Literature DB >> 35723058

Salvianolic acid B attenuates membranous nephropathy by activating renal autophagy via microRNA-145-5p/phosphatidylinositol 3-kinase/AKT pathway.

Junqi Chen1,2, Qinghong Hu1, Yini Luo1, Lina Luo1, Hua Lin1, Dandan Chen1, Yuan Xu1, Bihao Liu2, Yu He2, Chunling Liang1, Yaoyu Liu1, Jiuyao Zhou2, Junbiao Wu1.   

Abstract

The abnormal proliferation and inflammatory response of the mesangial cells play a crucial role in the progression of membranous nephropathy (MN). Herein, this study aimed to investigate the therapeutic effect of Salvianolic acid B (SalB) on MN-induced mesangial abnormalities and its underlying mechanisms. MN models were established in cationic bovine serum albumin-induced Sprague-Dawley rats and lipopolysaccharide-induced human mesangial cells (HMCs). Following SalB and microRNA-145-5p antagomir treatment, kidney function was investigated by 24-hours urine protein, serum creatinine, and blood urea nitrogen. Pathological changes of kidney were investigated by Periodic acid Schiff staining. CD68 and IgG were detected by immunofluorescence in glomerulus. Mesangial autophagosomes were observed by transmission electron microscope. MicroRNA-145-5p inhibitor, mimic, LY294002, and SalB were used to treat with HMCs. In kidney and HMCs, IL-1 β, IL-2, IL-6, TNF-α and microRNA-145-5p was detected by quantitative real-time PCR. Phosphatidylinositol 3-kinase (PI3K), phosphorylated AKT, AKT, beclin1, and microtubule-associated protein light chain 3 (LC3) levels were detected by Western blot. HMCs proliferation and cycle were detected by Cell Counting Kit-8 and flow cytometry. LC3 were detected by LC3-dual-fluorescent adenovirus in HMCs. Our results showed that SalB significantly ameliorated kidney function and pathological changes. Furthermore, it significantly alleviated proliferation, inflammation and activated autophagy in mesangial cells. Moreover, microRNA-145-5p antagomir accentuated MN while microRNA-145-5p inhibitor and LY294002 encouraged proliferation and inflammation through PI3K/AKT pathway in HMCs. Collectively, our study demonstrated that SalB activated renal autophagy to reduce cell proliferation and inflammation of MN, which was mediated by microRNA-145-5p to inhibit PI3K/AKT pathway, and ultimately attenuated MN.

Entities:  

Keywords:  PI3K/AKT pathway; Salvianolic acid B; autophagy; membranous nephropathy; mesangial cells; miRNA-145-5p

Mesh:

Substances:

Year:  2022        PMID: 35723058      PMCID: PMC9345616          DOI: 10.1080/21655979.2022.2083822

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   6.832


Highlights

SalB alleviated proliferation and inflammation of mesangial cells in MN rats. SalB upregulated miR-145-5p in MN rats. Antagonized miR-145-5p deteriorated MN in rats. MiR-145-5p activated autophagy through PI3K/AKT pathway.

Introduction

Membranous nephropathy (MN) is a vital cause of adult nephrotic syndrome, results from immune deposits in the epithelial side of the glomerular capillary loop [1]. According to epidemiological investigation, approximately 40% of patients deteriorate to end-stage renal disease (ESRD) within 10 years if they are untreated [2]. The abnormal proliferation of mesangial cells and deposition of mesangial matrix contribute to glomerulonephritis, glomerulosclerosis, and ESRD [3]. A latest single-cell sequencing result in MN indicates that the cross-talk between mesangial cells and other intrinsic renal cells play a crucial role in modulating inflammation as well as immunity [4]. Hence, it is of significance to explore the molecular mechanisms underlying MN-induced mesangial cells abnormities and to exploit potential agents. Dysregulated autophagy contributes to chronic kidney disease of varied aetiologias, including diabetic kidney disease [5], polycystic kidney disease [6] and focal segmental glomerulosclerosis [7]. Autophagy is a lysosome-dependent intracellular degradation system [8], basal autophagy in renal cells is essential for the maintenance of kidney homeostasis, structure, and function [9]. Each stage of autophagy requires precise regulation of autophagy-related genes by microRNA (miR) [10]. miR-145-5p was a regulatory molecule that induced autophagy in the kidney [11]. Recent researches indicated that increasing autophagy activity regulated by miR-145-5p attenuated different diseases such as human Tenon’s capsule fibroblasts and laryngeal squamous cell carcinoma [12-14]. Our previous study had shown that miR-145-5p reduced the proliferation of mesangial cells and the secretion of proinflammatory factors [15]. Thus, targeting miR-145-5p-autophagy represents an attractive strategy to alleviate kidney diseases. Salvianolic acid B (SalB) is an important water-soluble active ingredient, isolated from Danshen [16]. Studies have identified SalB has anti-inflammatory, anti-apoptotic, anti-fibrotic effects and other beneficial effects on renal injury and fibrosis [17,18]. Additionally, studies have reported that SalB attenuates chronic heart failure and renal fibrosis through activating autophagy [19,20]. A recent study reports that SalB alleviates mitochondrial dysfunction by improving endothelial mitophagy in diabetic mice [21]. Therefore, the mechanism of SalB alleviating kidney diseases may be closely linked to the regulation of autophagy. However, SalB has not been reported to protect mesangial cells by mediating miR-145-5p-autophagy in MN. Hence, the present paper aimed to explore the therapeutic effects and underlying mechanism of SalB on mesangial cells proliferation and inflammatory response caused by MN. We hypothesized that SalB ameliorated mesangial hyperplasia and inflammation in MN by regulating autophagy of mesangial cells via miR-145-5p. We look forward to clarifying the therapeutic effect of SalB on MN and the role of miR-145-5p in regulating autophagy in MN through this study, so as to provide reference for the pathogenesis and potential therapeutic agents of MN.

