| Literature DB >> 35729186 |
Andrey D Manakhov1,2,3, Maria Yu Mintseva2, Lev I Uralsky1,2, Tatiana V Andreeva2,3, Oleg V Trapezov4,5, Evgeny I Rogaev6,7,8,9.
Abstract
Sable (Martes zibellina) and American mink (Neogale vison) are valuable species characterized by a variety of coat colour produced on fur farms. Black crystal fur phenotype is Mendelian codominant trait: heterozygous animals (Cr/ +) have white guard hairs scattered predominantly on the spine and the head, while homozygous (Cr/Cr) minks have coats resembling the Himalayan (ch/ch) or white Hedlund (h/h) types. It is one of the most recent of more than 35 currently known phenotypic traits of fur colour in American mink. Black crystal fur phenotype was first described in 1984 in the Russian population of mink, which had undergone selection for domestic defensive response to humans. Here, we performed whole-genome sequencing of American mink with Cr/Cr phenotype. We identified a missense mutation in the gene encoding the α-COP subunit of the COPI complex (COPA). The COPI complex mediates retrograde trafficking from the Golgi system to the endoplasmic reticulum and sorting of transmembrane proteins. We observed an interaction between a newly identified mutation in the COPA gene and a mutation in the microphthalmia-associated transcription factor (MITF), the latter mutation led to the formation of the white Hedlund (h/h) phenotype. Double heterozygotes for these mutations have an entirely white coat and a black-eyed phenotype similar to the phenotype of Cr/Cr or h/h minks. Our data could be useful for tracking economically valuable fur traits in mink breeding programs to contribute to global fur production.Entities:
Mesh:
Substances:
Year: 2022 PMID: 35729186 PMCID: PMC9213499 DOI: 10.1038/s41598-022-14079-z
Source DB: PubMed Journal: Sci Rep ISSN: 2045-2322 Impact factor: 4.996
Figure 1American minks with the standard dark brown, Black crystal heterozygous (C/ +) and Black crystal homozygous (C/C) phenotypes.
Results of sequencing of American mink genomes. Statistics were calculated using samtools[11] and Picard software. The American mink genome (NNQGG.v01) was used as a reference.
| Sample | Colour name | Colour symbol | Mapped % | Duplicates % | Coverage |
|---|---|---|---|---|---|
| mink_4-131 | Black crystal* | 98.06 | 0.86 | 9.37 | |
| mink_3-247[ | Standard dark brown | + | 98.70 | 2.72 | 7.07 |
| mink_3-261[ | Standard dark brown | + | 97.89 | 4.23 | 9.08 |
| mink_3-265[ | Standard dark brown | + | 98.07 | 2.30 | 8.53 |
| mink_7-331[ | Moyle | 98.15 | 0.70 | 8.11 | |
| mink_7-317[ | Violet | 98.46 | 8.53 | 40.32 | |
| mink_0-329[ | Silverblue | 98.30 | 3.13 | 5.43 | |
| mink_1-663[ | Silverblue | 97.14 | 11.82 | 5.73 | |
| mink_9-431[ | Silverblue | 97.82 | 4.28 | 5.17 |
*Completely white animal, with no hearing defects.
Figure 2COPA mutation. (a) Structure of the mink COPA gene. The red arrow indicates the COPA mutation. Dotted boxes indicate 5’- and 3’-UTRs. Equal introns sizes are shown for simplification. (b) An electrophoregram of Sanger sequencing for COPA gDNA exon 6. The orange frame is the COPA c.478 C>T mutation in Black crystal animals.
Results of COPA and MITF genotyping in American mink. The p-value is 0.00023 for association of the T allele of COPA with Black crystal fur colour (OR = 218; 95% CI 12.45–3825.13).
| Coat colour name | Coat colour symbol | Genotype | Genotype | Number of animals |
|---|---|---|---|---|
| Black crystal* | T/C | G/G | 10 | |
| Black crystal** | T/T | G/G | 3 | |
| T/T | G/A | 1 | ||
| T/C | G/A | 3 | ||
| Standard dark brown | + | C/C | G/G | 25 |
| Violet | C/C | G/G | 1 | |
| Royle pastel | C/C | G/G | 1 | |
| Hedlund white | C/C | A/A | 1 | |
| Moyle | C/C | G/G | 1 | |
| Silverblue | C/C | G/G | 3 | |
| Shadow Silverblue | C/C | G/G | 1 | |
| Black cross | C/C | G/G | 1 |
*Animals with white guard hairs on the spine and head.
**Completely white animals, with no hearing defects.
Primer sequences used for cDNA and gDNA amplification.
| Primer name | Primer sequence | Expected amplicon size (bp) | Annealing t (°C) |
|---|---|---|---|
| TTCCTCAACAATCCGCTAAC | 506 | 58 | |
| TCAGAGGAAAGAAGGGGACT | |||
| CTTCTCTATGCCCGTCAGTC | 368 | 58 | |
| GAACAGGAGCTGATGGAGAG |