertrophy, inflammation, fibrosis, and heart failure" (p. 21, line 315). Thus, there is no clear distinction between the TRPV4 involvement in development of LVH vs heart failure. This is further addressed in point 3 below. 2) It is unclear which type of "mechanical loading" (p. 21, line 299) is activating TRPV4. Given the authors' suggestion that TRPV4 activation in pathological cardiac hypertrophy and heart failure occurs in response to pressure overload, does it mean that TRPV4 is activated by membrane stretch? However, this is unlikely because mammalian TRP ion channels are not activated by membrane stretch (Nikolaev et al., J Cell Sci 2019). Consequently, TRPV4 may not play a role as an initiating stressor but is more likely functioning as an upstream signaling transducer (p. 21, line 316). What is then acting upstream of TRPV4 as the primary transducer of the pressure overload? The current study does not answer this relevant question. 3) Yu et al. (Front. Cell Dev. Biol. 2021) reported two ca2+-calmodulin dependent hypertrophic pathways leading to LVH; the first one via AngII acting on Gq-coupled receptors and the second one via TAC-induced pressure overload. Both pathways are ca2+-calmodulin dependent with the AngII one via the ca2+-calmodulin dependent activation of calcineurin and the TAC one via ca2+ -calmodulin dependent activation of CaMKII. What is obscuring the results of this study is that the authors use AngII/PE model of cardiac dysfunction (e.g. p. 22, lines 327-32), which although exhibiting hypertrophy, is unrelated to the TAC-induced LVH. Consequently, the signaling pathways are different, and it remains unclear how TRPV4 is activated in this case. Further complication with the phenylephrine is that in addition to acting as a α1-adrenoceptor agonist it also causes ca2+ store depletion leading to ca2+-induced calcium release from SR through TRPV4 channels (Dryn et al., Int. J. Physiol. Pathophysiol. 2017). 4) The data of the TAC model are convincing, and the TRPV4-/- animals are protected from hypertrophy. But what is really missing is the attempt to show that TRPV4 inhibition by GSK2193874 is protective and/or provides a therapeutic option which is able to reduce pro-inflammatory downstream signaling. 5) In line 65-66/306-307: The authors state here that "TRPV4 has not been reported in association with pressure overload-induced cardiac hypertrophy", but Adapala et al., 2019 published an abstract showing a role of endothelial TRPV4 in coronary microvascular function during TAC-induced hypertrophy. Therefore, this statement is not correct, and it would be recommendable to change this statement and to expand the discussion/introduction on endothelial-mediated effects in this model. Adapala, R., Kanugula, A.K., Ohanyan, V.A., Paruchuri, S.M., Chilian, W.M., Thodeti, C.K., 2019. Abstract 15843: Endothelial TRPV4 Deletion Protects Myocardium Against Pressure Overload Induced Hypertrophy via Preserved Angiogenesis and Reduced Cardiac Fibrosis. Circulation 140, A15843-A15843. https://doi.org/10.1161/circ.140.suppl_1.15843 6) The authors refer in the discussion to many studies showing upregulation of TRPV4 (line 302-304) in models of sterile inflammation, but for the readership it is not quite clear what is meant with upregulation (transcriptional or translational level)? Moreover, the references in this passage should be updated, since some of them (Morine et al., 2016 --> no significant changes; Adapala et al., 2016 --> lower expression in tumor endothelial cells as compared to normal endothelial cells, but no expression data on GSK790A treatment) are not providing data/supporting the statement of an upregulation. The authors should state more precisely, if they mean activation or expression and on which level. This is critical because many studies show that TRPV4 changes are limited at the mRNA or protein level and that the amount of active TRPV4 channels at the plasma membrane is tightly regulated by vesicular transport. 7) Please provide more information and relevant clinical data for the donors of human samples. Essential revisions: 1) To examine if TRPV4 plays a role in cardiac hypertrophy, the authors measured the TRPV4 protein and mRNA expression levels in LV tissue from WT and sham-operated BL/6 mice at a single time point of four weeks after TAC surgery. However, it has been demonstrated that after the period longer than two weeks the hearts of TAC operated BL/6 mice aged 10 or 12 weeks manifested cardiac dysfunction by progressing from hypertrophy to heart failure when additional signaling pathways become activated compared to LVH only. This is also indicated by the findings of this study showing "the progression of