| Literature DB >> 35721560 |
Shenping Cao1, Yangbo Xiao1, Rong Huang1, Dafang Zhao1, Wenqian Xu1, Shitao Li1, Jianzhou Tang1, Fufa Qu1, Junyan Jin2, Shouqi Xie2, Zhen Liu1.
Abstract
An eight-week experiment was undertaken to examine the effect of dietary hydroxyproline (Hyp) supplementation on growth performance, collagen synthesis, muscle quality of an improved triploid crucian carp (Carassius auratus Triploid) (ITCC). Six isonitrogenous (340 g/kg diet), isolipidic (60 g/kg diet) and isocaloric (17.80 MJ/kg diet) diets were formulated containing a certain amount of Hyp: 0.09% (the control group), 0.39, 0.76, 1.14, 1.53 and 1.90%. Each diet was randomly assigned to three tanks and each group was fed two times daily until apparent satiation. The results showed that growth performance and feed utilization of ITCC were significantly improved with the dietary Hyp level was increased from 0.09 to 0.76%. Crude protein, threonine and arginine content in the dorsal muscle in 0.76% hydroxyproline group were significantly higher than those in basic diet group (p < 0.05). The muscle textural characteristics increased remarkably with the amount of Hyp in the diet rising from 0.09 to 1.53% (p < 0.05). Meanwhile, the contents of type I collagen (Col I) and Pyridinium crosslink (PYD) in the muscle of fish were significantly increased by dietary Hyp (p < 0.05). The muscle fiber diameter and density of the fish were significantly increased when fed with 0.76% Hyp (p < 0.05). Furthermore, dietary supplementation with an appropriate concentration of Hyp substantially increased the expression of genes involved in collagen synthesis (col1a1, col1a2, p4hα1, p4hβ, smad4, smad5, smad9, and tgf-β) and muscle growth (igf-1, tor, myod, myf5, and myhc) (p < 0.05). In conclusion, dietary supplementation of Hyp can enhance fish growth performance, collagen production, muscle textural characteristics and muscle growth of ITCC. According to the SGR broken-line analysis, the recommended supplementation level of Hyp was 0.74% in the diet for ITCC, corresponding to 2.2% of dietary protein.Entities:
Keywords: Carassius auratus triploid; collagen synthesis; growth performance; hydroxyproline; muscle texture
Year: 2022 PMID: 35721560 PMCID: PMC9198714 DOI: 10.3389/fphys.2022.913800
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Formulation and chemical composition of the experimental diets for ITCC (% dry matter).
| Ingredients | Dietary Hyp Level (%) | |||||
|---|---|---|---|---|---|---|
| 0.09 | 0.39 | 0.76 | 1.14 | 1.53 | 1.90 | |
| L-Hydroxyproline | 0.00 | 0.40 | 0.80 | 1.20 | 1.60 | 2.00 |
| Fish meal | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 |
| Soybean meal | 22.00 | 22.00 | 22.00 | 22.00 | 22.00 | 22.00 |
| Rapeseed meal | 19.00 | 19.00 | 19.00 | 19.00 | 19.00 | 19.00 |
| Cottonseed meal | 16.00 | 16.00 | 16.00 | 16.00 | 16.00 | 16.00 |
| Wheat flour | 13.00 | 13.00 | 13.00 | 13.00 | 13.00 | 13.00 |
| Soybean oil | 3.70 | 3.70 | 3.70 | 3.70 | 3.70 | 3.70 |
| α-starch | 4.00 | 4.00 | 4.00 | 4.00 | 4.00 | 4.00 |
| Corn starch | 8.00 | 8.00 | 8.00 | 8.00 | 8.00 | 8.00 |
| Choline chloride | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 |
| Vitamin premix | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 |
| Mineral premix | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 |
| CMC | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 |
| Ca(H2PO4)2 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 |
| Cellulose | 4.30 | 4.30 | 4.30 | 4.30 | 4.30 | 4.30 |
| Alanine | 2 | 1.60 | 1.20 | 0.80 | 0.40 | 0.00 |
| Hydroxyproline | 0.09 | 0.39 | 0.76 | 1.14 | 1.53 | 1.90 |
| Crude protein | 34.71 | 34.58 | 33.99 | 34.14 | 34.01 | 33.74 |
| Crude lipid | 5.87 | 5.82 | 5.79 | 6.00 | 5.96 | 6.10 |
| Moisture | 8.32 | 8.09 | 8.12 | 8.09 | 7.74 | 7.60 |
| Ash | 8.93 | 8.88 | 8.66 | 8.61 | 8.68 | 8.62 |
| Total phosphorus | 0.90 | 0.97 | 0.96 | 0.91 | 0.87 | 0.94 |
| Total calcium | 0.55 | 0.54 | 0.55 | 0.53 | 0.52 | 0.50 |
| Gross energy (MJ/kg) | 17.87 | 17.94 | 18.04 | 17.72 | 17.75 | 18.14 |
L-Hydroxyproline: Purchased from Sigma-Aldrich Co. Ltd (United States).