Materials and methods

Reagents

SalB was purchased form Herbpurify (purity > 99%; CAS No. 121521–90-2, Cat No. 115939–25-8, Lot No. 190322 R). The primary antibodies against microtubule-associated protein light chain 3 (LC3, ab192890) were obtained from Abcam. The primary antibodies against phosphatidylinositol 3-kinase (PI3K, 4257s), AKT (9272s), phosphorylated-AKT (P-AKT Ser473, 9271s), beclin1 (3758s), anti-mouse IgG (7076s), and anti-rabbit IgG (7074s), horseradish peroxidase-linked Antibody were purchased from Cell Signaling Technology. The antibody against glyceraldehyde-3-phosphate dehydrogenase (GAPDH, sc-32233) was from Santa Cruz Biotechnology. miR-145-5p antagomir, inhibitor, mimic and miR negative control were purchased from RiboBio.

Animal study

Forty male Sprague-Dawley rats weighing 180~220 g (No. SCXK 2018–0002) were obtained from Guangdong Medical Laboratory Animal Center (No. 44005800008589). The animal experiment design and implementation plan have been reviewed and approved by the Animal Ethics Committee of Guangzhou University of Chinese Medicine (No. ZYD-2019-078). All rats were housed in Specific Pathogen Free conditions (No. 2018–0085). After one week of adaptive feeding, established the MN model based on previous study [22]. Briefly, cationic bovine serum albumin (cBSA) dry powder was dissolved in saline and mixed 1:1 with incomplete Freund’s adjuvant to form a 1 mg/ml emulsion. Rats in the model group were pre-immunized by subcutaneous injection of 1 mL of the emulsion, while rats in the control group were injected the same volume of saline. One week later, each rat was injected with a dose of 0.5 mg cBSA (in saline) via tail vein, once every other day for 3 weeks. Urine collection was performed weekly in small animal metabolic cages. According to 24-hours urine protein level, nine rats with a similar degree of modeling were randomized into MN group (n = 3), SalB group and miR-145-5p antagomir group (n = 3). Then, SalB (100 mg/kg, in saline) was orally administered to rats daily for 2 weeks while miR-145-5p antagomir was injected into the tail vein of rats (140 nmol, in saline, n = 3) every other day for 2 weeks. As our previous study found that 100 mg/kg SalB showed outstanding renal protection, the dose was preferred for further study [19].

Detection of renal function index

Urine protein was examined weekly with Super-Bradford Protein Assay kit (purchased from CWBIO) until the rats were harvested. Briefly, rats were placed individually in metabolic cages for urine collection, with free access to water during the period. Urine was collected after 24 hours and centrifuged at 3000 × g for 10 minutes, and the supernatant was taken for detection. The level of serum creatinine (SCr) and blood urea nitrogen (BUN) were tested according to the instructions of the kit (purchased from Jiancheng Bioengineering Institute). Briefly, rats were bled through the abdominal aorta. After 3 hours of coagulation at room temperature, centrifuge at 3000 × g for 10 minutes, and take the upper serum for detection.

Periodic acid Schiff (PAS) staining of kidney tissue

After sacrifice, the kidney tissue was fixed overnight with 4% paraformaldehyde, dehydrated and embedded in paraffin, cut into 4 μm thick sections longitudinally and stained with PAS. Finally, changes of kidney tissue were observed under a magnification optical microscope (OLYMPUS BX53).

Immunofluorescence

Immunofluorescence experiment was performed according to our previous study [23]. Five μm sections were prepared from the renal cortex using a cryostat. After tissue fixation, permeabilization and blocking, incubate overnight at 4°C with mouse anti-IgG (1:200) and rabbit anti-CD68 (1:50). The next day, the sections were incubated with goat anti-mouse IgG (1:100) or anti-rabbit IgG (1:100) conjugated with Alexa Fluor 488 at room temperature. Then, the sections were counterstained with 4’,6-diamidino-2-phenylindole (5 μg/mL) and mounted with anti-fluorescence quencher. Finally, observe the sections under a confocal microscope (LSM 800; Zeiss).

