Bothrops lanceolatus snake venom impairs mitochondrial respiration and induces DNA release in human heart preparation.

INTRODUCTION: Envenomations by Bothrops snakebites can induce overwhelming systemic inflammation ultimately leading to multiple organ system failure and death. Release of damage-associated molecular pattern molecules (DAMPs), in particular of mitochondrial origin, has been implicated in the pathophysiology of the deregulated innate immune response.
OBJECTIVE: To test whether whole Bothrops lanceolatus venom would induce mitochondrial dysfunction and DAMPs release in human heart preparations.
METHODS: Human atrial trabeculae were obtained during cannulation for cardiopulmonary bypass from patients who were undergoing routine coronary artery bypass surgery. Cardiac fibers were incubated with vehicle and whole Bothrops lanceolatus venom for 24hr before high-resolution respirometry, mitochondrial membrane permeability evaluation and quantification of mitochondrial DNA.
RESULTS: Compared with vehicle, incubation of human cardiac muscle with whole Bothrops lanceolatus venom for 24hr impaired respiratory control ratio and mitochondrial membrane permeability. Levels of mitochondrial DNA increased in the medium of cardiac cell preparation incubated with venom of Bothrops lanceolatus.
CONCLUSION: Our study suggests that whole venom of Bothrops lanceolatus impairs mitochondrial oxidative phosphorylation capacity and increases mitochondrial membrane permeability. Cardiac mitochondrial dysfunction associated with mitochondrial DAMPs release may alter myocardium function and engage the innate immune response, which may both participate to the cardiotoxicity occurring in patients with severe envenomation.

Introduction

Envenomation induced by Bothrops snake bites presents a vast spectrum of clinical severity ranging from mild cases, with local edema and pain as predominant manifestations, to severe cases, in which a series of life-threatening manifestations may occur [1]. Bleeding, coagulopathy, edema, and hemodynamic alterations are typical clinical manifestations of Bothrops snake envenomation [1,2]. Mechanisms of these devastating local and systemic manifestations are attributed to the direct effects of toxins contained in snake venom predominately including snake venom metalloproteinases, snake venom serine proteinases, phospholipases A2, C-type lectin-like toxins, disintegrins, cysteine-rich secretory proteins, and L-amino acid oxidases [1].

Toxins delivered to the victims can also trigger a potent systemic inflammatory response host defense accompanied by the release of a multitude of mediators and signaling molecules leading to edema, endothelial activation, leukocyte migration and prothrombotic features [3,4]. Stimulation of the innate immune response in snakebite envenomation has been attributed to the expression of surface and cytosolic Toll-Like Receptors (TLRs) enabling the recognition of molecular patterns such damage and venom associated molecular patterns, i.e., DAMPs and VAMPS [5-8]. Once engaged, TLRs trigger signaling pathways that culminate in the transcription of inflammatory genes boosting the inflammatory response systems. These events can progress to either resolution or an excessive and uncontrolled systemic inflammatory response leading to multiple organ failure and death [1,2].

Within the last decade, mounting evidence suggest that damaged mitochondria activate innate immune pathways [9]. Because of their bacterial origin, parallels between how cells respond to mitochondrial and bacterial ligands are not altogether surprising. Mitochondrion-driven innate immunity has been related to the ability of mitochondrial DAMPs release (e.g., mtDNA, cardiolipin, formyl-methionine-labeled peptides, and cytochrome c) to engage pattern recognition receptors such as TLRs and trigger the inflammatory cascade [9,10]. Although the importance of mitochondrial DAMPs in triggering inflammation is well-recognized in many human pathologies, studies on their participation in snake venom-induced inflammation are scarce [7,8]. Previous experiments have demonstrated that Bothrops snake venom elicits mitochondrial DNA (mtDNA) and cytochrome c release in ex vivo treatment of tibialis anterior muscles [7]. In addition, injection of Bothrops snake venom in mice induced the release of mtDNA and cytochrome c in the circulation [7]. Overall, experimental evidence suggest that mitochondrial DAMPs release would mediate inflammatory signals in the envenomed tissue environment. Such mechanism has not been demonstrated in humans. As mitochondria account for ∼35% of the cardiomyocyte volume, human heart preparations can provide a suitable model for the evaluation of the impact of snake venoms on mitochondrial function.

