Literature DB >> 35730500

MiR-4739 inhibits the malignant behavior of esophageal squamous cell carcinoma cells via the homeobox C10/vascular endothelial growth factor A/phosphatidylinositol 3-kinase/AKT pathway.

Kaiqin Wu1, Zhenchuan Liu1, Chenglai Dong1, Shaorui Gu1, Lei Li1, Wenli Wang1, Yongxin Zhou1.   

Abstract

Esophageal cancer is a lethal disease, and emerging evidence has shown that microRNAs are involved in its development, progression, and clinical outcome. MicroRNAs are potential biomarkers for esophageal squamous cell carcinoma (ESCC), and may be useful in advanced RNA therapy for ESCC. This study was conducted to evaluate the molecular mechanism of miR-4739 in ESCC. Reverse transcription-quantitative polymerase chain reaction and western blotting were performed to measure RNA and protein levels. Transwell assay, Cell Counting Kit-8 assay, cytometry analysis, and human umbilical vein endothelial cell tube formation assay were conducted to determine the molecular function of miR-4739 in ESCC. Potential targets of miR-4739 were predicted using bioinformatics tools and confirmed in ESCC cells using a luciferase reporter and RNA pulldown assay. Finally, we performed immunohistochemistry to evaluate the effects of administering agomir-4739 to a mouse model of ESCC. MiR-4739 expression was downregulated in ESCC tissues and cells. MiR-4739 overexpression inhibited cell proliferation, migration, and invasion, and promoted apoptosis of ESCC cells. Furthermore, vascular endothelial growth factor A expression was downregulated by miR-4739 mimics in ESCC cells. MiR-4739 negatively regulated homeobox C10 expression. Additionally, agomir-4739 inhibited tumor growth and angiogenesis in vivo. We demonstrated that miR-4739 overexpression exerted an inhibitory effect on ESCC cells by preventing the expression of homeobox C10 via the vascular endothelial growth factor A/phosphatidylinositol 3-kinase/AKT pathway, indicating the potential of this microRNA as a treatment target in ESCC.

Entities:  

Keywords:  AKT; esophageal squamous cell carcinoma; homeobox C10; miR-4739; therapy; vascular endothelial growth factor A

Mesh:

Substances:

Year:  2022        PMID: 35730500      PMCID: PMC9342426          DOI: 10.1080/21655979.2022.2068783

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   6.832


Highlights

MiR-4739 expression was lower in esophageal squamous cell carcinoma tissues and cells High miR-4739 expression inhibits cell proliferation, migration, G1-S cell transition, and apoptosis arrest. High miR-4739 expression decreased tumor angiogenesis promotion MiR-4739 inhibits hoxc10 expression to regulate PI3K/AKT and VEGF-A MiR-4739 is a potential therapeutic target for esophageal squamous cell carcinoma

Introduction

Esophageal cancer causes approximately half a million deaths annually worldwide [1]. Esophageal squamous cell carcinoma (ESCC), a pathological subtype of esophageal cancer, is prevalent in East Asia, including China [2]. Potential treatments for esophageal cancer include surgery, chemotherapy, radiotherapy, and immunotherapy [3,4]. In recent years, multidisciplinary approaches have improved the clinical outcomes of patients with esophageal cancer in China. However, the 5-year overall survival rate of patients with advanced esophageal cancer (stage III–IV) remains less than 30%[5]. MicroRNAs are endogenously expressed short non-coding RNA molecules of 19–25 nucleotides in length that are involved in post-transcriptional gene regulation. Emerging evidence has revealed that microRNAs are involved in the development, progression, and clinical outcome of ESCC [6-8]. MicroRNAs are not only potential biomarkers for ESCC, but may also be useful in advanced RNA therapy for treating ESCC [9]. MiR-4739 is associated with various diseases, such as pleural fibrosis, gastric cancer, prostate cancer, type II diabetic nephropathy, pancreatic ductal adenocarcinoma, and limb ischemia. For example, Zhang et al [10]. reported that miR-4739 expression was regulated by circMYOF and plays a role in pancreatic ductal adenocarcinoma; Gu et al [11]. reported that TYMSOS promotes the molecular functions in gastric cancer by sponging miR-4739; and Wang et al [12]. showed that the long non-coding RNA, VPS9D1-AS1, promotes prostate cancer by sponging miR-4739. These studies indicate that downregulation of miR-4739 expression plays a crucial role in different types of cancer. MicroRNA-based therapeutics, including tumor-suppressor microRNA mimics and antimiRs targeting oncogenes, are promising therapies for cancer treatment. Chemical modification and delivery optimization of microRNAs as antimiRs have been exploited in several clinical trials for different diseases, including cancer [8,13]. However, the function and molecular mechanism of miR-4739 in ESCC have not been reported. Homeobox C10 (HOXC10) belongs to the homeobox transcription factor family and plays a crucial role in physiological functions, energy metabolism, and limb development [14-18]. Recently, many studies have revealed that HOXC10 is involved in cancer progression, including hepatocellular cancer, lung cancer, esophageal cancer, gastric cancer, colorectal cancer, liver cancer, ovarian cancer, and glioblastoma [19-23]. Notably, several studies have shown that high HOXC10 expression activates the phosphatidylinositol 3-kinase (PI3K)/AKT signaling pathway, including in ESCC [19,20]. Many aspects of cancer cell growth and survival rely on the PI3K/AKT signaling pathway [24]. Although various chemical inhibitors of the PI3K/AKT signaling pathway have been widely investigated, and some have been approved for treating human tumors, none of these inhibitors were effective in clinical practice [25]. We hypothesized that miR-4739 is involved in esophageal cancer progression and angiogenesis. This study aimed to investigate whether miR-4739 regulates the PI3K/AKT pathway via HOXC10. Bevacizumab is a commercially approved monoclonal antibody that targets vascular endothelial growth factor A (VEGFA). In clinical practice, bevacizumab is often used in combination with chemotherapy [26]. Based on the molecular mechanism of miR-4739, bevacizumab in combination with miR-4739 may be a powerful strategy for inhibiting tumor growth in vivo.