hypertrophy, inflammation, fibrosis, and heart failure" (p. 21, line 315). Thus, there is no clear distinction between the TRPV4 involvement in development of LVH vs heart failure. This is further addressed in point 3 below. Thank you very much for the excellent and professional review of our manuscript. Based on your suggestion, we performed the additional experiments on day 2, day 7, and day 14 after TAC. The protein and mRNA levels of TRPV4 were measured at different time points (2, 7, 14, 28 days) after surgery. We have added the result in the new Figures 1 A-C. We have also added the new Table 1 in Appendix 1, which has listed HW/BW, HW/TL, EF, FS, and the mRNA expression of ANP, BNP, Collagen I, and Collagen III after TAC in WT mice. On pages 4-5, lines 82-90, we now write: “Consistent with the previous observation (Guo, et al.,2021), we did not detect significant cardiac hypertrophy on day 2 after TAC. The 1-week TAC time point gave a sample in which the heart was undergoing compensated cardiac hypertrophy, while the 2- and 4-week TAC showed signs of decompensated cardiac hypertrophy with heart failure (Appendix 1-table 1). Similar findings have been previously reported (Wu, et al.,2017). Nonetheless, there are conflicting results for changes in cardiac function, particularly at 2 weeks after TAC, likely caused by differences in severity of constriction. As shown in Figures 1A-C, figure 1-supplement 1, the protein and mRNA level of TRPV4 began to increase 1 week after TAC and maintained a higher level on week 4.” To further investigate the role of TRPV4 in cardiac hypertrophy, WT and TRPV4-/- mice were subjected to either TAC or sham operation and hypertrophic responses were evaluated at 1 week. We have added the result in the new Figures 2 A-C and revised the second paragraph of the Results section. On pages 9-10, lines 129-149, we now write: “To further investigate the role of TRPV4 in cardiac hypertrophy induced by pressure overload, we performed TAC or sham surgery in WT and TRPV4 knock-out (Trpv KO) mice. The hypertrophic response was evaluated 1 week and 4 weeks after TAC. We used the ratios of heart weight/body weight (HW/BW) and heart weight /tibial length (HW/TL) to assess changes in LV mass (Figure 2A). As expected, both values were significantly increased after TAC in WT mice. However, this hypertrophic response to TAC was attenuated in Trpv4 KO mice at 1 week or 4 weeks. Next, we measured the cross-sectional area of myocytes in all groups. As shown in Figure 2B, Trpv4 KO mice significantly attenuated TAC-induced enlargement of myocytes size 1 week or 4 weeks after TAC. In order to confirm our findings at the molecular level, we then determined cardiac hypertrophic marker genes expression. Both ANP (Nppa) and BNP (Nppb) mRNA expression were significantly higher in WT hearts compared with Trpv4 KO hearts 1 week or 4 weeks after TAC. There was no significant difference between WT and Trpv4 KO in the sham group (Figure 2C). These results suggest that TRPV4 activation plays a critical role in pressure overload-induced cardiac hypertrophy.” We further examined the activation of CaMKII at 2 days, 1 week, 2 weeks, and 4 weeks after TAC in WT mice. We have added the result in the new Figures 8 G-H. On page 28, lines 366-373, we now write: “We also examined the phosphorylation of CaMKII at 2 days, 1 week, 2 weeks, and 4 weeks after TAC in WT mice. Similar to our observation of TRPV4 expression, p-CaMKII began to increase 1 week after the operation and remained at a high level 4 weeks after TAC (Figures 8G-H, figure 8 -supplement 3). More interestingly, the TAC-induced upregulation of p-CaMKII in WT mice 1 or 4 weeks was not observed in Trpv4 KO mice (Figures 8I-J, figure 8 -supplement 4). Our results indicate that TRPV4 activation is required for the phosphorylation of CaMKII in response to pressure overload.” On page 39, lines 502-504 in the Discussion subsection, we now write: “In addition, our in vivo studies showed that the phosphorylation of CaMKII began to increase at 1 week and maintained higher levels 4 weeks after TAC, which was following the same trend of TRPV4 upregulation.”. In conclusion, TRPV4 began to increase at 1 week and maintained a higher level 4 weeks after TAC. TRPV4-/- mice, compared with wild type, resulted in significantly reduced cardiac hypertrophy 1 week or 4 weeks after TAC and had improved heart function 4 weeks after TAC. Our results suggest that TRPV4 activation plays a critical role in pressure overload-induced cardiac hypertrophy and heart failure. 