All of these ingredients were supplied by Hunan Zhenghong Science and Technology Develop Co., Ltd., China. Fish meal, crude protein: 68.87%, crude lipid: 10.47%; Soybean meal, crude protein: 48.57%, crude lipid: 1.40%; Rapeseed meal, crude protein: 44.37%, crude lipid: 2.63%; Cottonseed meal, crude protein: 54.60%, crude lipid: 2.02%.
Vitamin premix (mg/kg diet): Vitamin B1, 20; Vitamin B2, 20; Vitamin B6, 20; Vitamin B12, 0.02; folic acid, 5; calcium pantothenate, 50; inositol, 100; niacin, 100; biotin, 0.1; Vitamin A, 11; Vitamin D, 2; Vitamin E, 50; Vitamin K, 10; Vitamin C, 100; cellulose, 3,412.
Mineral premix (mg/kg diet): NaCl, 500.0; MgSO4·7H2O, 8,155.6; NaH2PO4·2H2O, 12500.0; KH2PO4, 16000.0; CaHPO4·2H2O, 7,650.6; FeSO4·7H2O, 2286.2; C6H10CaO6·5H2O, 1750.0; ZnSO4·7H2O, 178.0; MnSO4·H2O, 61.4; CuSO4·5H2O, 15.5; CoSO4·7H2O, 0.91; KI, 1.5; Na2SeO3, 0.60; Corn starch, 899.7.
Alanine: Purchased from Sigma-Aldrich Co. Ltd (United States).
Amino acid profile of the experimental diets for 8 weeks (% dry matter).
| Ingredients | Dietary Hyp Level (%) | |||||
|---|---|---|---|---|---|---|
| 0.09 | 0.39 | 0.76 | 1.14 | 1.53 | 1.90 | |
| Essential amino acid | ||||||
| Threonine | 1.01 | 1.00 | 0.98 | 0.98 | 0.98 | 0.96 |
| Phenylalanine | 1.32 | 1.30 | 1.32 | 1.32 | 1.31 | 1.30 |
| Valine | 1.17 | 1.17 | 1.17 | 1.15 | 1.18 | 1.16 |
| Isoleucine | 1.16 | 1.17 | 1.16 | 1.15 | 1.17 | 1.16 |
| Leucine | 1.99 | 2.01 | 1.98 | 1.99 | 1.97 | 1.97 |
| Methionine | 0.29 | 0.29 | 0.30 | 0.28 | 0.29 | 0.28 |
| Arginine | 2.06 | 2.10 | 2.09 | 2.08 | 2.07 | 2.05 |
| Lysine | 1.46 | 1.48 | 1.48 | 1.45 | 1.43 | 1.40 |
| Histidine | 0.71 | 0.71 | 0.71 | 0.73 | 0.70 | 0.70 |
| Tryptophan | ND | ND | ND | ND | ND | ND |
| Non-essential amino acid | ||||||
| Aspartic acid | 2.38 | 2.39 | 2.39 | 2.38 | 2.37 | 2.37 |
| Serine | 1.30 | 1.33 | 1.30 | 1.32 | 1.30 | 1.29 |
| Glutamic acid | 5.23 | 5.24 | 5.26 | 5.22 | 5.22 | 5.20 |
| Glycine | 1.17 | 1.16 | 1.16 | 1.14 | 1.15 | 1.16 |
| Alanine | 2.69 | 2.30 | 1.87 | 1.50 | 1.12 | 0.84 |
| Tyrosine | 0.74 | 0.75 | 0.75 | 0.75 | 0.76 | 0.74 |
| Proline | 1.47 | 1.48 | 1.46 | 1.48 | 1.46 | 1.45 |
ND: not determined.