The aim of the present study was to test whether whole Bothrops lanceolatus venom would induce mitochondrial dysfunction and DAMPs release in human heart preparations. Specifically, we assessed mitochondrial respiration in human cardiac permeabilized fibers and the release of mtDNA of human myocardium preparation exposed to venom mixture.

Materials and methods

Ethics statement

The study was conducted in accordance with the amended Declaration of Helsinki (http://www.wma.net/en/30publications/10policies/b3/). All patients gave their informed consent for the processing of personal data and tissue collection for scientific research purposes. The study was approved by the French medical ethics committee (CPP: 19-MART-01).

Human right atrial trabeculae

Right atrial appendages were obtained during cannulation for cardiopulmonary bypass from patients who were undergoing routine coronary artery bypass surgery. All patients were anaesthetized with target-controlled administration of sevoflurane or propofol, sufentanil, and skeletal muscle relaxant. Patients with atrial arrhythmia or history of atrial arrhythmia and those with left ventricular ejection fraction < 55% were excluded from the study. Atrial appendages obtained during surgery were placed in ice-cold Krebs-Henseleit buffer (KHB), and immediately delivered to laboratory.

Human atrial myocardium preparations

Atrial appendages were carefully prepared under stereomicroscopic control in ice-cold BIOPS relaxing solution as we have previously described [11]. Fibers were separated with sharp forceps and transferred to vials containing 2 ml of oxygenated (95% O2, 5% CO2) BIOPS buffer containing 2.77 mM CaK2EGTA, 7.23 mM K2EGTA, 6.56 mM MgCl2, 0.5 mM dithiothreitol, 50 mM K-MES, 20 mM imidazole, 20 mM taurine, 5.3 mM Na2ATP, 15 mM phosphocreatine, pH 7.1. at 37°C. Whole Bothrops lanceolatus venom (10 and 100 μg/ml) (Latoxan Laboratory, Portes lès Valence, France) or vehicle, i.e., human serum albumin in equivalent volume (10 and 100 μg/ml) (Sigma Aldrich, France) were added to the vials. After 24hr of incubation, fibers and supernatants were separated by centrifugation (50g at 4°C for 10 minutes) and used for measurements of mitochondrial respiration and mtDNA quantification, respectively.

High-resolution respirometry

At the end of incubation time, fibers (10 mg) were transferred into 2mL of fresh ice-cold BIOPS relaxing solution and 20μL of saponin (freshly-prepared stock solution 5mg/mL) are added to obtain final concentration of 50μM. Bundles were maintained for 30 min with saponin solution, and then washed for 5 min three times in ice-cold respiration medium MiRO5 containing 110 mM sucrose, 20 mM HEPES, 10 mM KH2PO4, 20 mM taurine, 3 mM MgCl2 6H2O, 60 mM MES-K, 0.5 mM EGTA and 0.1% bovine serum albumin; pH 7.1. Respiration rates were measured (O2k oxygraph, Oroboros, Innsbruck, Austria) and expressed in picomoles O2 per second per milligram wet weight. Data acquisition and analysis were performed with Datlab4 software (Oroboros, Innsbruck, Austria).

Substrate and/or inhibitors for respiratory experiments were added within MiRO5 in a step-by-step manner using micro syringes. Chemical agents (Sigma Aldrich, France) were sequentially prepared according to Oroboros manufacturer data sheet and administered as we have previously described [12]. Respiration rates were measured (O2k oxygraph, Oroboros, Innsbruck, Austria) and expressed in picomoles O2 per second per milligram wet weight.