2) It is unclear which type of "mechanical loading" (p. 21, line 299) is activating TRPV4. Given the authors' suggestion that TRPV4 activation in pathological cardiac hypertrophy and heart failure occurs in response to pressure overload, does it mean that TRPV4 is activated by membrane stretch? However, this is unlikely because mammalian TRP ion channels are not activated by membrane stretch (Nikolaev et al., J Cell Sci 2019). Consequently, TRPV4 may not play a role as an initiating stressor but is more likely functioning as an upstream signaling transducer (p. 21, line 316). What is then acting upstream of TRPV4 as the primary transducer of the pressure overload? The current study does not answer this relevant question. Conventionally, the pathological mechanical load has been categorized into pressure- and volume-overload. TAC induces pressure overload and changes the stretch tension of cell membrane. TRPV4 has been found to be directly activated by membrane stretch in Xenopus laevis oocytes (Loukin, et al.,2010). However, membrane stretch fails to open mammalian TRPV4 (Nikolaev, et al.,2019). Therefore, TRPV4 could be a downstream signal initiated by a primary mechanoreceptor, such as Piezo1. Following membrane stretch, Piezo1 is activated, causing a transient calcium influx as well as increased phospholipase A2 (PLA2) activity. PLA2-dependent arachidonic acid metabolites then activate TRPV4, which is observed after the osmotic stimulus and shear stress (Gorelick and Nathanson,2020; Watanabe, et al.,2003). Indeed, very recent studies have provided evidence that Piezo1 acts as the primary mechanoreceptor and initiates the cardiac hypertrophic response to pressure overload (Guo, et al.,2021; Yu, et al.,2021). However, further studies are required to investigate a tight interaction of TRPV4 with Piezo1 in pathological cardiac hypertrophy. The above information has been added in lines 475-486. 3) Yu et al. (Front. Cell Dev. Biol. 2021) reported two ca2+-calmodulin dependent hypertrophic pathways leading to LVH; the first one via AngII acting on Gq-coupled receptors and the second one via TAC-induced pressure overload. Both pathways are ca2+-calmodulin dependent with the AngII one via the ca2+-calmodulin dependent activation of calcineurin and the TAC one via ca2+ -calmodulin dependent activation of CaMKII. What is obscuring the results of this study is that the authors use AngII/PE model of cardiac dysfunction (e.g. p. 22, lines 327-32), which although exhibiting hypertrophy, is unrelated to the TAC-induced LVH. Consequently, the signaling pathways are different, and it remains unclear how TRPV4 is activated in this case. Further complication with the phenylephrine is that in addition to acting as a α1-adrenoceptor agonist it also causes ca2+ store depletion leading to ca2+-induced calcium release from SR through TRPV4 channels (Dryn et al., Int. J. Physiol. Pathophysiol. 2017). Ang II can potently induce cardiac hypertrophy both in vivo and in vitro. The calcineurin/NFAT pathway has been identified as a likely mechanism (Yu, et al.,2021). However, Ang II also promotes the phosphorylation of CaMKII and increases CaMKII activity in cardiomyocytes (Nakamura and Sadoshima,2018). Similar to our finding, Yang et al (Yang, et al.,2021) have shown that Ang II treatment significantly increases CaMKII phosphorylation in cultured neonatal rat ventricular myocytes (NRVMs). CaMKII induces phosphorylation of the class II histone deacetylase 4 (HDAC4), promotes HDAC4 nuclear report, and then causes cardiac hypertrophy. This pathway has been demonstrated to mediate TAC-induced cardiac hypertrophy (Yu, et al.,2021). Interestingly, pretreatment with KN-93 (a potent CaMKII inhibitor) prevents the Ang II induced-nuclear report of HDAC4 (Helmstadter, et al.,2021). Therefore, the CaMKII pathway might also involve in Ang II-induced cardiac remodeling. Ang II increases reactive oxygen species (ROS) production and subsequently enhances CaMKII activity (Palomeque, et al.,2009). In a previous study, we reported that TRPV4 activation triggers ca2+ entry and then increases ROS production in cardiomyocytes (Wu, et al.,2017). In the present study, we found that pretreatment with TRPV4 antagonist prevented Ang II-induced CaMKII activation. Therefore, we assumed that TRPV4 activation was required for Ang II-induced CaMKII activation. Previous studies have also reported that Ang II can enhance TRPV4 activity and increase TRPV4 expression, through the activation of the AT1 receptor involving the PKC and Src kinase pathway, respectively (Mercado, et al.,2014; Saxena, et al.,2014). However, future studies addressing the cross-talk between TRPV4 and AngII in the context of cardiac hypertension are needed. Similar to Ang II, PE can also promote cardiac hypertrophy both in vivo and in vitro. PE, the α-adrenergic receptor agonist, can activate