| Literature DB >> 35721143 |
Chunlin Li1, Siyu Yu1, Xiaoxiao Li1, Ying Cao1, Meng Li1, Guang Ji1, Li Zhang1.
Abstract
Huazhi-Rougan (HZRG) formula is a Traditional Chinese medicine prescription, and has been widely used to treat non-alcoholic fatty liver disease (NAFLD) and its progressive form non-alcoholic steatohepatitis (NASH). However, the anti-NASH effects and the underlying mechanisms of HZRG have not yet been characterized. Here we showed that 4-week HZRG treatment alleviated methionine-choline-deficiency (MCD) diet-induced NASH in C57BL/6J mice, as evidenced by the improvement of hepatic steatosis and inflammation, as well as the decrease of serum levels of alanine and aspartate transaminases. Fecal 16S rDNA sequencing indicated that HZRG reduced the enrichment of pathogenic bacteria and increased the abundance of bacteria gena that are involved in bile acid (BA) conversation. The alteration of fecal and serum BA profile suggested that HZRG enhanced fecal BA excretion, and reduced the reabsorption of toxic secondary BA species (LCA, DCA, HCA). We further analyzed the BA receptors and transporters, and found that HZRG inhibited the expression of ileal bile acid transporter, and organic solute transporter subunit β, and increased the expression of intestinal tight junction proteins (ZO-1, Occludin, Claudin-2). The modulation of gut dysbiosis and BA profile, as well as the improvement of the intestinal environment, may contribute to the decrease of the p-65 subunit of NF-κB phosphorylation, liver F4/80 positive macrophages, inflammatory cytokine IL-1β and TNF-α expression. In conclusion, HZRG treatment enhances fecal BA excretion via inhibiting BA transporters, modulates BA profiles, gut dysbiosis as well as the intestinal environment, thus contributing to the beneficial effect of HZRG on NASH mice.Entities:
Keywords: bile acid excretion; gut microbiota; huazhi-rougan formula; ileal bile acid transporter; non-alcoholic steatohepatitis
Year: 2022 PMID: 35721143 PMCID: PMC9198489 DOI: 10.3389/fphar.2022.833414
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
Sequences of the primers used for RT-qPCR.
| Gene | Forward primer | Reverse primer |
|---|---|---|
|
| ACGTGGAACTGGCAGAAGAG | GGTTGTCTTTGAGATCCATGC |
|
| AAATGATGGCTTATTACAGTGGC | CTTGCTGTAGTGGTGGTCGG |
|
| ATGGCGACATGGACCTCAG | TCCCGAGTCAACCCACATC |
|
| ACCTCGTTTTATGCCGTATGC | TCGGGGTGTCCTTCAGTGTC |
|
| CTGCTGGAAGAAATGCTTTGG | TGGTGTTTCTTTGTCTTGTGGC |
|
| TGCGTCTTTTCCTGGATTACC | GTGATGTTGAGGGCGTTGG |
|
| AGCCTAAACATTCAAATCCCG | CAGAGCCCTTTACAGACACCAC |
|
| GTGCCGCCTGGAGAAACC | GGTGGAAGAGTGGGAGTTGC |
FIGURE 1Total ion chromatogram of constituents in HZRG. Agilent 1290 UPLC system was applied to analyze the chemical profiling of HZRG granules, data were collected under both negative ion mode and positive ion mode, and processed by Analyst Ver. 1.6 software.