Chemical agents (Sigma Aldrich, France) were sequentially prepared according to Oroboros manufacturer data sheet and administered as described below:

Complex I-dependent state 2 respiration (V0) was determined as the respiration rate in the presence of 10 mM L-glutamate and 2 mM L-malate dissolved in H2O, which activate the Krebs cycle enzyme malate dehydrogenase providing NADH to complex I of the respiratory chain.

Complex I-dependent state 3 respiration (Vglut+mal) was determined as a phosphorylation-stimulated respiration rate in the presence of 5 mM ADP added to the V0 medium providing ADP to F1-F0 ATP synthase. The coupling of phosphorylation to oxidation was estimated by calculating the respiratory control ratio (RCR) as the ratio Vglut+mal / V0.

Intactness of mitochondrial outer membrane was evaluated by the mean of cytochrome c. In brief, respiration in the presence of 10μM cytochrome c dissolved in ethanol (Vcyt-c) (horse heart cytochrome c, Sigma Aldrich, France) was determined. Vcyt-c/Vglut+mal ratio was used as a permeability index of the outer mitochondrial membrane.

Complex I+II-dependent state 3 respiration (Vsucc+glut) was determined as a phosphorylation-stimulated respiration rate in the presence of 10 mM succinate dissolved in H2O and added to the Vcyt-c medium activating the Krebs cycle enzyme succinate dehydrogenase providing FADH2 and the complex II (succinate dehydrogenease) of the respiratory chain.

Complex I+II-dependent respiration (Vsucc+glut) was then uncoupled by addition of 10 μM carbonyl cyanide p-(trifluoro-methoxy) phenyl hydrazone (FCCP), an oxidative phosphorylation uncoupler, dissolved in ethanol and added to the Vsucc+glut medium. FCCP makes the inner mitochondrial membrane permeable to protons and fully activates mitochondrial respiration. Dissipation of the proton gradient along the inner mitochondrial membrane inhibits ADP phosphorylation by F1-F0 ATP synthase.

Complex II-dependent uncoupled state of respiration (Vrot) was determined as the respiration rate by adding 0.5 μM of complex I inhibitor rotenone dissolved in ethanol to the medium.

O2 consumption independent of the respiratory-chain (VAA) was determined as the respiration rate in presence of complex III inhibitor antimycin-A dissolved in ethanol (2.5 μM) and added to the Vrot medium. Thus, electron supply to respiratory chain complex IV, and respiratory chain respiration were stopped.

Complex IV-dependent uncoupled state of respiration (VCOx) was determined in two steps. O2 consumption was first determined in presence of 2 mM ascorbate and 0.5 mM N,N,N’,N’-tetramethyl-p-phenylenediamine dihydrochloride TMPD dissolved in H2O and added to the VAA medium (VTMPD-asc). TMPD was used as an artificial redox mediator that assists electron transfer from ascorbate to cytochrome c. TMPD-ascorbate auto-oxidation was then determined as the O2 utilization (O2 consumption) in presence of 1 mM KCN added to the VTMPD-asc medium. Complex IV-dependent uncoupled state of respiration (VCOx) was calculated as VTMPD-asc minus VKCN. As antimycin-A inhibits complex III, VCOx estimates complex IV-related maximum respiration rate.

At the end of each experiment, chambers were calibrated for zero O2 content with dithionite.

Mitochondrial membrane integrity

Mitochondrial membrane integrity was indirectly evaluated by measuring reduction of exogenous cytochrome c (Cyt c) [13]. In healthy mitochondria, Cyt c is located in the mitochondrial intermembrane/inter-cristae spaces, where it functions as an electron shuttle to drive the respiratory chain activity. Impaired mitochondrial membrane permeability allows more cytochrome c to enter the mitochondria and stimulates mitochondrial respiration.