Quantitative real-time PCR (qRT-PCR) analysis

The extraction of total RNA from renal cortex and the detection process of qRT-PCR were as described previously [24]. Briefly, kidney tissue was lysed by Trizol and centrifuged at 14000 × g for 15 minutes and extracted with chloroform followed by isopropanol. Finally, wash the pellet three times with 75% ethanol. The precipitate was dissolved in double distilled water and quantified on a Nanodrop. Reverse transcription to complementary DNA and adding SYBR dye and primers for qRT-PCR detection. All data are normalized in a semi-quantitative way. All primers are entrusted to RiboBio company for design, synthesis, and verification. The primer sequence is shown in Table 1. Due to trade secrets, RiboBio company did not provide the sequence of miR-145-5p or U6.
Table 1.

Real-time qPCR primers for genes.

GenesForward primers (5’to 3’)Reverse primers (5’to 3’)
IL-1βGCTAGTGTGTGATGTTCCCATTAGCTTTTCCATCTTCTTCTTTGGGTA
IL-2CTAGAAGAAGAACTCAAACCTCTGGATTGCTGATTAAGTCCCTGGG
IL-6TGCCAGCCTGCTGACGAAAGCTGCGCAGAATGAGATGA
TNF-αTCCTCTCACATACTGACCCACGGGAGAAGAGGCTGAGGAACAAG
GAPDHCACCATCTTCCAGGAGCGAGAGACGCCAGTAGACTCCACGAC
Real-time qPCR primers for genes.

Transmission electron microscopy

Transmission electron microscopy was performed according to our previous protocol [25]. Briefly, the renal cortex was fixed with 1% OsO4 and dehydrated by gradient ethanol. Then, it was infiltrated with propylene oxide and embedded in a mixture of pure Araldite 502 resin and acetone, and cut into 50–60 nm sections. Finally, the sections were observed under a transmission electron microscope (HITACHI HT7700).

Western blotting analysis

The total protein extraction and Western Blotting analysis process of renal cortex and cells was as described previously [25]. The concentration of the primary antibody dilution was as follows: beclin1 (1:1000), LC3B (1:2000), PI3K (1:1000), AKT (1:1000), P-AKT (1:1000), and GAPDH (1:1000) overnight at 4°C, and incubate at room temperature with goat anti-mouse IgG (1:5000) or goat anti-rabbit IgG (1:2000) conjugated with Horseradish Peroxidase the next day. All data was statistically analyzed by the ImageJ 1.52a software and semi-quantitatively.

Cell proliferation assay

HMCs were purchased from Xiangya Hospital Central South University. After the cells were seeded in a 96-well plate, the cell cycle was synchronized with a serum-free medium. Intervention with lipopolysaccharide (LPS), SalB and miR-145-5p inhibitor was carried out according to different groups, and placed in an incubator for 24 h, and then treated with 10 mg/ml Cell Counting Kit-8 (CCK8, KeyGEN BioTECH) at 37°C for 4 h. Measure the optical density at 450 nm using a microplate reader (Thermo Fisher Scientific, Multiskan GO 1510).

Cell cycle analysis

The cell cycle operation process and sample preparation were as described previously [15]. Briefly, HMCs were seeded in 6-well plates in a 37°C, 5% CO2 incubator for 24 h. Changed the serum-free medium and continued culturing in the incubator for 24 hours. Interventions for each group were performed for 24 hours. After trypsinization without ethylene diamine tetra acetic acid, fixed overnight in 70% ethanol at 4°C. Propidium iodide and RNase A were added after washing with phosphate buffer solution the next day. Finally, propidium iodide was detected by flow cytometry after 30 minutes in the dark at 37°C. It should be noted that this study used the Agilent NovoCyte Quanteon™ to determine the cell DNA content and performed statistical analysis of the cell cycle on the NoveCyte NovoExpress 1.4.1 software.

Autophagy adenoviral infection

The protocol of autophagy adenoviral infection was as described previously [25]. The mRFP-GFP-LC3 adenovirus vector was purchased from Han Biotechnology. Different fluorescence exhibited at different pH after the vector was transfected into HMCs (Figure 1(b)). GFP fluorescence indicates that autophagy has not occurred in the early stage or temporarily, while mRFP fluorescence indicates that autophagy has advanced to the autolysosome stage. Meaning autophagy is progressing, both mRFP and GFP fluorescence will appear, which will be merged as yellow puncta. Therefore, the autophagy flux of HMCs can be examined by counting the yellow and red puncta in cells. Adenoviral infection was conducted as the instructions. When the confluence rate of HMCs reaches 60%, the vector was given in the RPMI 1640 for 4 h, and then the adenovirus-containing medium was removed before LPS, SalB, and miR-145-5p inhibitor were given according to different groups. After 24 hours, LC3 puncta was observed and count in each cell under a confocal laser microscope (LSM800, Zeiss).
Figure 1.

SalB protected against MN in rats and exacerbated by miR-145-5p antagomir. (a) The condensed structural formulas of SalB. (b) Relative miR-145-5p levels in the kidneys from different groups of rats. (c) 24 h urine protein levels for 1 to 6 weeks in different groups of rats. (d-e) SCr and BUN concentration in different groups of rats. (f) Quantitative representation of the total number of IgG-positive nuclei per HPF. (g) Representative micrographs showing the morphology by PAS staining (40×) from different groups of rats. (h) Representative sections of the kidneys stained for IgG (40×) from different groups of rats. *P < 0.05, **P < 0.01, ***P < 0.001 versus the MN group; ###P < 0.001 versus the Control group.