the Gq/11 subfamily of G proteins, leading to the activation of phospholipase C (PLC). The PLC hydrolysis of phosphatidylinositol 4,5-bisphosphate produces two second messengers, inositol 1,4,5-trisphosphate (IP3) and 1,2-diacylglycerol (DAG). IP3 has been found to increase ca2+ influx via TRPV4 (Garcia-Elias, et al.,2008; Hong, et al.,2018; Takahashi, et al.,2014). In addition, PE may increase TRPV4 activity via the DAG/PKC signal pathway. Many previous studies have shown that PE increases the phosphorylation of CaMKII and subsequently induces cardiac hypertrophy (Ji, et al.,2017; Ramirez, et al.,1997; Tonegawa, et al.,2017). On lines 463-467, we now write: “Previous studies have reported that Ang II can enhance TRPV4 activity and increase TRPV4 expression, through the activation of AT1 receptor involving the PKC and Src kinase pathway, respectively (Mercado, et al.,2014; Saxena, et al.,2014). Future studies addressing TRPV4 upregulation in the context of cardiac hypertrophy are needed.” On lines 498-502, we now write: “Previous studies have also shown that Ang II/PE promotes the phosphorylation of CaMKII, increases CaMKII activity, and subsequently mediates cardiac hypertrophy (Helmstadter, et al.,2021; Nakamura and Sadoshima,2018; Tonegawa, et al.,2017). However, the calcineurin/NFAT pathway may play a more important role in AngII-induced cardiac hypertrophy (Yu, et al.,2021).” 4) The data of the TAC model are convincing, and the TRPV4-/- animals are protected from hypertrophy. But what is really missing is the attempt to show that TRPV4 inhibition by GSK2193874 is protective and/or provides a therapeutic option which is able to reduce pro-inflammatory downstream signaling. As you suggested, we performed an additional experiment to investigate the therapeutic role of the TRPV4 antagonist GSK2193874 in TAC-induced hypertrophy and heart failure. As expected, GSK2193874 protected against pressure overload-induced cardiac hypertrophy as evidenced by measuring the mice phenotype, including global heart size, HW/BW ratio, HW/TL ratio, histological examinations of hypertrophy, fibrosis, echocardiographic measurements of systolic function, and mRNA levels of hypertrophic markers. (new Figure 5). The new results have been added in the Results section on pages 20-21. The figures appear in the new Figure 5. The corresponding figure legend has been also added. We have added the text, “Furthermore, the TRPV4 antagonist inhibited cardiac remodeling and dysfunction induced by TAC.” in the Abstract. On pages20-21, lines 259-274, we now write: “TRPV4 antagonist attenuates the pathological cardiac remodeling induced by TAC We further evaluated the effects of TRPV4 inhibition with a specific antagonist GSK2193874 (GSK3874) on pathological cardiac hypertrophy and dysfunction induced by pressure overload. WT mice received intragastric administration of GSK3874 at a dose of 10 mg/kg/d or vehicle from the day of TAC operation (Thorneloe, et al.,2012; Liao, et al.,2020). After 4 weeks, GSK3874 treatment substantially suppressed the increase in heart size induced by TAC (Figure 5A). Moreover, HW/BW and HW/TL ratios significantly decreased in GSK3874-treated mice (Figures 5B-C). The cross-sectional area of cardiomyocytes was also markedly reduced after treatment with GSK3874 (Figure 5D). The mRNA expression of hypertrophy marker genes ANP (Nppa) and BNP (Nppb) was significantly reduced (Figures 5E-F). Echocardiography showed that EF% and FS% were also significantly higher in GSK3874- than in the vehicle-treated group (Figures 5 G-H). LV internal dimension systole and LV mass were significantly smaller following GSK3874 treatment (Figures 5I-J). Finally, the fibrosis area significantly decreased in GSK3874-treated mice (Figure 5K). In summary, these results indicate that GSK3874 treatment effectively reduces cardiac remodeling and dysfunction induced by TAC.” On page 48, lines 598-600, we now write: “WT mice were treated with vehicle (6% Cavitron) or GSK3874 (10 mg/kg/d) via oral gavage for 4 weeks after TAC (Liao, et al.,2020; Thorneloe, et al.,2012).” 