Mitochondrial DNA (mtDNA) copy number and real-time PCR

At the end of incubation time, supernatant (200 μL) were treated with RNAse A (100 mg/ml) to avoid RNA contamination and mtDNA was extracted using QIAamp DNA Mini Kit (Qiagen, France) following manufacturer’s instructions. The relative mtDNA copy number was measured by PCR and corrected by simultaneous measurement of the nuclear DNA. The forward and reverse primers for mtDNA which are complementary to the sequence of the human mitochondrial ND2 gene were ND2 forward primer (TAAAACTAGGAATAGCCCCC) and reverse primer (TTGAGTAGTAGGAATGCGGT) [14] and sequences complementary to the 18S gene were the primers used for the detection of nuclear DNA. Quantitative PCR was performed on an Eppendorf Realplex S2 (Eppendorf, Germany) using Mesa Blue Mix (Eurogentec, France). Mitochondrial DNA levels were adjusted for nuclear DNA levels and analyzed using the ΔΔCt method.

Statistics

Numerical data are given as mean ± standard deviation (SD). The Shapiro-Wilk test was used to test for normal distribution of numerical data. Data were analyzed by using Student-t test and analysis of variance ANOVA. When a significant difference was found, we identified specific differences between groups with a sequentially rejective Bonferroni procedure. After application of the Bonferroni correction, p < 0.05 was taken as a level of statistical significance. Results were analyzed with the SPSS for Windows software, version 24.0 (SPSS Paris-la-Defense, France).

Results

We assessed functional properties of mitochondrial respiration of human heart preparations in dependence on the storage time as previously described. Mitochondrial respiration was evaluated in cardiac fibers immediately permeabilized after a 24hr storage period as described in Materials and methods. Long temporal stability of mitochondrial function in human cardiac muscle fibers is summarized Table 1. Pilot experiments demonstrated that compared with vehicle, incubation of cardiac fibers with whole Bothrops lanceolatus venom for 3hr and 6hr had no effects on mitochondrial respiration (n = 2 in each experiments). Compared with vehicle, incubation of human cardiac muscle with whole Bothrops lanceolatus venom for 24hr consistently induced respiratory control ratio reduction (Fig 1A). Respiration rates expressed in picomoles O2 per second per milligram wet weight are summarized Table 2 and S1 Data.

Table 1

Respiration rates of control cardiac human fibers in dependence on the storage time.

	glutamate malate		Cyt c	succinate	rotenone	TMPD/asc
	V0	Vglut+mal	Vcyt-c/Vglut+mal	Vsucc	Vrot	VCOx
T0	3.1±2.3	42.2±6.4	48.1±3.4	48.6±2.1	32.0±7.1	72.9±11.9
T24h	4.3±0.8	41.3±8.5	45.5±5.5	46.7±2.5	30.4±6.5	68.0±9.3
p-value	0.255	0.840	0.348	0.185	0.693	0.445

Rates of respiration are given in picomoles O2 per second per milligram wet weight (pmol/O2/sec/mg) at baseline and following 24hr storage in BIOPS medium. See Materials and Methods for detailed description. V0 complex I-dependent state 2 respiration; Vglut+mal complex I-dependent state 3 respiration; Vsucc complex I+II-dependent state 3 respiration; Vrot complex II-dependent uncoupled state of respiration; VCox complex IV-dependent uncoupled state of respiration. Data are mean±SEM. Results were analyzed with Student t-tests (n = 6 in each group).

Fig 1

Respiratory control ratio (A), effects of exogenous Cyt c (B) on respiratory rate expressed as (Vcytc—Vglut+mal)/Vglut+mal and medium release of mtDNA (C) in cardiac preparations treated with vehicle and whole Bothrops lanceolatus venom for 24hr. Relative ND2 DNA levels to 18S nuclear gene expression. Data are mean ± SD (n = 8). * indicates p<0.05.