Statistical analysis

All data were exhibited as mean ± standard deviation. The statistical test was performed by the Mac version of SPSS 24.0 software. The comparison between groups was performed by the t-test, followed by the Duncan multi-range test. P value < 0.05 was considered statistically significant.

Results

Autophagy was an important physiological process involved in protective effect of SalB in MN, while miR-145-5p was one of the key miR to mediate autophagy. In the present study, the effects of SalB, miR-145-5p antagomir, inhibitor, mimic, and LY294002 on autophagy and inflammation in vitro and in vivo were investigated by establishing cBSA-induced MN and LPS-induced mesangial cells proliferation and inflammation models. These results were aimed to clarify the therapeutic effect of SalB on MN and the underlying molecular mechanisms.

SalB protected against MN in rats and exacerbated by miR-145-5p antagomir

MN rats were induced by intravenous injection of cBSA. Compared with the control group, rats in the MN group showed macroalbuminuria after 4 weeks of cBSA induction, indicating that the MN model was successfully established. (Figure 1(c)). Meanwhile, SCr as well as BUN increased in MN rats, suggesting that renal dysfunction and the glomerulus filtration barrier were damaged (Figure 1(d,e)). Factoring the pathological condition, PAS staining sections showed mesangial matrix expansion and mesangial cell proliferation in the MN group (Figure 1(g)), while IgG deposition in the glomeruli was detected by immunofluorescence (Figure 1(f, h)). SalB protected against MN in rats and exacerbated by miR-145-5p antagomir. (a) The condensed structural formulas of SalB. (b) Relative miR-145-5p levels in the kidneys from different groups of rats. (c) 24 h urine protein levels for 1 to 6 weeks in different groups of rats. (d-e) SCr and BUN concentration in different groups of rats. (f) Quantitative representation of the total number of IgG-positive nuclei per HPF. (g) Representative micrographs showing the morphology by PAS staining (40×) from different groups of rats. (h) Representative sections of the kidneys stained for IgG (40×) from different groups of rats. *P < 0.05, **P < 0.01, ***P < 0.001 versus the MN group; ###P < 0.001 versus the Control group. SalB condensed structural formula was exhibited as Figure 1(a). After treating with SalB, pathological damages were markedly alleviated, manifested by the normalization of renal function and the improvement of pathology (Figure 1(c-h)). Furthermore, miR-145-5p level in the kidney was examined by qRT-PCR. Intriguingly, miR-145-5p remarkably increased after treatment with SalB (Figure 1(b)), suggesting that it may provide a protective effect on MN rather than aggravate pathological damages. Based on this, we evaluated the effect of miR-145-5p on MN rats through miR-145-5p antagomir intervention. The results showed that after antagonizing miR-145-5p, 24 h urinary protein, SCr, and BUN increased accompanied by more mesangial hyperplasia and immune deposition. (Figure 1(b-h)). By the way, since the mechanism of antagomir is to functionally antagonize miR, the expression of miR-145-5p will not be affected (Figure 1(b)).

SalB reduced inflammatory responses in MN rats and elevated by miR-145-5p antagomir

MN is a primary glomerular disease accompanied by immune-mediated inflammation [26]. Thus, proinflammatory mediators and macrophage infiltration in the kidney were examined. The results showed that SalB reduced inflammatory responses by decreasing the level of proinflammatory mediators, such as IL-1β, IL-2, IL-6 as well as TNF-α (Figure 2(a-d)). It also reduced macrophage infiltration in the kidney as we detected CD68, a marker of macrophages, by immunofluorescence (Figure 2(e,f)). Conversely, both proinflammatory mediators and macrophages were recruited after miR-145-5p antagomir treatment (Figure 2(a-f)).
Figure 2.

SalB reduced renal inflammatory responses in MN rats and elevated by miR-145-5p antagomir. (a-d) The mRNA levels of proinflammatory mediators including IL-1β, IL-2, IL-6 and TNF-α in the kidneys from different groups of rats. (e) Representative sections of the kidneys were stained for macrophages (40×) from different groups of rats. (f) Data analysis of macrophage infiltrates in the kidneys (numbers per high-power field [HPF]) from different groups of rats. *P < 0.05, **P < 0.01, ***P < 0.001 versus the MN group.

SalB reduced renal inflammatory responses in MN rats and elevated by miR-145-5p antagomir. (a-d) The mRNA levels of proinflammatory mediators including IL-1β, IL-2, IL-6 and TNF-α in the kidneys from different groups of rats. (e) Representative sections of the kidneys were stained for macrophages (40×) from different groups of rats. (f) Data analysis of macrophage infiltrates in the kidneys (numbers per high-power field [HPF]) from different groups of rats. *P < 0.05, **P < 0.01, ***P < 0.001 versus the MN group.

SalB abated mesangial cells proliferation and inflammatory responses through miR-145-5p

Next, mesangial cells proliferation were be examined by CCK8 assay. It can be observed that SalB inhibited mesangial cells proliferation and was abrogated by miR-145-5p inhibitor (Figure 3(c)). Further propidium iodide flow analysis of mesangial cells cycle showed that SalB inhibited cell proliferation by blocking S-phase cells through miR-145-5p (Figure 3(a,b)). Besides, the inhibitory effect of proinflammatory mediators by SalB was also abrogated by miR-145-5p (Figure 3(d-g)). These results suggested that SalB abated mesangial cells proliferation and inflammation via miR-145-5p.
Figure 3.