5) In line 65-66/306-307: The authors state here that "TRPV4 has not been reported in association with pressure overload-induced cardiac hypertrophy", but Adapala et al., 2019 published an abstract showing a role of endothelial TRPV4 in coronary microvascular function during TAC-induced hypertrophy. Therefore, this statement is not correct, and it would be recommendable to change this statement and to expand the discussion/introduction on endothelial-mediated effects in this model. Adapala, R., Kanugula, A.K., Ohanyan, V.A., Paruchuri, S.M., Chilian, W.M., Thodeti, C.K., 2019. Abstract 15843: Endothelial TRPV4 Deletion Protects Myocardium Against Pressure Overload Induced Hypertrophy via Preserved Angiogenesis and Reduced Cardiac Fibrosis. Circulation 140, A15843-A15843. https://doi.org/10.1161/circ.140.suppl_1.15843 We appreciate and agree with the reviewer’s comments. We have added the response statements to the “Introduction” section in this revised manuscript. On page 4, lines 69-72, we now write: “Moreover, Adapala et al. have reported that endothelial TRPV4 deletion protects TAC-induced-structure remodeling in a conference abstract (Adapala, et al.,2019). However, the role of TRPV4 in the development of pressure overload-induced cardiac hypertrophy is not well understood.”. We also deleted the previous statement “However, there are no data demonstrating the role of TRPV4 in pathological cardiac hypertrophy and heart failure in response to pressure overload.”. In the “Discussion” section, on page 40, lines 531-533, we now write: “Indeed, deletion of endothelial TRPV4 has been found to suppress TAC-induced cardiac hypertrophy and dysfunction via increased coronary angiogenesis and reduced cardiac fibrosis (Adapala, et al.,2019)”. Thank you for your comment. 6) The authors refer in the discussion to many studies showing upregulation of TRPV4 (line 302-304) in models of sterile inflammation, but for the readership it is not quite clear what is meant with upregulation (transcriptional or translational level)? Moreover, the references in this passage should be updated, since some of them (Morine et al., 2016 --> no significant changes; Adapala et al., 2016 --> lower expression in tumor endothelial cells as compared to normal endothelial cells, but no expression data on GSK790A treatment) are not providing data/supporting the statement of an upregulation. The authors should state more precisely, if they mean activation or expression and on which level. This is critical because many studies show that TRPV4 changes are limited at the mRNA or protein level and that the amount of active TRPV4 channels at the plasma membrane is tightly regulated by vesicular transport. As you suggested, we have revised the second paragraph of the “Discussion” section. Please check page 37, line 453. Morine et al., 2016 have shown that the mRNA level of TRPV4 increases more than 8-fold 8 weeks after thoracic aorta constriction in Eng+/+ mice (please check their Figure 3B). Adapala et al. have found that TRPV4 protein level in tumor endothelial cells is lower than normal endothelial cells but can be significantly increased (more than 1.5 -fold) after 24 h treatment with TRPV4 agonist GSK790A (please check their Figure 4 C). Indeed, several other groups have also demonstrated that TRPV4 function is enhanced even if its expression remains unchanged under pathological conditions (Everaerts, et al.,2010; Rahaman, et al.,2014) 7) Please provide more information and relevant clinical data for the donors of human samples. As you suggested, the clinical data of patients have been shown in Appendix 2-table 1. On page 45, lines 549-553, we now write: “All patients were diagnosed with DCM with ejection fraction (EF) less than 40% at least 3 months prior to heart transplantation. Non-heart failure tissues were obtained from three organ donors whose hearts could not be placed due to size issues, ABO mismatch, or other factors. The clinical data of patients have been shown in Appendix 2-table 1. The clinical data of patients have been shown in Appendix 2-table 1.”. References: Everaerts W, Zhen X, Ghosh D, Vriens J, Gevaert T, Gilbert JP, Hayward NJ, McNamara CR, Xue F, Moran MM, Strassmaier T, Uykal E, Owsianik G, Vennekens R, De Ridder D, Nilius B, Fanger CM, Voets T. 2010. Inhibition of the cation channel TRPV4 improves bladder function in mice and rats with cyclophosphamide-induced cystitis. Proc Natl Acad Sci U S A 107:19084-19089. DOI:10.1073/pnas.1005333107, PMID:20956320 Garcia-Elias A, Lorenzo IM, Vicente R, Valverde MA. 2008. IP3 receptor binds to and sensitizes TRPV4 channel to osmotic stimuli via a calmodulin-binding site. J Biol Chem 283:31284-31288. DOI:10.1074/jbc.C800184200, PMID:18826956 Gorelick F, Nathanson MH. 2020. TRPV4 helps Piezo1 put the squeeze on pancreatic acinar cells. J Clin Invest 130:2199-2201. DOI:10.1172/JCI136525, PMID:32281947 Guo Y, Merten AL, Scholer U, Yu ZY, Cvetkovska J, Fatkin D, Feneley MP, Martinac B, Friedrich O. 2021. in vitro cell stretching technology (IsoStretcher) as an approach to unravel Piezo1-mediated cardiac mechanotransduction. Prog Biophys Mol Biol 159:22-33. DOI:10.1016/j.pbiomolbio.2020.07.003, PMID:32763257 Helmstadter KG, Ljubojevic-Holzer S, Wood BM, Taheri KD, Sedej S, Erickson JR, Bossuyt J, Bers DM. 2021. CaMKII and PKA-dependent