Sequences of the primers used for qRT-PCR analysis.
| Gene | Acronym | Primer Sequence | Accession No. | Amplicon Size (bp) | Annealing Temp. (°C) |
|---|---|---|---|---|---|
|
|
| F: TGTCACTGAGGATGGTTGCAC | AB275454 | 83 | 60 |
| R: GACGGGATGTTTTCGTTGTTT | |||||
|
|
| F: TGAGGGCTAAGGATTATGAGG | AB275455 | 99 | 60 |
| R: GGGCAGGGTTCTTCTTTGAGC | |||||
|
|
| F: CGTCTTCCCTGGCATCGGAGTTG | XM_026207228 | 93 | 55 |
| R: TTACCCAATAACACAGGGCATCC | |||||
|
|
| F: AGGAGAGAAGGAGAACCCCAA | XM_026213906 | 133 | 60 |
| R: AGCAATAAGAGACTCCGCCTG | |||||
|
|
| F: CCTGGGCTGGAAGTGGATA | EU086521 | 190 | 60 |
| R: GTAAAGGATGGGCAGTGGG | |||||
|
|
| F: TGGCTGGTCGTAAAGGAT | XM_026274091 | 152 | 60 |
| R: CTCGTAATGGTAAGGGTTCA | |||||
|
|
| F: CGAGGTGTGCGAGTATCCGTT | XM_026281121 | 169 | 55 |
| R: ATTGTGACTCAGGTTGCGAAA | |||||
|
|
| F: GCACTCCACTACATCCATCAC | XM_026274041 | 93 | 55 |
| R: TTTTCCTCCTCATCTCCTTGT | |||||
|
|
| F: AGCGTGTCTACAAGCTCCG | KF813006 | 175 | 60 |
| R: GGATGTCTAGCGGTCATTTCT | |||||
|
|
| F: TTGATGGCACGGTGTTTCCTAA | KF772613 | 195 | 60 |
| R: GCCCTGGTTCTGGTGCTTGTAG | |||||
|
|
| F: ACCAGAGGCTGCCCAAAG | KP715154 | 123 | 60 |
| R: AGTCTCCGCTGTAATGTTCC | |||||
|
|
| F: GTTTGAGGCACTACGGCG | KP715152 | 192 | 60 |
| R: CTTTCAGAACAGCTTGAGGAAG | |||||
|
|
| F: GTGCTTGACATTGCTGGGTT | XM_026260328 | 143 | 60 |
| R: ATGCCTTCTTTCTTGTATTCCT | |||||
|
|
| F: TTGAGCAGGAGATGGGAACCG | AB039726.2 | 115 | 60 |
| R: AGAGCCTCAGGGCAACGGAAA |
Growth, feed utilization and survival rate of ITCC fed with the experimental diets containing different levels of Hyp for 8 weeks.