SalB contributed to LPS-induced cell proliferation and production of proinflammatory mediators via miR-145-5p in HMCs. (a and b) Summarized data showing the overall percentage of cell cycle, including the number of cells in S-phase determined by flow cytometric analysis in HMCs with different treatments. (c) Proliferation rate of HMCs with different treatments were detected by Cell Counting Kit-8 (CCK8). (d-g) The mRNA levels of proinflammatory mediators including IL-1β, IL-2, IL-6 and TNF-α in HMCs with different treatments. Ctr, control; L, LPS; S, SalB; I, miR-145-5p inhibitor; NC, miR-145-5p negative control. *P < 0.05, **P < 0.01, ***P < 0.001 versus the L+ NC group; #P < 0.05, ##P < 0.01, ###P < 0.001 versus the L + S+ NC group (n = 6).

SalB contributed to LPS-induced cell proliferation and production of proinflammatory mediators via miR-145-5p in HMCs. (a and b) Summarized data showing the overall percentage of cell cycle, including the number of cells in S-phase determined by flow cytometric analysis in HMCs with different treatments. (c) Proliferation rate of HMCs with different treatments were detected by Cell Counting Kit-8 (CCK8). (d-g) The mRNA levels of proinflammatory mediators including IL-1β, IL-2, IL-6 and TNF-α in HMCs with different treatments. Ctr, control; L, LPS; S, SalB; I, miR-145-5p inhibitor; NC, miR-145-5p negative control. *P < 0.05, **P < 0.01, ***P < 0.001 versus the L+ NC group; #P < 0.05, ##P < 0.01, ###P < 0.001 versus the L + S+ NC group (n = 6).

SalB and miR-145-5p modulated mesangial autophagy in MN rats

A latest study indicates that autophagy-lysosomal pathway coordinates cell cycle and cell growth [27]. Here, beclin1 and LC3B protein were detected to reveal autophagy level in the kidney. After treating with SalB in MN rats, autophagy was upregulated while downregulated in MN rats treated with miR-145-5p antagomir (Figure 4(d, g, h)).
Figure 4.

SalB activated glomerular mesangium autophagy via miR-145-5p. (a) Representative sections of glomerular mesangium for autophagosomes (15000×) by TEM from different groups of rats. The red arrows indicated autophagosomes and autolysosomes. (b) Schematic diagram of mRFP-GFP-LC3 adenoviral vectors detecting autophagic flux. (c) Quantitative representation of the total number of autolysosomes (red puncta) and autophagosomes (yellow puncta) per HMC (n = 6). (D, G and H) Summarized data showing the expression levels of beclin1 and LC3B in the kidneys from different groups of rats (n = 6). (f) Representative sections of HMCs for autophagic flux (400×) with different treatments (n = 6). (e, i, and j) Summarized data showing the expression levels of beclin1 and LC3B in HMCs with different treatments (n = 6). Ctr, control; L, LPS; S, SalB; I, miR-145-5p inhibitor; NC, miR-145-5p negative control. *P < 0.05, **P < 0.01, ***P < 0.001 versus MN group in rats or L+ NC group in HMCs; ##P < 0.01 versus L + S+ NC group; aaaP < 0.001 versus autolysosomes in L+ NC group; bbbP < 0.001 versus autophagosomes in L+ NC group; cccP < 0.001 versus autolysosomes in the L + S+ NC group; dddP < 0.001 versus autophagosomes in the L + S+ NC group.

To further evaluate the autophagic activities in the kidney, electron microscope was used to observe the autophagosomes and autolysosomes (Figure 4(a)). The autophagic activity in glomerular mesangium was more active in the kidneys of control rats, and the structure of autophagosomes at various stages could be clearly distinguished. Autophagosomes reduced in MN rats, indicating a reduction in autophagic activity. The autophagic activity was enhanced in MN rats treated with SalB, while conspicuous empty vesicles appeared in glomerular mesangium with few autophagosomes after treating with miR-145-5p antagomir.

SalB elevated autophagy in HMCs via miR-145-5p

We next examined autophagy in HMCs to further understand the effect of SalB on autophagy in the kidney. The results revealed that autophagy proteins, beclin1 and LC3B, were decreased in LPS-induced HMCs, while SalB increased autophagy. The results of autophagy proteins, beclin1 and LC3B, were downregulated in the LPS-induced HMCs and SalB increased autophagy (Figure 4(e, i, j)). After inhibiting miR-145-5p, the inhibitory role of SalB on autophagy was eliminated, suggesting that SalB regulated autophagy through miR-145-5p. Furthermore, autophagic flux was explored by transfection with autophagy double-labeled adenovirus in HMCs (Figure 5(c,f)). The results showed that SalB promoted the later development of autophagy in HMCs, while miR-145-5p inhibitors can eliminate this effect. Taken together, our results suggested that SalB elevated the development of mesangial cells autophagy via miR-145-5p.
Figure 5.