phosphorylation co-regulate nuclear localization of HDAC4 in adult cardiomyocytes. Basic Res Cardiol 116:11. DOI:10.1007/s00395-021-00850-2, PMID:33590335 Hong K, Cope EL, DeLalio LJ, Marziano C, Isakson BE, Sonkusare SK. 2018. TRPV4 (Transient receptor potential vanilloid 4) Channel-Dependent negative feedback mechanism regulates gq Protein-Coupled Receptor-Induced vasoconstriction. Arterioscler Thromb Vasc Biol 38:542-554. DOI:10.1161/ATVBAHA.117.310038, PMID:29301784 Ji Y, Guo X, Zhang Z, Huang Z, Zhu J, Chen QH, Gui L. 2017. CaMKIIdelta meditates phenylephrine induced cardiomyocyte hypertrophy through store-operated ca2+ entry. Cardiovasc Pathol 27:9-17. DOI:10.1016/j.carpath.2016.11.004, PMID:27940402 Loukin S, Zhou X, Su Z, Saimi Y, Kung C. 2010. Wild-type and brachyolmia-causing mutant TRPV4 channels respond directly to stretch force. J Biol Chem 285:27176-27181. DOI:10.1074/jbc.M110.143370, PMID:20605796 Mercado J, Baylie R, Navedo MF, Yuan C, Scott JD, Nelson MT, Brayden JE, Santana LF. 2014. Local control of TRPV4 channels by AKAP150-targeted PKC in arterial smooth muscle. J Gen Physiol 143:559-575. DOI:10.1085/jgp.201311050, PMID:24778429 Nakamura M, Sadoshima J. 2018. Mechanisms of physiological and pathological cardiac hypertrophy. Nat Rev Cardiol 15:387-407. DOI:10.1038/s41569-018-0007-y, PMID:29674714 Nikolaev YA, Cox CD, Ridone P, Rohde PR, Cordero-Morales JF, Vasquez V, Laver DR, Martinac B. 2019. Mammalian TRP ion channels are insensitive to membrane stretch. J Cell Sci 132:s238360. DOI:10.1242/jcs.238360, PMID:31722978 Palomeque J, Rueda OV, Sapia L, Valverde CA, Salas M, Petroff MV, Mattiazzi A. 2009. Angiotensin II-induced oxidative stress resets the ca2+ dependence of ca2+-calmodulin protein kinase II and promotes a death pathway conserved across different species. Circ Res 105:1204-1212. DOI:10.1161/CIRCRESAHA.109.204172, PMID:19850941 Rahaman SO, Grove LM, Paruchuri S, Southern BD, Abraham S, Niese KA, Scheraga RG, Ghosh S, Thodeti CK, Zhang DX, Moran MM, Schilling WP, Tschumperlin DJ, Olman MA. 2014. TRPV4 mediates myofibroblast differentiation and pulmonary fibrosis in mice. J Clin Invest 124:5225-5238. DOI:10.1172/JCI75331, PMID:25365224 Ramirez MT, Zhao XL, Schulman H, Brown JH. 1997. The nuclear deltaB isoform of ca2+/calmodulin-dependent protein kinase II regulates atrial natriuretic factor gene expression in ventricular myocytes. J Biol Chem 272:31203-31208. DOI:10.1074/jbc.272.49.31203, PMID:9388275 Saxena A, Bachelor M, Park YH, Carreno FR, Nedungadi TP, Cunningham JT. 2014. Angiotensin II induces membrane trafficking of natively expressed transient receptor potential vanilloid type 4 channels in hypothalamic 4B cells. Am J Physiol Regul Integr Comp Physiol 307:R945-R955. DOI:10.1152/ajpregu.00224.2014, PMID:25080500 Takahashi N, Hamada-Nakahara S, Itoh Y, Takemura K, Shimada A, Ueda Y, Kitamata M, Matsuoka R, Hanawa-Suetsugu K, Senju Y, Mori MX, Kiyonaka S, Kohda D, Kitao A, Mori Y, Suetsugu S. 2014. TRPV4 channel activity is modulated by direct interaction of the ankyrin domain to PI(4,5)P. Nat Commun 5:4994. DOI:10.1038/ncomms5994, PMID:25256292 Tonegawa K, Otsuka W, Kumagai S, Matsunami S, Hayamizu N, Tanaka S, Moriwaki K, Obana M, Maeda M, Asahi M, Kiyonari H, Fujio Y, Nakayama H. 2017. Caveolae-specific activation loop between CaMKII and L-type Ca(2+) channel aggravates cardiac hypertrophy in alpha1-adrenergic stimulation. Am J Physiol Heart Circ Physiol 312:H501-H514. DOI:10.1152/ajpheart.00601.2016, PMID:28039202 Watanabe H, Vriens J, Prenen J, Droogmans G, Voets T, Nilius B. 2003. Anandamide and arachidonic acid use epoxyeicosatrienoic acids to activate TRPV4 channels. Nature 424:434-438. DOI:10.1038/nature01807, PMID:12879072 Wu QF, Qian C, Zhao N, Dong Q, Li J, Wang BB, Chen L, Yu L, Han B, Du YM, Liao YH. 2017. Activation of transient receptor potential vanilloid 4 involves in hypoxia/reoxygenation injury in cardiomyocytes. Cell Death Dis 8:e2828. DOI:10.1038/cddis.2017.227, PMID:28542130 Yang B, Jiang Q, He S, Li T, Ou X, Chen T, Fan X, Jiang F, Zeng X, Huang CL, Lei M, Tan X. 2021. Ventricular SK2 upregulation following angiotensin II challenge: Modulation by p21-activated kinase-1. J Mol Cell Cardiol 164:110-125. DOI:10.1016/j.yjmcc.2021.11.001, PMID:34774547 Yu Z, Gong H, Kesteven S, Guo Y, Wu J, Li J, Iismaa S, Kaidonis X, Graham R, Cox C. 2021. Piezo1 is the cardiac mechanosensor that initiates the hypertrophic response to pressure overload. Research Square DOI:10.21203/rs.3.rs-895561/v1, Yu ZY, Gong H, Wu J, Dai Y, Kesteven SH, Fatkin D, Martinac B, Graham RM, Feneley MP. 2021. Cardiac gq receptors and calcineurin activation are not required for the hypertrophic response to mechanical left ventricular pressure overload. Front Cell Dev Biol 9:639509. DOI:10.3389/fcell.2021.639509, PMID:33659256