Materials and methods

Cell culture

TE-1 and Eca-109 cell lines were obtained from the Chinese Academy of Science Cell Bank, Shanghai, China. Other esophageal cell lines (KYSE30, KYSE410, and KYSE510) and a normal human esophageal epithelial cell line were purchased from the Bena Culture Collection, Beijing, China. Cells were cultured in RPMI-1640 (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA) at 37°C in a humidified atmosphere with 95% air and 5% carbon dioxide.

Bioinformatics analysis

Five databases, TargetScan (http://www.targetscan.org/vert_80/), miRWalk (http://mirwalk.umm.uni-heidelberg.de/), PicTar (https://pictar.mdc-berlin.de/), miRDB (http://mirdb.org/), and miRMap (https://mirmap.ezlab.org/), were used to predict targets of has-miR-4739. A Venn diagram was generated using a web-based tool (https://bioinformatics.psb.ugent.be/webtools/Venn/). Potential targets were further screened based on the intersection of differentially expressed genes in ESCC obtained from Gepia 2.0 (http://gepia2.cancer-pku.cn/#degenes) in The Cancer Genome Atlas ESCC cohort.

Western blotting

In accordance with the manufacturer’s instructions, total protein was extracted by lysing the cells in radioimmunoprecipitation assay buffer (Thermo Fisher Scientific, Waltham, MA, USA) containing 1% phenylmethylsulfonyl fluoride (MedChemExpress, Monmouth Junction, NJ, USA). A Bicinchoninic Acid Protein Assay Kit (Beyotime, Shanghai, China) was used to measure the total protein concentration in the cell lysate. The protein samples were diluted in 5× sodium dodecyl sulfate-polyacrylamide gel electrophoresis sample loading buffer and heated at 100°C for 5 min. In total, 20–50 μg of protein was subjected to gel electrophoresis and transferred to a polyvinylidene fluoride membrane (Millipore, Billerica, MA, USA). After incubation with 5% milk–Tris-buffered saline with Tween-20 for 2 h, the membrane was incubated with corresponding primary antibodies and then with horseradish peroxidase-conjugated secondary antibody, and finally visualized using an enhanced chemiluminescence assay kit (Epizyme, Cambridge, MA, USA). The primary antibodies were anti-HOXC10 (ab153904) (1:1,000 dilution; Abcam, Cambridge, UK), anti-VEGFA (ab214424) (1:1,000 dilution; Abcam), anti-GAPDH (ab181602) (1:5,000 dilution; Abcam), anti-beta tubulin (ab179513) (1:10,000 dilution; Abcam), anti-PI3-kinase p85-alpha (T40115S) (1:1,000 dilution) (Abmart, Shanghai, China), anti-phospho-PI3-kinase p85-alpha/gamma (T40116S) (1:1,000 dilution; Abmart), anti-AKT1/2/3 (T55561F) (1:1,000 dilution; Abmart), anti-phospho-AKT (Ser473) (T40067F) (1:1,000 dilution; Abmart), and anti-phospho-AKT (Thr308) (T40068F) (1:1,000 dilution; Abmart). Densitometric analysis of the bands was performed using ImageJ 1.52a software (National Institutes of Health, Bethesda, MD, USA) for protein quantification.

RNA extraction and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

This study was approved by the Ethics Committee of Tongji Hospital, Shanghai, China. Esophageal cancer tissues and matched normal tissues were obtained from 30 patients who underwent surgery at Tongji Hospital. Each patient signed an informed consent form before surgery. All specimens were stored long-term at – 80°C. According to the manufacturer’s protocol, total RNA was extracted from the samples using TRIzol reagent (Invitrogen). RNA concentrations were determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). Complementary DNA was synthesized using an HG TaqMan miRNA cDNA Synthesis Kit (HaiGene, Harbin, China). MicroRNA was quantified using an HG TaqMan miRNA PCR Kit (HaiGene). The levels of miR-4739 were normalized to those of the internal control, U6B, using the 2−ΔΔCt method [27]. To investigate messenger RNA expression levels, 500 ng of total RNA was used to synthesize complementary DNA using HiScript Reverse Transcriptase (Vazyme, Nanjing, China), and RT-qPCR was performed using ChamQ SYBR qPCR Master Mix (Vazyme) with specific primers (Table 1). The messenger RNA levels of HOXC10, TIMP1, VEGFA, and COL3A1 were normalized to those of GAPDH. For each sample, RT-qPCR was performed in duplicate, and the mean value was used to quantify microRNA or messenger RNA expression levels [28].
Table 1.