| Items | Dietary Hyp Level (%) | |||||
|---|---|---|---|---|---|---|
| 0.09 | 0.39 | 0.76 | 1.14 | 1.53 | 1.90 | |
| IBW (g) | 14.99 ± 0.04 | 15.01 ± 0.02 | 14.99 ± 0.05 | 15.05 ± 0.02 | 15.03 ± 0.02 | 15.00 ± 0.02 |
| FBW (g) | 41.94 ± 1.07a | 43.95 ± 1.32ab | 46.79 ± 0.62b | 46.58 ± 0.58b | 46.76 ± 0.72b | 46.68 ± 0.69b |
| WGR (%) | 179.76 ± 7.78a | 192.92 ± 9.22ab | 212.10 ± 3.54b | 209.49 ± 4.10b | 211.16 ± 4.88b | 211.12 ± 4.55b |
| SGR (%/d) | 1.84 ± 0.05a | 1.92 ± 0.06ab | 2.03 ± 0.02b | 2.02 ± 0.02b | 2.03 ± 0.03b | 2.03 ± 0.02b |
| FE (%) | 44.60 ± 1.73a | 47.21 ± 2.60a | 52.68 ± 0.86b | 52.43 ± 1.05b | 53.90 ± 1.22b | 52.62 ± 1.04b |
| FR (%) | 3.54 ± 0.06b | 3.43 ± 0.08b | 3.26 ± 0.03a | 3.25 ± 0.04a | 3.18 ± 0.04a | 3.25 ± 0.03a |
| PER (%) | 128.49 ± 4.97a | 141.04 ± 10.45ab | 154.97 ± 2.53bc | 153.57 ± 3.08bc | 158.47 ± 3.59c | 155.99 ± 3.08c |
| NRE (%) | 22.71 ± 0.85a | 23.40 ± 1.99a | 27.05 ± 1.09b | 25.63 ± 0.84ab | 25.67 ± 0.48ab | 25.35 ± 1.18ab |
| TNW (g/kg WG) | 45.57 ± 0.92b | 43.12 ± 2.65b | 38.77 ± 0.71a | 39.66 ± 0.87a | 38.56 ± 0.75a | 39.33 ± 0.97a |
| SR (%) | 100.00 ± 0.00 | 100.00 ± 0.00 | 100.00 ± 0.00 | 100.00 ± 0.00 | 100.00 ± 0.00 | 100.00 ± 0.00 |
Values are Means ± SE (n = 3); a, b, c mean values in the same row with different superscript letters are significantly different (p < 0.05); Absence of letters indicates no significant difference between treatments.
IBW: initial body weight. FBW: final body weight. WGR: weight gain rate. SGR: specific growth rate. FE: feed efficiency. FR: feeding rate. PER: protein efficiency ratio. NRE: nitrogen retention efficiency. TNW: total nitrogen waste output. SR: survival rate.
FIGURE 1Broken-line regression analysis between SGR and dietary Hyp level in ITCC fed with different experimental diets for 8 weeks. The breakpoint of the broken-line is 0.74% of dry diet.
Whole body and dorsal muscle compositions of ITCC fed with different experimental diets for 8 weeks.
| Items | Dietary Hyp Level (%) | |||||
|---|---|---|---|---|---|---|
| 0.09 | 0.39 | 0.76 | 1.14 | 1.53 | 1.90 | |
| Whole body composition (% fresh weight) | ||||||
| Crude protein | 15.72 ± 0.33 | 15.98 ± 0.11 | 16.35 ± 0.71 | 16.59 ± 0.59 | 16.01 ± 0.16 | 15.68 ± 0.06 |
| Crude lipid | 11.04 ± 0.5 | 11.18 ± 2.01 | 12.1 ± 0.55 | 12.17 ± 1.16 | 13.06 ± 0.91 | 13.57 ± 1.34 |
| Ash | 2.85 ± 0.16a | 2.47 ± 0.12b | 2.52 ± 0.07ab | 2.71 ± 0.08ab | 2.63 ± 0.05ab | 2.58 ± 0.08ab |
| Moisture | 69.85 ± 0.24 | 68.15 ± 0.46 | 68.22 ± 0.38 | 68.18 ± 0.79 | 67.94 ± 0.97 | 67.3 ± 1.22 |
| Dorsal muscles composition (% fresh weight) | ||||||
| Crude protein | 17.06 ± 0.12a | 17.69 ± 0.11ab | 18.55 ± 0.73b | 17.79 ± 0.19ab | 17.57 ± 0.28ab | 17.26 ± 0.55ab |
| Crude lipid | 1.32 ± 0.07 | 1.24 ± 0.07 | 1.28 ± 0.06 | 1.30 ± 0.04 | 1.25 ± 0.08 | 1.20 ± 0.04 |
| Ash | 1.44 ± 0.06 | 1.38 ± 0.06 | 1.42 ± 0.04 | 1.38 ± 0.12 | 1.39 ± 0.04 | 1.51 ± 0.01 |
| Moisture | 75.65 ± 0.09 | 76.23 ± 0.42 | 76.00 ± 0.13 | 76.55 ± 0.57 | 75.92 ± 0.96 | 75.69 ± 0.75 |
Values are Means ± SE (n = 3); a, b, c mean values in the same row with different superscript letters are significantly different (p < 0.05); Absence of letters indicates no significant difference between treatments.