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Chemical compound, drugAng IIMCECat# HY-13948
Chemical compound, drugPEMACKLINCat# I822933
Chemical compound, drugGSK790ASigma-AldrichCat# G0798
Chemical compound, drugGSK3874Sigma-AldrichCat# SML0942
Chemical compound, drugA21387Sigma-AldrichCat# G0798
Chemical compound, drugKN92SelleckCat# S6507
Chemical compound, drugKN93SelleckCat# S6787
Chemical compound, drugPentobarbital sodiumSigma-AldrichCat# 76-74-4
Chemical compound, drugCollagenase IIWorthingtonCat# ls004176
Chemical compound, drugFluo-4/AMAAT BioquestCat# AAT-B20401
Chemical compound, drugPluronic F‐127SolarbioCat# P679
Sequence-based reagentBNP (Nppb)_R(mice)This paperPCR primers CAACTTCAGTGCGTTACAGC
Sequence-based reagentCollagenase-1 (Col1a1) _F (mice)This paperPCR primers GAAACCCGAGGTATGCTTGA
Sequence-based reagentCollagenase1 (Col1a1) _R (mice)This paperPCR primers GGGTCCCTCGACTCCTACAT
Sequence-based reagentCollagenase-3 (Col3a1) _F (mice)This paperPCR primers AGCCACCTTGGTCAGTCCTA
Sequence-based reagentCollagenase-3 (Col3a1) _R (mice)This paperPCR primers GTGTAGAAGGCTGTGGGCAT
Sequence-based reagentGalectin-3 (LGALS3)_F (mice)This paperPCR primersCAGGAAAATGGCAGACAGCTT
Sequence-based reagentGalectin-3 (LGALS3)_R(mice)This paperPCR primers CCCATGCACCCGGATATC
Sequence-based reagentIL-1β (Il1b) _F (mice)This paperPCR primers TGCCACCTTTTGACAGTGATG
Sequence-based reagentIL-1β(Il1b)_R (mice)This paperPCR primers TGATGTGCTGCTGCGAGATT
Sequence-based reagentIL-6(Il6)_F (mice)This paperPCR primers GATAAGCTGGAGTCACAGAAG G
Sequence-based reagentIL-6(Il6)_R (mice)This paperPCR primers TTGCCGAGTAGATCTCAAAGT
Sequence-based reagentTNF-α(Tnfa)_F (mice)This paperPCR primers CCCCAAAGGGATGAGAAGTT
Sequence-based reagentTNF-α(Tnfa)_R (mice)This paperPCR primers ACTTGGTGGTTTGCTACGA
Sequence-based reagentMIP-2(Mip2)_F (mice)This paperPCR primers CGCCCAGACAGAAGTCATAG
Sequence-based reagentMIP-2(Mip2)_R (mice)This paperPCR primers TCCTCCTTTCCAGGTCAGTTA
Sequence-based reagentMCP-1(Mcp1p)_F (mice)This paperPCR primers TTTTTGTCACCAAGCTCAAGAG
Sequence-based reagentMCP-1(Mcp1p)_R (mice)This paperPCR primers TTCTGATCCTCATTTGGTTCCGA
Sequence-based reagentGapdh_F(mice)This paperPCR primers AAGAAGGTGGTGAAGCAGGCAT
Sequence-based reagentGapdh_F (mice)This paperPCR primers CGGCATCGAAGGTGGAAGAGTG
Sequence-based reagentTrpv4_F (rat)This paperPCR primers CGTCCAAACCTGCGAATGAAGTTC
Sequence-based reagentTrpv4_F (rat)This paperPCR primers CCTCCATCTCTTGTTGTCACTGG
Sequence-based reagentANP (Nppa)_F (rat)This paperPCR primers ATCTGATGGATTTCAAGAACC
Sequence-based reagentANP (Nppa)_R(rat)This paperPCR primers CTCTGAGACGGGTTGACTTC
Sequence-based reagentBNP (Nppb)_F (rat)This paperPCR primers CAATCCACGATGCAGAAGCT
Sequence-based reagentBNP (Nppb)_R (rat)This paperPCR primers GGGCCTTGGTCCTTTGAGA
Sequence-based reagentGapdh_ F (rat)This paperPCR primers ATGGGAAGCTGGTCATCAAC
Sequence-based reagentGapdh_ R (rat)This paperPCR primers GTGGTTCACACCCATCACAA
AntibodyAnti-GAPDH HRP(mouse monoclonal)BioworldeCat# MB001HRRID: AB_2857326Western blot (1:10,000)
AntibodyAnti-TRPV4(rabbit polyclonal)Alomone labsCat# ACC-034RRID: AB_2040264Western blot (1:500)
AntibodyAnti-p-CaMKII(Thr287)(rabbit polyclonal)Thermo Fisher ScientificCat# PA5-37833RRID: AB_2554441Western blot (1:500)
AntibodyAnti-CaMKII(rabbit monoclonal)AbcamCat# ab52476RRID: AB_868641Western blot (1:1000)
AntibodyAnti-p-P65 (Ser536)(rabbit polyclonal)AffinityCat# AF2006RRID: AB_2834435Western blot (1:500)
AntibodyAnti-P65(rabbit polyclonal)AffinityCat# AF5006RRID: AB_2834847Western blot (1:500)
AntibodyAnti-NLRP3(rabbit monoclonal)AbcamCat# ab263899RRID: AB_2889890Western blot (1:500)
AntibodyAnti-ASC/TMS1(rabbit monoclonal)CSTCat# 67824RRID: AB_2799736Western blot (1:1000)
AntibodyAnti-Cleaved-Caspase 1, p20(rabbit polyclonal)AffinityCat# AF4005RRID: AB_2845463Western blot (1:500)
AntibodyAnti-IL 1β(rabbit monoclonal)AbcamCat# ab234437Western blot (1:1000)
AntibodyAnti-IL-6(rabbit monoclonal)CSTCat# 12912RRID: AB_2798059Western blot (1:500)
AntibodyAnti-TNF-α(rabbit monoclonal)CSTCat# 11948RRID: AB_2687962Western blot (1:1000)
AntibodyGoat Anti-Rabbit IgG HRP(goat polyclonal)AffinityCat# S0001RRID: AB_2839429Western blot (1:3000)
AntibodyAnti-α-actinin(rabbit polyclonal)AbcamCat# Ab137346RRID: AB_2909405ICC (1:500)
Commercial assay or kitcDNA reverse transcription kitVazymeCat# R211-01
Commercial assay or kitSYBR Green PCR Master Mix KitCWbioCat# cw3008h
OthersPercollCytivaCat# 17089109A low-viscosity, non-toxic medium suitable for density gradient centrifugation of cells, viruses and subcellular particles
  58 in total