RT-qPCR primer sequences for selected genes.

GeneSequence (5’–3’)
GAPDHForward: CCCACTCCTCCACCTTTGAC
 Reverse: TCTTCCTCTTGTGCTCTTGC
VEGFAForward: CTCTACTTCCCCAAATCACT
 Reverse: CCAAAAGCAGGTCACTCACT
HOXC10Forward: CTATCCGTCCTACCTCTCGCA
 Reverse: CCTGCCAACAGGTTGTTCC
TIMP1Forward: CGCAGCGAGGAGGTTTCTCAT
 Reverse: GGCAGTGATGTGCAAATTTCC
COL3A1Forward: GGCAGTGATGTGCAAATTTCC
 Reverse: AACGGATCCTGAGTCACAGACA

COL3A1, collagen type III alpha 1 chain; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HOXC10, homeobox C10; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; TIMP1, TIMP metallopeptidase inhibitor 1; VEGFA, vascular endothelial growth factor A.

RT-qPCR primer sequences for selected genes. COL3A1, collagen type III alpha 1 chain; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HOXC10, homeobox C10; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; TIMP1, TIMP metallopeptidase inhibitor 1; VEGFA, vascular endothelial growth factor A.

Cell transfection

MiR-4739 mimetic molecules and inhibitors, as well as their respective negative controls, were designed and synthesized by GenePharma, Shanghai, China. HOXC10 small-interfering RNAs were synthesized by Ribobio, Guangzhou, China. The plasmid for overexpressing HOXC10 protein was constructed and produced by Vectorbuilder, Shanghai, China. Small-interfering RNA or plasmid was transfected into TE-1 or KYSE30 cells using Lipofectamine 3000 (Invitrogen), according to the manufacturer’s instructions.

Transwell invasion and migration assays

Transwell chambers (Corning Inc., Corning, NY, USA) were used to evaluate cell invasion and migration [29]. After starving the cells for 24 h, ESCC cells were seeded in the upper chamber with 200 μL of fetal bovine serum-free culture medium, whereas 700 μL of culture medium containing 10% fetal bovine serum was added to the lower chamber. For the invasion assay, 100 μL of Matrigel was used to precoat the upper chamber before ESCC cell seeding. At 48 h post-seeding, the medium was removed, and cells were washed three times with phosphate-buffered saline. Remaining cells on the membrane of the upper chamber were removed, and migrated cells were fixed using 4% paraformaldehyde for 30 min and stained with 0.1% crystal violet solution (Sigma, St. Louis, MO, USA) for 30 min. Images were obtained under a microscope and stained cells were counted using ImageJ 1.52a software. Data from three independent experiments were expressed as mean ± standard deviation.

Cell Counting Kit-8 assay

Cell proliferation was analyzed using the Cell Counting Kit-8 assay (Beyotime). Briefly, approximately 5 × 103 cells were seeded in each well of a 96-well plate in 100 μL medium, starved, and subsequently transfected with the corresponding plasmid. At 24, 48, 72, and 96 h after cell transfection, 10 µL Cell Counting Kit-8 solution was added to each well and incubated for 2 h at 37°C. Optical density was measured using a microplate reader. Each experiment was performed in triplicate. The results are expressed as mean ± standard deviation [30].

Flow cytometric analysis

ESCC cell apoptosis and cell cycle were analyzed using flow cytometry with the Cell Cycle Analysis Kit and Annexin V-Fluorescein Isothiocyanate Apoptosis Detection Kit (Beyotime), as previously described [31,32]. Analysis was performed using FlowJo software (TreeStar, Ashland, OR, USA). Each experiment was performed in triplicate.

Immunohistochemistry

Immunohistochemistry was performed as previously described [33]. Briefly, tissues were fixed with formalin, embedded in paraffin, and sliced into 4-μm-thick sections. Tissue sections were dewaxed in xylene and hydrated with gradient density alcohol. After antigen retrieval, sections were incubated with antibodies against VEGFA, HOXC10, and CD31, and visualized using a horseradish peroxidase-conjugated secondary antibody and 3,3′-Diaminobenzidine Detection Kit (Beyotime). Representative images were captured using a microscope (Nikon Instruments, Tokyo, Japan). Primary antibodies included anti-HOXC10 (ab153904) (1:100 dilution; Abcam), anti-VEGF-A (ab214424) (1:100 dilution; Abcam), and anti-CD31 (ab76533) (1:100 dilution; Abcam).