Table 2

Effects on respiration rates of 24hr incubation of cardiac human permeabilized fibers with vehicle and whole Bothrops lanceolatus venom.

	glutamate malate		succinate	rotenone	antimycin-A	TMPD/asc
	V0	Vglut+mal	Vsucc + glut	Vrot	VAA	VCOx
vehicle	4.3±0.8	41.3±8.5	46.7±2.5	30.4±6.5	3.3±0.5	68.0±9.3
10μg/ml	3.7±1.3	17.3±1.4 *	16.7±2.5*	10.4±2.5 *	1.8±1.3	62.0±2.9
100μg/ml	4.1±0.9	10±0.8 *	12.5±0.3 *	8.5±0.6 *	2.1±1.8	38.0±7.1 *

Rates of respiration are given in picomoles O2 per second per milligram wet weight (pmol/O2/sec/mg) in vehicle and venom-treated cardiac preparation. See Materials and Methods for detailed description. V0 complex I-dependent state 2 respiration; Vglut+mal complex I-dependent state 3 respiration; Vsucc complex I+II-dependent state 3 respiration; Vrot complex II-dependent uncoupled state of respiration; VCox complex IV-dependent uncoupled state of respiration. Data are mean ± SD (n = 8). * indicates p<0.05.

Exogenous Cyt c induced mitochondrial respiration increased less than 5% (Fig 1B) in human cardiac muscle incubated with vehicle for 24hr. In contrast, exogenous Cyt c induced significant increases of mitochondrial respiration in human cardiac muscle incubated with whole Bothrops lanceolatus venom for 24hr, suggesting impairment of mitochondrial membrane permeability.

In order to extend the analysis of mitochondrial permeability, quantification of mtDNA in the supernatant of cardiac cell preparation incubated with vehicle and whole Bothrops lanceolatus venom for 24hr were performed. Fig 1C shows that mtDNA was detectable in the medium following incubation of cardiac cell preparation with whole Bothrops lanceolatus venom for 24hr (S2 Data).

Discussion

Snake envenomation is a common but neglected disease that affects millions of people around the world annually [1]. In the overseas French territories, snakebites are related to the presence of endemic venomous snake species such as Bothrops atrox, Bothrops brazili, and Lachesis muta in French overseas territories and Bothrops lanceolatus in Martinique [15,16]. In these overseas territories, Bothrops snakebites are responsible for life-threatening envenomations related to an overwhelming systemic inflammatory and hemostatic host response. Proposed mechanisms of these complications include the release of damage-associated molecular pattern molecules (DAMPs), in particular of mitochondrial origin, which triggers the systemic inflammatory response [5-8]. Here for the first time, we have shown in human heart preparation that venom of Bothrops lanceolatus causes mitochondrial dysfunction and mitochondrial DNA release, which is regarded as an endogenous danger signal inducing the inflammatory response.

Firstly, we found that venom of Bothrops lanceolatus caused reduction of respiratory control ratio in human heart preparation, suggesting that efficiency of mitochondrial oxidative phosphorylation was impaired. Previous studies in human cell lines have shown that toxins isolated from Bothrops snake venom can promote mitochondrial dysfunction [17-19]. Changes of mitochondrial respiration induced by snake venoms in human tissue have not been previously reported. Here, we have shown that venom of Bothrops lanceolatus deteriorates oxidative phosphorylation capacity in human cardiac preparation. Further experiments using contracting isolated human right atrial trabeculae are warranted to demonstrate that such oxidative phosphorylation deficits may be associated with cardiac contractile dysfunction, which can occur in pitviper snake envenoming [20,21].