1.  Isolation of cardiac myocytes and fibroblasts from neonatal rat pups.

Authors:  Honey B Golden; Deepika Gollapudi; Fnu Gerilechaogetu; Jieli Li; Ricardo J Cristales; Xu Peng; David E Dostal
Journal:  Methods Mol Biol       Date:  2012

Review 2.  The failing heart--an engine out of fuel.

Authors:  Stefan Neubauer
Journal:  N Engl J Med       Date:  2007-03-15       Impact factor: 91.245

3.  Transient receptor potential vanilloid 2 function regulates cardiac hypertrophy via stretch-induced activation.

Authors:  Sheryl E Koch; Adrien Mann; Shannon Jones; Nathan Robbins; Abdullah Alkhattabi; Mariah C Worley; Xu Gao; Valerie M Lasko-Roiniotis; Rajiv Karani; Logan Fulford; Min Jiang; Michelle Nieman; John N Lorenz; Jack Rubinstein
Journal:  J Hypertens       Date:  2017-03       Impact factor: 4.844

Review 4.  Reappraising the role of inflammation in heart failure.

Authors:  Luigi Adamo; Cibele Rocha-Resende; Sumanth D Prabhu; Douglas L Mann
Journal:  Nat Rev Cardiol       Date:  2020-01-22       Impact factor: 32.419

5.  Transient receptor potential vanilloid 4 channel participates in mouse ventricular electrical activity.

Authors:  Sebastien Chaigne; Guillaume Cardouat; Julien Louradour; Fanny Vaillant; Sabine Charron; Frederic Sacher; Thomas Ducret; Romain Guinamard; Edward Vigmond; Thomas Hof
Journal:  Am J Physiol Heart Circ Physiol       Date:  2021-01-15       Impact factor: 4.733

6.  Impaired osmotic sensation in mice lacking TRPV4.

Authors:  Atsuko Mizuno; Naoko Matsumoto; Masashi Imai; Makoto Suzuki
Journal:  Am J Physiol Cell Physiol       Date:  2003-07       Impact factor: 4.249

7.  Endoglin selectively modulates transient receptor potential channel expression in left and right heart failure.

Authors:  Kevin J Morine; Vikram Paruchuri; Xiaoying Qiao; Mark Aronovitz; Gordon S Huggins; David DeNofrio; Michael S Kiernan; Richard H Karas; Navin K Kapur
Journal:  Cardiovasc Pathol       Date:  2016-08-21       Impact factor: 2.185

8.  Mitogen-Activated Protein Kinase and Intracellular Polyamine Signaling Is Involved in TRPV1 Activation-Induced Cardiac Hypertrophy.

Authors:  Mai Chen; Jiajia Xin; Baohui Liu; Liyang Luo; Jiayi Li; Wen Yin; Mingkai Li
Journal:  J Am Heart Assoc       Date:  2016-07-29       Impact factor: 5.501

9.  CaMKIIδC Drives Early Adaptive Ca2+ Change and Late Eccentric Cardiac Hypertrophy.

Authors:  Senka Ljubojevic-Holzer; Anthony W Herren; Natasa Djalinac; Julia Voglhuber; Stefano Morotti; Michael Holzer; Brent M Wood; Mahmoud Abdellatif; Ingrid Matzer; Michael Sacherer; Snjezana Radulovic; Markus Wallner; Milan Ivanov; Stefan Wagner; Samuel Sossalla; Dirk von Lewinski; Burkert Pieske; Joan Heller Brown; Simon Sedej; Julie Bossuyt; Donald M Bers
Journal:  Circ Res       Date:  2020-08-21       Impact factor: 17.367

10.  TRPV4 blockade suppresses atrial fibrillation in sterile pericarditis rats.

Authors:  Jie Liao; Qiongfeng Wu; Cheng Qian; Ning Zhao; Zhaoyang Zhao; Kai Lu; Shaoshao Zhang; Qian Dong; Lei Chen; Qince Li; Yimei Du
Journal:  JCI Insight       Date:  2020-12-03
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.