The detected ion chromatogram of constituents in HZRG.
| NO | TR(min) | Selected ion |
|
| ppm | Formula | Identification | MS/MS fragmentation | Attribution |
|---|---|---|---|---|---|---|---|---|---|
| 1 | 8.83 | [M-H]− | 337.0784 | 337.0776 | 2.3 | C12H18O11 | 2-O-β-D-glucopyranosyl L-ascorbic acid | 337.0750; 277.0545; 174.0150 | Gou-Qi-Zi |
| 2 | 15.40 | [M + H]+ | 294.1528 | 294.1547 | −6.9 | C12H23NO7 | Fructoseleucine | 276.1426; 258.1318; 230.1369; 212.1262; 182.1154 | Gou-Qi-Zi |
| 3 | 16.43 | [M + H]+ | 268.1026 | 268.104 | −5.3 | C10H13N5O4 | Adenosine | 136.0601; 119.0329 | / |
| 4 | 17.22 | [M + H]+ | 284.0963 | 284.0989 | −9.3 | C10H13N5O5 | Guanosine | 152.0556; 135.0285; 110.0329 | / |
| 5 | 19.63 | [M + H]+ | 328.1373 | 328.1391 | −5.4 | C15H21NO7 | Fructosephenylalanine | 310.1261; 292.1160; 264.1206; 192.0996; 120.784 | Gou-Qi-Zi |
| 6 | 19.77 | [M-H]− | 493.1212 | 493.1199 | 2.6 | C19H26O15 | Galloylsucrose | 493.1182; 403.0838; 283.0438; 169.0136 | / |
| 7 | 21.7 | [M-H]− | 315.0723 | 315.0722 | 0.5 | C13H16O9 | Protocatechuic acid-3-O-glucoside | 315.0727; 153.0114; 153.0187; 108.0213 | Gou-Qi-Zi |
| 8 | 27.3 | [M-H]− | 353.0878 | 353.0878 | −4.3 | C16H18O9 | Neochlorogenic acid | 353.0850; 191.0557; 179.0343; 135.0447 | Mo-Han-Lian, Yin-Chen, Gou-Qi-Zi, Cang Zhu, Shan Zha |
| 9 | 34.77 | [M + H]+ | 798.3654 | 798.3655 | −0.1 | C37H55N3O16 | N (1),N (8)-bis-dihydrocaffeoyl -spermidine-di-hexoside | 798.3659; 636.3117; 474.2589; 384.1634; 222.1109 | Gou-Qi-Zi |
| 10 | 35.16 | [M + H]+ | 796.3467 | 796.344 | 3.4 | C44H49N3O11 | N (1)-dihydrocaffeoyl-N (8)-caffeoyl-spermidine-di-hexoside | 796.3512; 634.3006; 472.2430; 382.1492; 220.0978 | Gou-Qi-Zi |
| 11 | 37.23 | [M + H]+ | 796.3513 | 796.3499 | 1.8 | C37H53N3O16 | N (1)-caffeoyl-N (8)-dihydrocaffeoyl-spermidine-di-hexoside | 796.3538; 634.3020; 472.2546; 382.1498; 220.0973 | Gou-Qi-Zi |
| 12 | 37.25 | [M-H]− | 389.1083 | 389.1089 | −1.6 | C16H22O11 | Secologanoside | 389.1109; 345.1207; 209.0461; 165.0562 | Nv-Zhen-Zi |
| 13 | 37.36 | [M + H]+ | 636.3106 | 636.3127 | −3.3 | C31H45N3O11 | N (1),N (8)-bis-dihydrocaffeoyl-spermidine-hexoside | 636.3134; 474.2596; 384.1646; 222.1116 | Gou-Qi-Zi |
| 14 | 37.5 | [M-H]− | 353.0881 | 353.0878 | 0.8 | C16H18O9 | Chlorogenic acid | 191.0550; 173.0444; 161.0259 | Mo-Han-Lian, Yin-Chen, Gou-Qi-Zi, Cang Zhu, Shan Zha |