Amino acid profile in dorsal muscle of ITCC fed with different experimental diets for 8 weeks (% dry matter).
| Amino Acids | Dietary Hyp Level (%) | |||||
|---|---|---|---|---|---|---|
| 0.09 | 0.39 | 0.76 | 1.14 | 1.53 | 1.90 | |
| Essential amino acid | ||||||
| Threonine | 2.62 ± 0.09a | 2.86 ± 0.15ab | 3.01 ± 0.08b | 2.87 ± 0.03ab | 2.89 ± 0.03ab | 2.65 ± 0.04a |
| Phenylalanine | 2.95 ± 0.11 | 3.16 ± 0.18 | 3.29 ± 0.12 | 3.24 ± 0.03 | 3.23 ± 0.09 | 2.95 ± 0.08 |
| Valine | 2.98 ± 0.11 | 3.13 ± 0.15 | 3.27 ± 0.10 | 3.19 ± 0.01 | 3.24 ± 0.05 | 2.97 ± 0.07 |
| Isoleucine | 3.03 ± 0.10 | 3.21 ± 0.16 | 3.37 ± 0.11 | 3.29 ± 0.02 | 3.31 ± 0.07 | 3.02 ± 0.08 |
| Leucine | 5.36 ± 0.18 | 5.68 ± 0.29 | 5.96 ± 0.18 | 5.80 ± 0.04 | 5.84 ± 0.11 | 5.34 ± 0.20 |
| Methionine | 1.72 ± 0.03 | 1.96 ± 0.11 | 2.05 ± 0.06 | 1.97 ± 0.02 | 1.97 ± 0.03 | 1.56 ± 0.27 |
| Arginine | 3.67 ± 0.13a | 3.94 ± 0.22ab | 4.12 ± 0.12b | 4.05 ± 0.04ab | 4.02 ± 0.09ab | 3.71 ± 0.06ab |
| Lysine | 6.01 ± 0.29 | 7.07 ± 0.43 | 7.19 ± 0.41 | 7.23 ± 0.10 | 6.95 ± 0.37 | 6.17 ± 0.41 |
| Histidine | 3.21 ± 0.14ab | 3.42 ± 0.16ab | 3.51 ± 0.10ab | 3.54 ± 0.08ab | 3.57 ± 0.09b | 3.16 ± 0.05a |
| Tryptophan | ND | ND | ND | ND | ND | ND |
| Non-essential amino acid | ||||||
| Aspartic acid | 6.84 ± 0.25 | 7.23 ± 0.40 | 7.58 ± 0.24 | 7.35 ± 0.07 | 7.40 ± 0.08 | 6.85 ± 0.32 |
| Serine | 2.74 ± 0.09 | 2.86 ± 0.15 | 3.00 ± 0.08 | 2.91 ± 0.02 | 2.95 ± 0.05 | 2.72 ± 0.04 |
| Glutamic acid | 9.74 ± 0.33 | 10.19 ± 0.58 | 10.75 ± 0.33 | 10.41 ± 0.10 | 10.54 ± 0.10 | 9.71 ± 0.48 |
| Glycine | 2.93 ± 0.06 | 2.95 ± 0.14 | 3.07 ± 0.05 | 3.05 ± 0.06 | 3.06 ± 0.03 | 2.93 ± 0.01 |
| Alanine | 3.27 ± 0.10 | 3.45 ± 0.20 | 3.63 ± 0.10 | 3.53 ± 0.04 | 3.53 ± 0.05 | 3.26 ± 0.08 |
| Tyrosine | 2.15 ± 0.08 | 2.27 ± 0.11 | 2.38 ± 0.07 | 2.31 ± 0.01 | 2.33 ± 0.05 | 2.16 ± 0.02 |
| Proline | 2.10 ± 0.05 | 2.09 ± 0.08 | 2.16 ± 0.04 | 2.15 ± 0.03 | 2.18 ± 0.03 | 2.06 ± 0.04 |
ND: not determined.