Secondly, we found that venom of Bothrops lanceolatus impaired mitochondrial membrane permeability, which was evaluated indirectly by measuring reduction of exogenous cytochrome c (Cyt c) in the medium of cardiac fiber preparation. Cyt c, a peripheral protein, only loosely bound of the mitochondrial inner membrane, functions as an electron shuttle between complex III and complex IV of the respiratory chain [13]. If the outer membrane of mitochondria is damaged, the endogenous Cyt c can be released from intermembrane space at physiological ionic strength and will inhibit respiration. In high-resolution respirometry studies, Cyt c is applied to test the integrity of the mitochondrial outer membrane [13]. Herein, when outer membrane of mitochondria is intact the addition of exogenous Cyt c has no effect on respiration. In contrast, addition of exogenous Cyt c to the experimental preparation will markedly stimulate the respiratory rate when the outer membrane of mitochondria has been damaged. In our study, addition of exogenous Cyt c induced significant increases of mitochondrial respiration in human cardiac muscle incubated with whole Bothrops lanceolatus venom, suggesting impairment of mitochondrial membrane permeability. In order to extend the evaluation of mitochondrial permeability increase, we evaluated the release of mtDNA in the medium of cardiac cell preparation incubated with venom of Bothrops lanceolatus. Consistently with previous experiments showing that mitochondrial DNA, cytochrome c, and ATP are released in tissue affected by venoms of Bothrops [7,8], we confirm that whole Bothrops lanceolatus venom can induce the release of mitochondrial DNA in human heart tissue.

Overall, it is likely that mitochondrial DNA, a ligand of several innate immune receptors, would be involved in intensity of the inflammatory response in envenomed patients. Indeed, mitochondria are cellular organelles that orchestrate several biological processes, ranging from energy production and metabolism to cell death and inflammation. Release of mitochondrial DNA into the cytoplasm and out into the extracellular milieu activates a plethora of different pattern recognition receptors and innate immune responses, including TLRs and inflammasome formation leading to, among others, robust type I interferon responses [22]. Upon stress or cellular damage, one group of DAMPs, the mitochondrial nucleic acids, are released from their compartments and sensed as foreign, eliciting a similar innate immune response one would see against pathogens. Most of the sensors of mtDNA have only been recently identified [22]. Amongst all the cytosolic DNA sensors, cyclic GMP–AMP synthase (cGAS), activating endoplasmic reticulum-resident Stimulator of interferon genes (STING) are probably the most explored pathway. This pathway is triggered during infection with cytosolic bacterial pathogens and some DNA viruses resulting into transcriptional induction of type I interferon and the nuclear factor-κB (dependent expression of proinflammatory cytokines [23].

Study limitations

This study had several limitations. First, the study mainly documented the effects of incubation with whole Bothrops lanceolatus venom after 24hr, whereas shorter time intervals that would induce similar mitochondrial alterations were not studied in details. Identification of DAMPs released in the supernatant of cardiac cell preparation incubated with vehicle and whole Bothrops lanceolatus venom was limited to mtDNA. Besides, it was not possible to identify the toxins responsible for the mitochondrial effects as experiments were done with crude venom. Eventually, whether changes in oxidative phosphorylation induced by whole Bothrops lanceolatus venom can induce cardiac contractile dysfunction was not studied.

Conclusion

Our study suggests that incubation of human cardiac cell preparation with whole Bothrops lanceolatus venom for 24hr impairs mitochondrial oxidative phosphorylation capacity and elicits the release of mitochondrial DNA, a known trigger of the innate immune response.

Supporting information file on mitochondrial respiration protocols and results.

(XLSX)

Click here for additional data file.

Supporting information file on RT PCR raw data for human mitochondrial ND2 gene

(XLSX)

Click here for additional data file.

16 Apr 2022

Dear Pr NEVIERE,

Thank you very much for submitting your manuscript "Bothrops lanceolatus snake venom impairs mitochondrial respiration and induces DNA release in human heart preparation" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Kartik Sunagar, Ph.D.

Deputy Editor

PLOS Neglected Tropical Diseases

Kartik Sunagar

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: The objectives of this study are clear and well presented. The study design is appropriate and the population is clearly described, as well as the methods used. Appropriate statistical analyses were carried out. I have no ethical concerns with the study.