SalB activated autophagy by inhibiting PI3K/AKT pathway via miR-145-5p. (a-c) Summarized data showing the expression levels of PI3K and P-AKT (Ser473) in the kidneys from different groups of rats. (d-i) Summarized data showing the expression levels of PI3K and P-AKT (Ser473) in HMCs with different treatments (n = 6). (j-k) Relative miR-145-5p levels in HMCs with different treatments (n = 6). Ctr, control; L, LPS; S, SalB; I, miR-145-5p inhibitor; M, miR-145-5p mimic; LY, LY294002; NC, miR-145-5p negative control. *P < 0.05, **P < 0.01, ***P < 0.001 versus the MN group in rats or the L+ NC group in HMCs; ###P < 0.001 versus the L + S+ NC group or the L+ LY+NC group.

SalB activated glomerular mesangium autophagy via miR-145-5p. (a) Representative sections of glomerular mesangium for autophagosomes (15000×) by TEM from different groups of rats. The red arrows indicated autophagosomes and autolysosomes. (b) Schematic diagram of mRFP-GFP-LC3 adenoviral vectors detecting autophagic flux. (c) Quantitative representation of the total number of autolysosomes (red puncta) and autophagosomes (yellow puncta) per HMC (n = 6). (D, G and H) Summarized data showing the expression levels of beclin1 and LC3B in the kidneys from different groups of rats (n = 6). (f) Representative sections of HMCs for autophagic flux (400×) with different treatments (n = 6). (e, i, and j) Summarized data showing the expression levels of beclin1 and LC3B in HMCs with different treatments (n = 6). Ctr, control; L, LPS; S, SalB; I, miR-145-5p inhibitor; NC, miR-145-5p negative control. *P < 0.05, **P < 0.01, ***P < 0.001 versus MN group in rats or L+ NC group in HMCs; ##P < 0.01 versus L + S+ NC group; aaaP < 0.001 versus autolysosomes in L+ NC group; bbbP < 0.001 versus autophagosomes in L+ NC group; cccP < 0.001 versus autolysosomes in the L + S+ NC group; dddP < 0.001 versus autophagosomes in the L + S+ NC group. SalB activated autophagy by inhibiting PI3K/AKT pathway via miR-145-5p. (a-c) Summarized data showing the expression levels of PI3K and P-AKT (Ser473) in the kidneys from different groups of rats. (d-i) Summarized data showing the expression levels of PI3K and P-AKT (Ser473) in HMCs with different treatments (n = 6). (j-k) Relative miR-145-5p levels in HMCs with different treatments (n = 6). Ctr, control; L, LPS; S, SalB; I, miR-145-5p inhibitor; M, miR-145-5p mimic; LY, LY294002; NC, miR-145-5p negative control. *P < 0.05, **P < 0.01, ***P < 0.001 versus the MN group in rats or the L+ NC group in HMCs; ###P < 0.001 versus the L + S+ NC group or the L+ LY+NC group.

SalB activated autophagy by inhibiting PI3K/AKT pathway via miR-145-5p

A central checkpoint that negatively regulates autophagy is mTOR, which is inhibited by the PI3K/AKT signaling pathway [28]. Here, we examined PI3K and P-AKT (Ser473) proteins in different groups of rats. The results showed that both PI3K and P-AKT upregulated in the MN group and downregulated after SalB treatment (Figure 5(a-c)). Besides, PI3K/AKT pathway downregulated after miR-145-5p antagomir treatment, which indicated that miR-145-5p may regulate this pathway (Figure 5(a-c)). We further examined the signaling in LPS-induced HMCs treatment with SalB and miR-145-5p inhibitor to explore the relationship among SalB and PI3K/AKT pathway. The results revealed that SalB blocked the LPS-induced upregulation of PI3K/AKT pathway and this effect was abolished after inhibiting miR-145-5p (Figure 5(d-f)). Furthermore, miR-145-5p mimics reduced pathway protein levels compared to LPS-induced HMCs. Taken together, our results indicated that SalB inhibited PI3K/AKT signaling pathway via miR-145-5p.

Promoting mesangial cell autophagy inhibited cell proliferation and inflammation

Autophagy is associated with cell proliferation and apoptosis from previous literatures. Thus, LY294002, a PI3K/AKT inhibitor, was used as an autophagy activator to explore the relationship between cell proliferation and autophagy. As shown in Figure 5(g-i), the PI3K/AKT signaling pathway was inhibited after treatment with LY294002. Autophagy marker proteins (Figure 6(a-c)) and autophagic flux (Figure 6(e, h)) remarkedly increased after treating with LY294002 or miR-145-5p mimics. Meanwhile, CCK8 and flow cytometric analysis exhibited that LY294002 and miR-145-5p mimics suppressed the HMCs proliferation (Figure 6(d, f, g)). Interestingly, the expression of proinflammatory factors also decreased after the treatment detected by qRT-PCR (Figure 6(i-l)). Taken together, our results indicated that activating autophagy inhibited mesangial cells proliferation and inflammation through PI3K/AKT signaling.
Figure 6.