In vitro angiogenesis assay

To evaluate angiogenesis in vitro, 200 μL culture medium containing 10% fetal bovine serum was added to each well of a 24-well plate that was previously coated with 300 μL of Matrigel per well (BD Biosciences, Franklin Lakes, NJ, USA) [34]. In each Transwell chamber, we plated approximately 5 × 104 human umbilical vein endothelial cells that were cocultured with ESCC cells previously transfected with miR-4739 mimics or scramble. After 6 h of incubation, the medium was discarded, and cells were fixed. Representative images of the tubular structures were captured by microscopy. The vascular structure of the cells was analyzed using ImageJ 1.52a software. All experiments were performed in triplicate.

Dual-luciferase reporter assay

Dual-luciferase reporter assay was performed as previously described [35]. Cells (293 T) were seeded in 24-well plates, grown to a density of 50%, and then transfected with HOXC10 wild-type 3′-untranslated region (UTR) and HOXC10 mutant dual-luciferase reporter plasmids. The miR-4739 mimic or scramble was transfected into 293 T cells. After 24 h, luciferase activity was measured using a Dual-Luciferase Reporter Assay System Kit (Promega, Madison, WI, USA). All experiments were performed at least three times.

RNA pulldown assay

To identify the interaction between miR-4739 and messenger RNA, RNA pulldown assays were performed as previously described [36]. MiR-4739 mimics and control (3′-UTR-biotinylated) were synthesized by GenePharma. TE-1 or KYSE30 cells were seeded at 70% confluency in a 10-cm culture dish and transfected with biotinylated mimics or control. After 48 h, cells were lysed with protease and RNase inhibitors and incubated with streptavidin-coated magnetic beads (Beyotime). After incubation, the beads were pulled down, and RNA was isolated using TRIzol reagent. HOXC10 messenger RNA levels in the biotin-labeled sample and control were measured using RT-qPCR.

Tumor xenograft and drug administration

The animal protocols followed in this study were approved by the local Animal Use and Care Committee and were in accordance with applicable national and international guidelines. Female BALB/c nude mice (6–8 weeks old) were kept under standard conditions according to the institutional guidelines for animal care and use. Xenografts were established by injecting 100 μL of phosphate-buffered saline containing approximately 1 × 106 cells into each mouse, with five mice per group. Agomir-4739 or negative control was synthesized by GenePharma, whereas bevacizumab (an anti-VEGFA monoclonal antibody) was purchased from MedChemExpress. Two weeks after establishing a xenograft tumor model, 20 mice were randomly divided into four groups: agomir-4739, bevacizumab, agomir-4739 plus bevacizumab, and phosphate-buffered saline (negative control) groups. Agomir-4739 (5 nmoL/mouse) was administered through subcutaneous intratumoral injection, whereas bevacizumab (5 mg/kg/mouse) was injected intraperitoneally every 3 days for 2 weeks, according to the manufacturer’s instructions. All mice were sacrificed, and tumor tissues were removed for further analysis [37].

Statistical analysis

Continuous data from at least three independent experiments were expressed as mean ± standard deviation. SPSS 16.0 software (SPSS Inc., Chicago, IL, USA) was used to analyze the data. Unpaired two-tailed student’s t-test was used for two-group comparisons. Analysis of variance followed by Tukey’s post hoc test, to compare differences among multiple groups, was used for continuous data. Statistical significance was set at P < 0.05.

Results

We found that miR-4739 functions as an oncosuppressor in ESCC. MiR-4739 inhibited cell proliferation, apoptosis inhibition, G1/S phase transition, and cell mobility in vitro. Additionally, miR-4739 directly targeted HOXC10 to regulate the VEGFA/PI3K/AKT axis. More importantly, agomir-4739 combined with bevacizumab suppressed tumor growth in vivo.

MiR-4739 expression is lower in ESCC cells and tissues than in normal cells and adjacent tissues

We measured the relative miR-4739 expression levels in tissue samples from surgical resection using RT-qPCR and compared the results with those in adjacent normal tissue samples. The expression of miR-4739 in cancer tissues was considerably lower than that in adjacent tissues. In addition, as compared to a normal esophageal cell line, the expression of miR-4739 was lower in the five cancer cell lines (Figure 1(a,b)).
Figure 1.

MiR-4739 expression was decreased in cancer tissues and esophageal squamous cell carcinoma (ESCC) cells compared with control cells. (a) Relative expression levels of miR-4739 in ESCC (t) samples and adjacent normal tissues (n) determined by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). (b) RT-qPCR analysis of miR-4739 expression in a normal esophageal epithelial cell line (HEEC) and five human ESCC cell lines. (c) RT-qPCR analysis of miR-4739 expression in TE-1 or KYSE30 cells transfected with mimics or scramble (NC). (d) Proliferation of TE-1 and KYSE30 cells evaluated by Cell Counting Kit-8 assay. (e, f) Transwell assay showing that miR-4739 mimics inhibited the migration and invasion of ESCC cells. (g, h) Flow cytometric assay showing that the upregulation of miR-4739 expression affects ESCC cell apoptosis and cell cycle. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