Line 101: The term ‘purified venom’ is a bit misleading since the term ‘purified’ usually refers to the use of isolated toxins. In this case the authors are using crude or whole venom. I suggest using the term ‘whole B. lanceolatus venom' throughout the paper instead of ‘purified venom’.

Line 103: The authors only used one incubation time (24 hr). It would have been appropriate to use shorter incubation times as well, for example 3 hr or 6 hr, to have a view on the early effects of venom in the system. That would provide a time-course of the effects being studied.

Reviewer #2: Please refer general comments

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: The analysis presented matched the analysis plan and are clearly formulated. Results are clear and well presented. The figures and tables are also clear and summarize the main findings of the study.

Line 174: The text is confusing with the use of the word ‘either’. Please revise.

Reviewer #2: Please refer general comments

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: Most of the conclusions are supported by the data, with one exception: Line 226: The extrapolation of these observations to the clinical situation should be made with caution. In the experimental setting used. Cardiac tissue is directly exposed to venom for a prolonged period of time (24 hr). This is very different from a real envenoming case since (a) previous toxicokinetic data indicate that venom concentration in cardiac tissue after experimental envenoming in vivo is very low, and (b) the vasculature of the heart is of the ‘continuous’ type, meaning that it has low permeability and, therefore, the amount of venom that would reach myocardial cells is probably low in vivo. Thus, even though the observations clearly demonstrate that this venom is able to affect cardiac tissue and release DAMPs, the extrapolation of these findings to explain cardiac effects in snakebites is too speculative. This comment also applies to the conclusion paragraph (lines 248-250).

The authors present a well structured discussion on how these findings help to explain one important aspect of the action of snake venoms in tissues, i.e., the release of DAMPs which might impact on the innate immune response, with a possible effect on the systemic outcome of envenomings.

The authors did not discuss the limitations of their work, some of which are: (1) the incubation time is 24 hr and it is not clear whether shorter time intervals would induce similar alterations. (2) The work was done with crude venom, and this does not allow the identification of the toxins responsible for the effects.

Line 212: It should be Bothrops atrox, B. brazili and Lachesis muta

Line 213: It should be ‘French overseas territories’

Reviewer #2: Please refer general comments

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: (No Response)

Reviewer #2: Please refer general comments

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: This study presents an interesting contribution that expands our understanding on the action of the venom of B. lanceolatus. In recent years, the concept that snake venoms induce tissue damage with the release od DAMPs, and that these molecules may play a role in the overall pathophysiology of envenoming, contributing to systemic inflammation, has gained support. This study demonstrates with a sound experimental setting that the venom of B. lanceolatus is able to impair mitocondrial respiratory funcion in human cardiac tissue and also to release DAMPs from the tissue.

My main concern has to do with the extrapolation made by the authors on the possible implications of their findings for the clinical cardiotoxicity induced by this venom. In my comments to the Discussion I have mentioned why I believe this extrapolation is too speculative and not necessarily suported by their findings. The main conclusion of this study should be focused on the ability of venom to impair mitochondrial function and to release DAMPS from the tissue, without extrapolating this to explain cardiac dysfunction in envenomings. For this, the authors should use in vivo experimental systems.

Reviewer #2: The study on Bothrops lanceolatus snake venom impairs mitochondrial respiration and induces DNA release in human heart preparation (PNTD-D-22-00263) by Cano-Sanchez et al have tried to address the effect of the venom on the cardiac muscle fibres, especially on the role of mitochondria in the venom induced toxicity. The authors have made an interesting observation of leaking of mitochondrial DNA which they consider it as the sole DAMP involved in venom induced cardiac related systemic toxicity. It is interesting that the authors have also tried to connect the mitochondrial DNA release to the innate immune response. The manuscript may be accepted after addressing the following queries.

Minor comments:

Line 65 – remove receptor from ‘Toll-Like Receptor (TLR) receptors’.