| 15 | 38.75 | [M-H]− | 353.0893 | 353.0878 | 4.2 | C16H18O9 | Cryptochlorogenic acid | 191.0554; 173.0454 | Mo-Han-Lian, Yin-Chen, Gou-Qi-Zi, Cang Zhu, Shan Zha |
| 16 | 39.15 | [M + H]+ | 634.2986 | 634.297 | 2.5 | C31H43N3O11 | N (1)-dihydrocaffeoyl-N8-caffeoyl-spermidine-hexoside | 634.2955; 472.2446; 310.2116; 220.0951 | Gou-Qi-Zi |
| 17 | 39.73 | [M + H]+ | 634.2978 | 634.297 | 1.2 | C31H43N3O11 | N (1)-caffeoyl-N8-dihydrocaffeoyl-spermidine-hexoside | 634.2982; 472.2419; 382.1487; 220.0964 | Gou-Qi-Zi |
| 18 | 40.34 | [M + H]+ | 474.2580 | 474.2599 | −3.9 | C25H35N3O6 | N (1),N (8)-bis-(dihydrocaffeoyl)spermidine | 474.2580; 222.1110 | Gou-Qi-Zi |
| 19 | 42.2 | [M + H]+ | 472.2417 | 472.2442 | −5.3 | C25H33N3O6 | N (1)-caffeoyl-N (8)-dhydrocaffeoylspermidine | 472.2436; 310.2105; 220.0947; 163.0373 | Gou-Qi-Zi |
| 20 | 43.02 | [M-H]− | 593.1517 | 593.1512 | 0.2 | C27H30O15 | Vicenin-II | 593.1486; 473.1085; 353.0643 | Gan-Cao, Chen-Pi |
| 21 | 44.62 | [M-H]− | 515.1189 | 515.1195 | −1.2 | C25H24O12 | 1,3-Dicaffeoylquinic acid | 515.1224; 353.0869; 191.0555; 179.0351; 135.0449 | Mo-Han-Lian, Gou-Qi-Zi, Cang Zhu |
| 22 | 45.21 | [M-H]− | 785.2514 | 785.251 | 0.5 | C35H46O20 | Echinacoside | 785.2558; 623.2188; 161.0250 | Nv-Zhen-Zi |
| 23 | 45.52 | [M-H]- | 367.1027 | 367.1035 | −2.1 | C17H20O9 | 3-O-feruloylquinic acid | 191.0569; 173.0449 | Gou-Qi-Zi |
| 24 | 46.82 | [M + FA-H]- | 621.2769 | 621.2764 | 0.8 | C27H44O13 | Atractyloside I | 621.2749; 575.2742; 413.2193 | Cang-Zhu |
| 25 | 46.99 | [M-H]− | 479.0839 | 479.0831 | 1.6 | C21H20O13 | Myricetin-3-O-β-galactoside | 479.0852; 317.0285 | / |
| 26 | 49.83 | [M-H]− | 701.2333 | 701.2298 | 4.9 | C31H42O18 | Neonuezhenide | 701.2314; 469.1386; 315.1095 | Nv-Zhen-Zi |
| 27 | 50.33 | [M-H]− | 609.1477 | 609.1461 | 2.6 | C27H30O16 | Rutin | 609.1468; 301.0339; 300.0265 | Shan-Zha, Xiao-Ji |
| 28 | 50.67 | [M-H]− | 549.1628 | 549.1614 | 2.6 | C26H30O13 | Liquiritinapioside | 549.1632; 417.1193; 255.069 | Gan-Cao |
| 29 | 51.23 | [M-H]- | 417.1192 | 417.1191 | 0 | C21H22O9 | Liquiritin | 417.1165; 255.0654; 135.0077 | Gan-Cao |
| 30 | 52.02 | [M-H]− | 623.1970 | 623.1981 | −1.8 | C29H36O15 | Verbascoside | 623.1962; 461.1615; 161.0232 | Nv-Zhen-Zi |