MiR-4739 expression was decreased in cancer tissues and esophageal squamous cell carcinoma (ESCC) cells compared with control cells. (a) Relative expression levels of miR-4739 in ESCC (t) samples and adjacent normal tissues (n) determined by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). (b) RT-qPCR analysis of miR-4739 expression in a normal esophageal epithelial cell line (HEEC) and five human ESCC cell lines. (c) RT-qPCR analysis of miR-4739 expression in TE-1 or KYSE30 cells transfected with mimics or scramble (NC). (d) Proliferation of TE-1 and KYSE30 cells evaluated by Cell Counting Kit-8 assay. (e, f) Transwell assay showing that miR-4739 mimics inhibited the migration and invasion of ESCC cells. (g, h) Flow cytometric assay showing that the upregulation of miR-4739 expression affects ESCC cell apoptosis and cell cycle. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

MiR-4739 overexpression reduces the malignant behavior and proangiogenic activity of ESCC cells

To investigate the biological function of miR-4739 in ESCC, we transfected miR-4739 mimics or control into ESCC cells and validated the impact of mimics by performing RT-qPCR (Figure 1(c)). The Cell Counting Kit-8 assay indicated that miR-4739 overexpression inhibited the proliferation of TE-1 and KYSE30 cells (Figure 1(d)). In addition, the Transwell assay indicated that miR-4739 inhibited cell migration and invasion (Figure 1(e,f)). We hypothesized that miR-4739 mimics are involved in regulating the ESCC cell cycle and apoptosis. MiR-4739 mimics increased the percentage of cells in the G1 phase and inhibited G1/S cell cycle progression, but did not decrease the percentage of cells in the G2 phase in TE-1 and KYSE30 cells (Figure 1h). Finally, annexin V-fluorescein isothiocyanate assay revealed that miR-4739 induced apoptosis in ESCC cells after 48 h of treatment (Figure 1(g)). We measured VEGFA expression levels in ESCC cells treated with miR-4739 mimics or the negative control using RT-qPCR. Unexpectedly, upregulation of miR-4739 reduced VEGFA messenger RNA expression (Figure 2(b)). Western blotting revealed that intracellular VEGFA expression was reduced by miR-4739 mimics. Enzyme-linked immunosorbent assay indicated that extracellular VEGFA released from cancer cells was reduced in miR-4739 mimics compared with negative controls (Figure 2(c,d)). Moreover, microvascular density in human umbilical vein endothelial cells was reduced after treating cells with supernatant from mimic-transfected ESCC cells (Figure 2(a)). These results showed that miR-4739 significantly reduced intracellular and extracellular VEGFA in TE-1 and KYSE30 cells, thus inhibiting tumor angiogenesis.
Figure 2.

Upregulating miR-4739 expression reduces the proangiogenic activity of esophageal squamous cell carcinoma (ESCC) cells in vitro. (a) Representative images (left) and quantification (right) of human umbilical endothelial cells that formed tube-like structures on Matrigel-coated plates after treatment with conditioned medium (CM) derived from miR-4739 mimics or negative control ESCC cells. (b) Reverse transcription-quantitative polymerase chain reaction analysis of VEGFA messenger RNA expression levels in ESCC cultures transfected with miR-4739 mimics or scramble, normalized to those of GAPDH. (c) Enzyme-linked immunosorbent assay of vascular endothelial growth factor A (VEGFA) protein levels in the supernatants of ESCC cell cultures in which miR-4739 expression was upregulated or downregulated. (d) Western blotting of VEGFA levels in miR-4739 mimic or scrambled ESCC cells; alpha-tubulin was used as a loading control. *P < 0.05; **P < 0.01; ***P < 0.001.

Upregulating miR-4739 expression reduces the proangiogenic activity of esophageal squamous cell carcinoma (ESCC) cells in vitro. (a) Representative images (left) and quantification (right) of human umbilical endothelial cells that formed tube-like structures on Matrigel-coated plates after treatment with conditioned medium (CM) derived from miR-4739 mimics or negative control ESCC cells. (b) Reverse transcription-quantitative polymerase chain reaction analysis of VEGFA messenger RNA expression levels in ESCC cultures transfected with miR-4739 mimics or scramble, normalized to those of GAPDH. (c) Enzyme-linked immunosorbent assay of vascular endothelial growth factor A (VEGFA) protein levels in the supernatants of ESCC cell cultures in which miR-4739 expression was upregulated or downregulated. (d) Western blotting of VEGFA levels in miR-4739 mimic or scrambled ESCC cells; alpha-tubulin was used as a loading control. *P < 0.05; **P < 0.01; ***P < 0.001.