Promoting mesangial cells autophagy inhibited cell proliferation and inflammation. (a-c) Summarized data showing the expression levels of beclin1 and LC3B in HMCs with different treatments. (d and f) Summarized data showing the overall percentage of cell cycle, including the number of cells in S-phase determined by flow cytometric analysis in HMCs with different treatments. (g) Proliferation rate of HMCs with different treatments were detected by Cell Counting Kit-8 (CCK8). (e) Representative sections of HMCs for autophagic flux (400×) with different treatments. (h) Quantitative representation of the total number of autolysosomes (red puncta) and autophagosomes (yellow puncta) per HMC. (i-l) The mRNA levels of proinflammatory mediators including IL-1β, IL-2, IL-6 and TNF-α in HMCs with different treatments. Ctr, control; L, LPS; S, SalB; M, miR-145-5p mimic; LY, LY294002; NC, miR-145-5p negative control. *P < 0.05, **P < 0.01, ***P < 0.001 versus the L+ NC group; aaaP < 0.001 versus autolysosomes in the L+ NC group; bbbP < 0.001 versus autophagosomes in the L+ NC group (n = 6).

Promoting mesangial cells autophagy inhibited cell proliferation and inflammation. (a-c) Summarized data showing the expression levels of beclin1 and LC3B in HMCs with different treatments. (d and f) Summarized data showing the overall percentage of cell cycle, including the number of cells in S-phase determined by flow cytometric analysis in HMCs with different treatments. (g) Proliferation rate of HMCs with different treatments were detected by Cell Counting Kit-8 (CCK8). (e) Representative sections of HMCs for autophagic flux (400×) with different treatments. (h) Quantitative representation of the total number of autolysosomes (red puncta) and autophagosomes (yellow puncta) per HMC. (i-l) The mRNA levels of proinflammatory mediators including IL-1β, IL-2, IL-6 and TNF-α in HMCs with different treatments. Ctr, control; L, LPS; S, SalB; M, miR-145-5p mimic; LY, LY294002; NC, miR-145-5p negative control. *P < 0.05, **P < 0.01, ***P < 0.001 versus the L+ NC group; aaaP < 0.001 versus autolysosomes in the L+ NC group; bbbP < 0.001 versus autophagosomes in the L+ NC group (n = 6).

Discussion

Recently, reports on Rituximab or Cyclosporine in the treatment of MN have triggered new discussions and doubts, suggesting that the current clinical drugs for MN are unsatisfactory [29,30]. Exploring new agents for the treatment of MN is still the focus of attentions in clinical. In this study, SalB, an important active ingredient of Salvia miltiorrhiza Bunge, was first found to have a significant effect on MN. Our data confirmed that SalB had protection for renal function, decreased immune deposition, inhibited the mesangial cells proliferation and inflammatory responses in MN model induced by cBSA. In recent years, researches on MN have mainly focused on the damage of podocytes. For example, the phospholipase A2 receptor on podocytes was found to be the main antigen of idiopathic MN [31]. However, abnormal proliferation of mesangial cell is also a striking clinical characteristic in MN, which is closely related to cell autophagy [27,32]. In this study, we found that basal autophagy active in mesangial cells and significantly inhibited in the kidneys of MN rats. Meanwhile, the abnormal proliferation of mesangial cells and the release of proinflammatory factors were reduced while the autophagy was increasing, which potentially suggested the autophagy activity in mesangial cells were involved in the progress of MN. After SalB intervention, mesangial autophagy was upregulated in vivo, accompanied by increasing miR-145-5p in the kidney. Therefore, miR-145-5p were antagonized, and then the autophagy activity of the kidney was blocked, especially in mesangium. Our data suggested that SalB regulated autophagy through miR-145-5p and was involved in the inflammatory process of MN in mesangial cells. There were many reports on autophagy in kidney disease, but mainly focused on podocytes, renal tubules, and endothelial cells [33,34]. Our study showed that the autophagy of mesangial cells was also closely related to its pathological progression, which filled the gap in the study of mesangial autophagy in kidney disease. MiR have emerged as critical regulators in kidney disease, involved in every stage of autophagy [35]. In in vitro experiment, SalB also induced the upregulation of miR-145-5p in mesangial cells. What’s more, PI3K/AKT is one of the important pathways for regulating autophagy and widely participates in various physiological activities [36]. In our study, we confirmed that SalB enhanced autophagy through PI3K/AKT signaling pathway by using LY294002. LY294002, as an autophagy inhibitor, inhibits the phosphorylation of AKT through broad-spectrum suppression of PI3K, and final achieves autophagy inhibition [35]. Some literatures have reported that autophagy retardation could aggravate glomerular diseases, suggesting that increased autophagy may attenuate MN [37,38]. Here, we found that LY294002 could reverse the reduction of mesangial cells proliferation and inflammation after SalB intervention. These results showed that intervening autophagy in mesangial proliferative glomerular disease regulated cell proliferation and inflammation. Besides, miR-145-5p significantly suppressed the PI3K/AKT pathway and increased autophagy in vivo and in vitro. Studies have shown that miR-145-5p can modulate oxidative stress, mitophagy as well as apoptosis in the kidney [39,40]. These miR-145-5p studies were mainly in acute kidney damage, and the effect of miR-145-5p in chronic kidney disease was still unclear. This is the first the role of miR-145-5p-autophagy in kidney disease has been discovered. Although our study revealed the effect of SalB on renal autophagy and the mechanism of miR-145-5p on autophagy, there were still some limitations from our study. Firstly, the number of rats in each group were relatively small, and more animals needed to be supplemented to increase the stability of the results. Secondly, the effect of SalB on miR-145-5p had only been demonstrated in vitro, and whether miR-145-5p antagomir can reverse the therapeutic effect of SalB in vivo required further studies. Thirdly, the target genes of miR-145-5p for autophagy remained unclear, which needed to be further explored through omics analysis.