Values are Means ± SE (n = 3); a, b, c mean values in the same row with different superscript letters are significantly different (p < 0.05); Absence of letters indicates no significant difference between treatments.
Muscle texture of ITCC fed with different experimental diets for 8 weeks.
| Items | Dietary Hyp Level (%) | |||||
|---|---|---|---|---|---|---|
| 0.09 | 0.39 | 0.76 | 1.14 | 1.53 | 1.9 | |
| Hardness (N) | 3.67 ± 0.17a | 4.11 ± 0.24ab | 3.89 ± 0.08ab | 4.12 ± 0.11ab | 4.16 ± 0.08b | 4.30 ± 0.11b |
| Springiness (mm) | 0.51 ± 0.04a | 0.54 ± 0.03ab | 0.63 ± 0.04b | 0.54 ± 0.02ab | 0.64 ± 0.05b | 0.60 ± 0.04ab |
| Chewiness (mJ) | 0.60 ± 0.07a | 0.60 ± 0.08a | 0.68 ± 0.09ab | 0.55 ± 0.06a | 0.93 ± 0.13b | 0.67 ± 0.10ab |
| Adhesiveness (N*mm) | 0.031 ± 0.004 | 0.032 ± 0.005 | 0.037 ± 0.004 | 0.031 ± 0.003 | 0.027 ± 0.003 | 0.031 ± 0.005 |
| Cohesiveness (%) | 0.38 ± 0.03 | 0.37 ± 0.03 | 0.39 ± 0.02 | 0.36 ± 0.02 | 0.43 ± 0.03 | 0.37 ± 0.03 |
| Gumminess (g*mm) | 1.04 ± 0.12a | 1.16 ± 0.14ab | 1.20 ± 0.11ab | 1.10 ± 0.10a | 1.54 ± 0.14b | 1.13 ± 0.16a |
Values are Means ± SE (n = 9); a, b mean values in the same row with different superscript letters are significantly different (p < 0.05); Absence of letters indicates no significant difference between treatments.
The hydroxyproline content in different tissues of ITCC fed with different experimental diets for 8 weeks.
| Tissues | Dietary Hyp Level (%) | |||||
|---|---|---|---|---|---|---|
| 0.09 | 0.39 | 0.76 | 1.14 | 1.53 | 1.90 | |
| Muscle (mg/g) | 0.91 ± 0.10a | 1.37 ± 0.01ab | 1.64 ± 0.19b | 1.41 ± 0.16ab | 1.46 ± 0.17ab | 1.44 ± 0.24ab |
| Skin (mg/g) | 8.77 ± 0.93a | 10.33 ± 0.31ab | 13.15 ± 1.10bc | 11.98 ± 0.94abc | 9.66 ± 0.94ab | 13.99 ± 1.52c |
| Liver (μg/g) | 256.88 ± 5.69a | 553.99 ± 72.59ab | 671.96 ± 103.44b | 567.93 ± 195.71ab | 430.59 ± 46.70ab | 456.84 ± 73.89ab |
| Vertebra (mg/g) | 7.39 ± 0.17a | 7.62 ± 0.49a | 8.45 ± 0.73ab | 9.47 ± 0.89ab | 9.04 ± 1.18ab | 10.5 ± 0.40b |
| Plasma (mg/ml) | 100.00 ± 9.62a | 119.84 ± 7.57ab | 124.60 ± 12.01ab | 141.27 ± 10.68bc | 142.86 ± 4.76bc | 170.63 ± 9.36c |
Values are Means ± SE (n = 6); a, b, c mean values in the same row with different superscript letters are significantly different (p < 0.05); Absence of letters indicates no significant difference between treatments.