MiR-4739 directly regulates HOXC10 messenger RNA expression and inhibits the phosphorylation of PI3K/AKT in ESCC cells

The target messenger RNAs of miR-4739 were predicted using several online bioinformatics tools to investigate the biological function of miR-4739. The results indicated that HOXC10, TIMP1, and COL3A1 are targets of miR-4739 (Figure 3(a,b)). According to RT-qPCR, only HOXC10 messenger RNA levels were decreased in ESCC cells transfected with miR-4739 mimics compared with negative controls (Figure 3(c)). Western blotting confirmed that miR-4739 also regulated HOXC10 protein expression (Figure 3(f)). The direct interaction of miR-4739 with the 3′-UTR of the HOXC10 messenger RNA was confirmed in a dual-luciferase reporter assay. MiR-4739 mimics reduced the relative luciferase activity of the plasmid expressing the wild-type HOXC10 3′-UTR (Figure 3(d,e)). Furthermore, inhibition of HOXC10 messenger RNA expression in ESCC cells decreased VEGFA expression (Figure 4(c,d)), whereas upregulation of HOXC10 messenger RNA expression increased VEGFA protein levels (Figure 4(b)). Moreover, the interaction between HOXC10 messenger RNA and miR-4739 was confirmed in an RNA pulldown assay. HOXC10 messenger RNA levels were higher in 3′UTR-biotinylated miR-4739 samples than in control samples (Figure 3(h)). Western blotting showed that miR-4739 overexpression or downregulation of HOXC10 messenger RNA reduced AKT phosphorylation levels in ESCC cells (Figure 4(e,f)).
Figure 3.

MiR-4739 directly targets HOXC10 expression. (a, b) Bioinformatics analysis revealed possible targets of miR-4739. (c) Messenger RNA expression levels of possible targets of miR-4739 in esophageal squamous cell carcinoma (ESCC) cells transfected with mimics or control were analyzed using reverse transcription-quantitative polymerase chain reaction. Expression levels were normalized to those of GAPDH. (d) Nucleotide sequence alignment between miR-4739 and the 3′-untranslated region (UTR) of HOXC10. (e) Dual-luciferase assays evaluating the effects of miR-4739 and scramble (NC) on the activity of the luciferase reporter containing either wild-type (WT) or mutant (MT) HOXC10 3′-UTR. (f, g) Western blotting of homeobox C10 protein levels in ESCC cells over- or under-expressing miR-4739. Protein bands were quantified using ImageJ 1.52a software. (h) The 3′-UTR-biotinylated miR-4739 binding HOXC10 messenger RNA levels were determined by an RNA pulldown assay. *P < 0.05; **P < 0.01; ***P < 0.001.

Figure 4.

MiR-4739 negatively regulates vascular endothelial growth factor A (VEGFA) levels and the phosphatidylinositol 3-kinase (PI3K)/AKT signaling pathway by targeting HOXC10. (a) Representative western blot images of the effects of short interfering RNA targeting HOXC10 on esophageal squamous cell carcinoma (ESCC) cells. (b–d) Western blot and reverse transcription quantitative-polymerase chain reaction analysis of the protein and messenger RNA levels of HOXC10 and VEGFA in ESCC cells after transfection with si-HOXC10-3 and HOXC10 plasmids. (e, f) Western blotting of PI3K, p-PI3K, AKT, and p-AKT expression in TE-1 or KYSE30 cells after transfection with miR-4739 mimics or HOXC10 siRNA-3; beta-tubulin or GAPDH was used as an internal control. *P < 0.05; **P < 0.01.

MiR-4739 directly targets HOXC10 expression. (a, b) Bioinformatics analysis revealed possible targets of miR-4739. (c) Messenger RNA expression levels of possible targets of miR-4739 in esophageal squamous cell carcinoma (ESCC) cells transfected with mimics or control were analyzed using reverse transcription-quantitative polymerase chain reaction. Expression levels were normalized to those of GAPDH. (d) Nucleotide sequence alignment between miR-4739 and the 3′-untranslated region (UTR) of HOXC10. (e) Dual-luciferase assays evaluating the effects of miR-4739 and scramble (NC) on the activity of the luciferase reporter containing either wild-type (WT) or mutant (MT) HOXC10 3′-UTR. (f, g) Western blotting of homeobox C10 protein levels in ESCC cells over- or under-expressing miR-4739. Protein bands were quantified using ImageJ 1.52a software. (h) The 3′-UTR-biotinylated miR-4739 binding HOXC10 messenger RNA levels were determined by an RNA pulldown assay. *P < 0.05; **P < 0.01; ***P < 0.001. MiR-4739 negatively regulates vascular endothelial growth factor A (VEGFA) levels and the phosphatidylinositol 3-kinase (PI3K)/AKT signaling pathway by targeting HOXC10. (a) Representative western blot images of the effects of short interfering RNA targeting HOXC10 on esophageal squamous cell carcinoma (ESCC) cells. (b–d) Western blot and reverse transcription quantitative-polymerase chain reaction analysis of the protein and messenger RNA levels of HOXC10 and VEGFA in ESCC cells after transfection with si-HOXC10-3 and HOXC10 plasmids. (e, f) Western blotting of PI3K, p-PI3K, AKT, and p-AKT expression in TE-1 or KYSE30 cells after transfection with miR-4739 mimics or HOXC10 siRNA-3; beta-tubulin or GAPDH was used as an internal control. *P < 0.05; **P < 0.01.