Line 103 - what is the vehicle control used?

Line 135- mention the concentration of antimycin-A.

Line 192 - In table 2, third column doesn’t match the description of the legend.

Line 195, 197,198 - There is no uniformity in manuscript writing, for example, VAA is written as VAA.

Line 196 - Correct the word ‘Vsucc+glu’.

Line 106 – methodology for, ‘High-resolution respirometry’ is clumsy and difficult to follow. Split the methodology and explain in detail.

Major comments:

What is the basis for Bothrops lanceolatus venom targeting cardiac muscle fibres only?

The authors have to discuss about the fate of mitochondria after releasing their DNA. It is even better if they demonstrate the extent of their viability.

Inclusion of the data on nuclear DNA release will make the readership better.

As the study focuses on the mitochondrial dysfunction, it is essential to shed light on the possible role of mitochondrial membrane lipids, example lipid peroxidation, cardiolipin role etc if any.

The authors have focussed only on the release of mitochondrial DNA, it is important that they should address how and what promote the DNA release. Is the venom/venom toxin(s) exerting the DNA release effect directly interacting with the mitochondria (after crossing the sarcolemma) or does it acts at the sarcolemma level? An insight in to the mechanism of action will provide better clarity.

It is important for the authors to demonstrate the state of respiration of mitochondria in venom treated cardiac fibres without saponin treatment.

Mitochondrial DNA release and its connectivity to innate immunity need to be discussed properly.

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

27 Apr 2022

Submitted filename: Reviewers PLOS Neglected Tropical Diseases.docx

Click here for additional data file.

20 May 2022

Dear Pr NEVIERE,

We are pleased to inform you that your manuscript 'Bothrops lanceolatus  snake venom impairs mitochondrial respiration and induces DNA release in human heart preparation' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Kartik Sunagar, Ph.D.

Deputy Editor

PLOS Neglected Tropical Diseases

Kartik Sunagar

Deputy Editor

PLOS Neglected Tropical Diseases

***********************************************************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: See general comments

Reviewer #2: Refer general comments

**********

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: See general comments

Reviewer #2: Refer general comments

**********

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: See general comments

Reviewer #2: Refer general comments

**********

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: (No Response)

Reviewer #2: Refer general comments

**********

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: The authhors have adequately aqddressed my concerns and suggestions to the first version of this manuscript. The modifications introduced are satisfactory.

Reviewer #2: The authors have studied the effect of Bothrops lanceolatus venom on the mitochondrial dysfunction and DAMPs release in human heart preparations. The observed effects were demonstrated in permeabilized cardiac fibers.

The main concern was that the authors have demonstrated the mitochondrial dysfunction and DAMPs release in permeabilized cardiac fibers. Therefore, they were asked to demonstrate the effects in non-permeabilized cardiac fibers. That is treating the cardiac fibers directly with the venom, and also the signaling pathway. These have not been addressed.

In this study, the role of TLRs, inflammasome formation, and type-I interferon responses are all speculative. Therefore need justifications.

The last, but one sentence in the abstract is too speculative. ‘Hence, mitochondrial DAMPs will engage a vicious circle, which deregulates inflammation via aberrant mitochondrial signaling, impaired mitophagy, and disruption of mitochondrial dynamics. In this study, no evidence has been provided to justify the following statement.

Mitochondrial dysfunction and release of mitochondrial DNA (DAMP) are good observations. Therefore, this manuscript may be accepted as a short report.

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

16 Jun 2022

Dear Pr NEVIERE,

We are delighted to inform you that your manuscript, "Bothrops lanceolatus  snake venom impairs mitochondrial respiration and induces DNA release in human heart preparation," has been formally accepted for publication in PLOS Neglected Tropical Diseases.

We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Shaden Kamhawi

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Paul Brindley

co-Editor-in-Chief

PLOS Neglected Tropical Diseases