The type I collagen (Col I) content, pyridinium crosslink (PYD) content, prolyl 4-hydroxylase (P4H) and lysyl hydroxylase (LH) activity in muscle of ITCC fed with different experimental diets for 8 weeks.
| Items | Dietary Hyp Level (%) | |||||
|---|---|---|---|---|---|---|
| 0.09 | 0.39 | 0.76 | 1.14 | 1.53 | 1.90 | |
| Col I (ng/mg prot) | 4.88 ± 0.02a | 5.53 ± 0.36ab | 5.34 ± 0.45ab | 5.13 ± 0.24ab | 6.02 ± 0.27b | 5.98 ± 0.27b |
| PYD (ng/mg prot) | 25.74 ± 1.06a | 28.76 ± 0.60ab | 26.91 ± 1.62ab | 26.73 ± 1.64ab | 30.37 ± 1.17b | 30.79 ± 1.18b |
| P4H (ng/mg prot) | 0.66 ± 0.03a | 0.74 ± 0.03ab | 0.75 ± 0.04ab | 0.83 ± 0.05b | 0.81 ± 0.07b | 0.84 ± 0.05b |
| LH (ng/mg prot) | 0.136 ± 0.005a | 0.142 ± 0.003ab | 0.157 ± 0.007ab | 0.154 ± 0.005ab | 0.154 ± 0.004ab | 0.161 ± 0.013b |
Values are Means ± SE (n = 6); a, b mean values in the same row with different superscript letters are significantly different (p < 0.05); Absence of letters indicates no significant difference between treatments.
FIGURE 2Microstructure of dorsal muscle of ITCC in cross-section. Bars represent 50 μ; (A–D) represent different dorsal muscle from the 0.09, 0.76, 1.14 and 1.90% of Hyp supplemental groups, respectively.
The muscle fiber diameter (DI) and density (DE) of ITCC fed with different experimental diets for 8 weeks.
| Items | Dietary Hyp Level (%) | |||||
|---|---|---|---|---|---|---|
| 0.09 | 0.39 | 0.76 | 1.14 | 1.53 | 1.90 | |
| DI (μm) | 47.49 ± 1.94a | 55.84 ± 1.98b | 61.48 ± 1.36c | 58.12 ± 1.13bc | 56.39 ± 1.29b | 49.14 ± 1.79a |
| DE (n/mm2) | 158.67 ± 6.44a | 175.00 ± 7.09ab | 221.67 ± 18.00b | 218.00 ± 19.08b | 184.67 ± 19.38ab | 167.67 ± 6.06a |
Values are Means ± SE; a, b, c mean values in the same row with different superscript letters are significantly different (p < 0.05); Absence of letters indicates no significant difference between treatments.
FIGURE 3Relative expressions of col1a1, col1a2, p4hα1 and p4hβ in muscle of ITCC fed with different experimental diets for 8 weeks. Data are present as Means ± SE (n = 6). Different lowercase letters above the same group of bars represent significant difference between the corresponding groups (p < 0.05).
FIGURE 4Relative expressions of smad4, smad5, smad9 and tgf-β in muscle of ITCC fed with different experimental diets for 8 weeks. Data are present as Means ± SE (n = 6). Different lowercase letters above the same group of bars represent significant difference between the corresponding groups (p < 0.05).
FIGURE 5Relative expressions of igf-1, tor, myod, myf5 and myhc in muscle of ITCC fed with different experimental diets for 8 weeks. Data are present as Means ± SE (n = 6). Different lowercase letters above the same group of bars represent significant difference between the corresponding groups (p < 0.05).