Agomir-4739 combined with bevacizumab is a potential therapy for ESCC

Considering the effects of miR-4739 on ESCC cells, we assessed the potential of using miR-4739 as an anticancer drug in mice (Figure 5(a)) [9,38,39]. Although miR-4739 and bevacizumab both inhibited tumor growth in mice, the combination of miR-4739 and bevacizumab more effectively suppressed tumor volume (Figure 5(b-d)). The expression levels of HOXC10, VEGFA, and CD31 were downregulated in the miR-4739-treated group and combination group compared to the negative control group. In the bevacizumab-treated group, only the expression level of CD31 was downregulated. These results indicate that agomir-4739 combined with bevacizumab can be used to treat ESCC (Figure 5(e)).
Figure 5.

MiR-4739 overexpression inhibited the tumor growth and pro-angiogenic activity of TE-1 cells in vivo. (a) Schematic of agomir-4739 or scramble in a nude mouse model. (b) Tumor volumes of mice in the control, agomir-4739, bevacizumab, and agomir-4739 plus bevacizumab groups. (c) Tumor growth curve after TE-1 cell injection. (d) Tumor weights of mice. (e) Detection of homeobox C10, vascular endothelial growth factor A, and CD31 proteins in tumor tissues using immunohistochemistry (magnification, ×200). *P < 0.05; **P < 0.01.

MiR-4739 overexpression inhibited the tumor growth and pro-angiogenic activity of TE-1 cells in vivo. (a) Schematic of agomir-4739 or scramble in a nude mouse model. (b) Tumor volumes of mice in the control, agomir-4739, bevacizumab, and agomir-4739 plus bevacizumab groups. (c) Tumor growth curve after TE-1 cell injection. (d) Tumor weights of mice. (e) Detection of homeobox C10, vascular endothelial growth factor A, and CD31 proteins in tumor tissues using immunohistochemistry (magnification, ×200). *P < 0.05; **P < 0.01.

Discussion

Recently, an increasing number of studies have shown that microRNAs play a key role in the post-transcriptional regulation network of gene expression in esophageal cancer [7,9]. Liu et al [40]. found that upregulated miR-25 promoted epithelial–mesenchymal transition in ESCC by targeting E-cadherin signaling. Suyal et al [41]. reported that microRNA-335-5p was decreased and functioned as an oncosuppressor in ESCC. However, the biological role and molecular mechanisms of miR-4739 in ESCC remain unclear [11,12,42-44]. We confirmed that miR-4739 was expressed at lower levels in ESCC cells and tumor tissues than in non-cancerous cell lines and tissues, respectively. Using an array of functional experiments, we verified that miR-4739 expression is inversely related to ESCC and that miR-4739 overexpression reduces the malignant potential of ESCC cells. These findings suggest that miR-4739 exerts a tumor suppressor role in ESCC. Recently, the complex interacting network of microRNAs and transcription factors has attracted attention [45]. By employing powerful bioinformatics tools, we predicted that HOXC10 is a direct target gene of miR-4739. MiR-4739-overexpressing ESCC cells expressed lower levels of HOXC10 messenger RNA and protein. Moreover, miR-4739 directly targeted the 3′-UTR of HOXC10 and suppressed its luciferase activity, and was enriched in 3′-UTR-biotinylated miR-4739 cells compared to 3′-UTR-biotinylated negative control cells. These results support the hypothesis that HOXC10 (a HOX gene family transcription factor) is directly regulated by miR-4739. The HOXC10/PI3K/AKT pathway has been evaluated previously [46]. HOXC10 was identified as an oncogene that promotes malignant phenotypes by activating the PI3K/AKT pathway in esophageal cancer [20]. We mainly focused on the regulation of HOXC10 by miR-4739 and found that miR-4739 suppresses the phosphorylation of PI3K/AKT pathway molecules by inhibiting HOXC10 expression in ESCC cells. One of the hallmarks of cancer is sustained angiogenesis [47]. Vascular endothelial growth factors, especially VEGFA, play important roles in tumor angiogenesis [34,48,49]. In addition, it has been reported that HOXC10 promotes tumor angiogenesis and induces VEGFA expression in glioblastoma by binding to protein arginine methyltransferase-5.19 Our results revealed that miR-4739 overexpression decreased VEGFA expression in ESCC cells by downregulating HOXC10 expression, thus inhibiting tumor angiogenesis in vitro. The VEGFA-targeting monoclonal antibody, bevacizumab, was the first approved anti-angiogenesis drug for the treatment of cancer, and is still widely used in combination with other therapies [26]. However, simultaneously using microRNAs that inhibit intracellular VEGFA expression in cells (agomir-4739) and monoclonal antibodies that inhibit extracellular VEGFA (bevacizumab) have not been reported in vivo [39,50]. We first constructed an esophageal cancer murine model and then treated the tumor with phosphate-buffered saline, agomir-4739, bevacizumab, or agomir-4739 plus bevacizumab. Agomir-4739, which upregulates miR-4739 expression, inhibited the growth of esophageal tumors in mice. Furthermore, combination therapy with miR-4739 and bevacizumab for treating xenograft tumors showed significantly enhanced inhibitory effects toward the growth and angiogenesis of ESCC cells, supporting the potential of miR-4739 in combination with bevacizumab as a treatment for ESCC. The in-vivo experiment results revealed that miR-4739 is a potential therapeutic target for esophageal squamous cell carcinoma. This study has some limitations. First, the sample size used to measure the miR-4739 level was limited and may not be representative of all patients. Second, although we clarified the relationship between miR-4739 and HOXC10 in ESCC, more detailed regulatory upstream mechanisms, including those involving transcription factors, circular RNAs, and long non-coding RNAs that downregulate miR-4739 expression, should be investigated.