Conclusion

In conclusion, SalB upregulated mesangial cell autophagy to reduce cell proliferation and inflammation of MN, which was regulated by miR-145-5p to inhibit PI3K/AKT signaling pathway. Our data illustrated the therapeutic effect and potential mechanism of SalB in MN. Elucidating the key regulatory effects of miRNA-autophagy regulation mechanism can provide signpost for new pharmaceutical references and potential therapeutic targets for the clinical treatment of MN.
  38 in total

1.  MMP9 inhibition increases autophagic flux in chronic heart failure.

Authors:  Shyam S Nandi; Kenichi Katsurada; Neeru M Sharma; Daniel R Anderson; Sushil K Mahata; Kaushik P Patel
Journal:  Am J Physiol Heart Circ Physiol       Date:  2020-10-16       Impact factor: 4.733

Review 2.  Immunosuppressive effect of artemisinin and hydroxychloroquine combination therapy on IgA nephropathy via regulating the differentiation of CD4+ T cell subsets in rats.

Authors:  Lixia Bai; Honglian Li; Jicheng Li; Jianping Song; Yuan Zhou; Bihao Liu; Ruirui Lu; Peichun Zhang; Junqi Chen; Dandan Chen; Yu Pang; Xusheng Liu; Junbiao Wu; Chunling Liang; Jiuyao Zhou
Journal:  Int Immunopharmacol       Date:  2019-03-07       Impact factor: 4.932

3.  Rituximab or Cyclosporine for Membranous Nephropathy.

Authors:  Claudio Ponticelli; Gabriella Moroni
Journal:  N Engl J Med       Date:  2019-10-24       Impact factor: 91.245

4.  A reciprocal regulation of spermidine and autophagy in podocytes maintains the filtration barrier.

Authors:  Wei Liang; Kosuke Yamahara; Camila Hernando-Erhard; Simon Lagies; Nicola Wanner; Huan Liang; Christoph Schell; Bernd Kammerer; Tobias B Huber; Tillmann Bork
Journal:  Kidney Int       Date:  2020-06-27       Impact factor: 10.612

5.  Dioscin ameliorates methotrexate-induced liver and kidney damages via adjusting miRNA-145-5p-mediated oxidative stress.

Authors:  Y Li; M Gao; L-H Yin; L-N Xu; Y Qi; Pengyuan Sun; J-Y Peng
Journal:  Free Radic Biol Med       Date:  2021-04-07       Impact factor: 7.376

6.  Zhen-wu-tang ameliorates membranous nephropathy rats through inhibiting NF-κB pathway and NLRP3 inflammasome.

Authors:  Bihao Liu; Ruirui Lu; Honglian Li; Yuan Zhou; Peichun Zhang; Lixia Bai; Dandan Chen; Junqi Chen; Jicheng Li; Pang Yu; Junbiao Wu; Chunling Liang; Jianping Song; Xusheng Liu; Jiuyao Zhou
Journal:  Phytomedicine       Date:  2019-04-02       Impact factor: 5.340

Review 7.  Autophagy Assays for Biological Discovery and Therapeutic Development.

Authors:  Noboru Mizushima; Leon O Murphy
Journal:  Trends Biochem Sci       Date:  2020-08-21       Impact factor: 13.807

8.  circPARD3 drives malignant progression and chemoresistance of laryngeal squamous cell carcinoma by inhibiting autophagy through the PRKCI-Akt-mTOR pathway.

Authors:  Wei Gao; Huina Guo; Min Niu; Xiwang Zheng; Yuliang Zhang; Xuting Xue; Yunfeng Bo; Xiaoya Guan; Zhongxun Li; Yujia Guo; Long He; Yu Zhang; Li Li; Jimin Cao; Yongyan Wu
Journal:  Mol Cancer       Date:  2020-11-24       Impact factor: 27.401

9.  Dihydroartemisinin Inhibits TGF-β-Induced Fibrosis in Human Tenon Fibroblasts via Inducing Autophagy.

Authors:  Xiaoyuan Wang; Wuqi Song; Fengmin Zhang; Renping Huang
Journal:  Drug Des Devel Ther       Date:  2021-03-03       Impact factor: 4.162

10.  Associations between m-type phospholipase A2 receptor,human leukocyte antigen gene polymorphisms and idiopathic membranous nephropathy.

Authors:  Xiaogang Liu; Weixi Xu; Chengyuan Yu; Mingao Wang; Ruichan Liu; Rujuan Xie
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.