Conclusions

We confirmed that miR-4739 was expressed at low levels in ESCC tissues and cells. Increased levels of miR-4739 inhibit aggressive cell behaviors, including proliferation, migration, invasion, G1/S phase transition, and apoptotic arrest. Moreover, miR-4739 suppressed the proangiogenic activity of ESCC cells. Mechanistically, miR-4739 downregulated HOXC10 expression through direct interaction and then negatively regulated PI3K/AKT signaling or VEGFA expression. Additionally, agomir-4739 inhibited tumor growth and angiogenesis in vivo. Our study reveals a potential therapy for the treatment of ESCC by employing agomir-4739. Click here for additional data file.
  50 in total

1.  Direct serum assay for microRNA-21 concentrations in early and advanced breast cancer.

Authors:  Sota Asaga; Christine Kuo; Tung Nguyen; Marilou Terpenning; Armando E Giuliano; Dave S B Hoon
Journal:  Clin Chem       Date:  2010-10-29       Impact factor: 8.327

2.  Hoxc10 and Hoxd10 regulate mouse columnar, divisional and motor pool identity of lumbar motoneurons.

Authors:  Yuanyuan Wu; Guoying Wang; Sheryl A Scott; Mario R Capecchi
Journal:  Development       Date:  2008-01       Impact factor: 6.868

3.  MicroRNA-4739 regulates osteogenic and adipocytic differentiation of immortalized human bone marrow stromal cells via targeting LRP3.

Authors:  Mona Elsafadi; Muthurangan Manikandan; Nehad M Alajez; Rimi Hamam; Raed Abu Dawud; Abdullah Aldahmash; Zafar Iqbal; Musaad Alfayez; Moustapha Kassem; Amer Mahmood
Journal:  Stem Cell Res       Date:  2017-03-08       Impact factor: 2.020

Review 4.  VEGF in Signaling and Disease: Beyond Discovery and Development.

Authors:  Rajendra S Apte; Daniel S Chen; Napoleone Ferrara
Journal:  Cell       Date:  2019-03-07       Impact factor: 41.582

5.  Circulating MicroRNA-4739 May Be a Potential Biomarker of Critical Limb Ischemia in Patients with Diabetes.

Authors:  Ju-Yi Li; Biao Cheng; Xiu-Fang Wang; Zhong-Jing Wang; Hong-Mei Zhang; Shu-Fen Liu; Li-Sha Chen; Wen-Jing Huang; Jue Liu; Ai-Ping Deng
Journal:  Biomed Res Int       Date:  2018-11-14       Impact factor: 3.411

6.  Global Burden, Risk Factors, and Trends of Esophageal Cancer: An Analysis of Cancer Registries from 48 Countries.

Authors:  Junjie Huang; Anastasios Koulaouzidis; Wojciech Marlicz; Veeleah Lok; Cedric Chu; Chun Ho Ngai; Lin Zhang; Ping Chen; Shanjuan Wang; Jinqiu Yuan; Xiang-Qian Lao; Shelly L A Tse; Wanghong Xu; Zhi-Jie Zheng; Shao-Hua Xie; Martin C S Wong
Journal:  Cancers (Basel)       Date:  2021-01-05       Impact factor: 6.639

7.  HOXC10 promotes growth and migration of melanoma by regulating Slug to activate the YAP/TAZ signaling pathway.

Authors:  Yuanxin Miao; Weina Zhang; Su Liu; Xiangfeng Leng; Chunnan Hu; Hao Sun
Journal:  Discov Oncol       Date:  2021-04-26

Review 8.  miRNAs in Cancer (Review of Literature).

Authors:  Beata Smolarz; Adam Durczyński; Hanna Romanowicz; Krzysztof Szyłło; Piotr Hogendorf
Journal:  Int J Mol Sci       Date:  2022-03-03       Impact factor: 5.923

9.  A global perspective in second-line treatment patterns for patients with advanced esophageal squamous cell carcinoma.

Authors:  Dena H Jaffe; Joseph Gricar; Marc DeCongelio; deMauri S Mackie
Journal:  Thorac Cancer       Date:  2022-03-30       Impact factor: 3.223

10.  Urinary Exosomal miRNA Signature in Type II Diabetic Nephropathy Patients.

Authors:  Denis Delić; Claudia Eisele; Ramona Schmid; Patrick Baum; Franziska Wiech; Martin Gerl; Heike Zimdahl; Steven S Pullen; Richard Urquhart
Journal:  PLoS One       Date:  2016-03-01       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.