| 31 | 52.07 | [M-H]− | 463.0897 | 463.0882 | 3.2 | C21H20O12 | Hyperoside | 463.0879; 301.0323; 300.0265; 271.0221 | Shan-Zha |
| 32 | 52.14 | [M-H]− | 685.2351 | 685.2349 | 0.3 | C31H42O17 | Nuezhenide | 685.2334; 523.1779; 453.1365; 299.1118 | Nv-Zhen-Zi |
| 33 | 52.66 | [M-H]− | 463.0891 | 463.0882 | 1.9 | C21H20O12 | Isoquercitrin | 463.0869; 301.0339; 300.0243 | Shan-Zha |
| 34 | 52.67 | [M-H]− | 447.0936 | 447.0933 | 0.7 | C21H20O11 | Astragalin | 447.0928; 285.0380; 284.0322 | Nv-Zhen-Zi |
| 35 | 53.85 | [M + H]+ | 197.1161 | 197.1172 | −5.7 | C11H16O3 | Loliolide | 197.1170; 179.1055; 161.0946; 133.0996; 105.0690 | Gua-Lou |
| 36 | 54.78 | [M-H]− | 378.9746 | 378.9765 | −5.1 | C15H8O10S | 1,8,9-Trihydroxy-3-(sulfooxy)-6H-benzofuro [3,2-c][1]benzopyran-6-one | 378.9712; 299.0173; 255.0266; 211.0405 | Mo-Han-Lian |
| 37 | 55.22 | [M-H]− | 685.2348 | 685.2349 | −0.2 | C31H42O17 | Specnuezhenide | 685.2364; 523.1821; 453.1392; 421.1495; 299.1112 | Nv-Zhen-Zi |
| 38 | 56 | [M-H]− | 579.1705 | 579.1719 | −2.5 | C27H32O14 | Naringin | 579.1682; 271.0605; 151.0037 | Chen-Pi |
| 39 | 56.15 | [M-H]− | 623.2003 | 623.1981 | 3.5 | C29H36O15 | Isoverbascoside | 623.1989; 461.1692; 315.1106; 161.0231 | Nv-Zhen-Zi |
| 40 | 56.41 | [M-H]− | 515.1197 | 515.1195 | 0.4 | C25H24O12 | Isochlorogenic acid B | 515.1207; 353.0873; 191.0557; 137.0449; 179.0345 | Mo-Han-Lian/Gou-Qi-Zi/Cang-Shu |
| 41 | 59.55 | [M-H]− | 515.1196 | 515.1195 | 0.2 | C25H24O12 | Isochlorogenic acid A | 515.1175; 353.0867; 191.0560; 179.0349 | Mo-Han-Lian/Gou-Qi-Zi/Cang-Shu |
| 42 | 60.78 | [M-H]− | 919.2716 | 919.2725 | −1 | C39H52O25 | Cassiaside B2 | 919.2707; 647.2037; 545.1625; 271.0606; 256.0383 | Jue-Ming-Zi |
| 43 | 61.43 | [M-H]− | 901.2645 | 901.2619 | 2.9 | C39H50O24 | Chrysophanol-1-O-β-D-glucopyranosyl-(1→3)-O-β-D-glucopyranosyl-(1→6)-O-β-D-glucopyranosyl-(1→6)-O-β-D-glucopyranoside | 901.2654; 647.2058; 545.1692; 253.0500 | Jue-Ming-Zi |
| 44 | 61.5 | [M-H]− | 609.1828 | 609.1825 | 0.5 | C28H34O15 | Hesperidin/Neohesperidin | 609.1810; 301.0706; 286.0471 | Chen-Pi |
| 45 | 63.87 | [M-H]− | 515.1197 | 515.1195 | 0.4 | C25H24O12 | Isochlorogenic acid C | 515.1209; 353.0875; 191.0556; 173.0458; 179.0347 | Mo-Han-Lian/Gou-Qi-Zi/Cang-Shu |
| 46 | 64.98 | [M-H]− | 739.2090 | 739.2091 | −0.1 | C33H40O19 | Chrysophanol 1-triglucoside | 739.2048; 485.1503; 253.0491 | Da-Huang/Jue-Ming-Zi |
| 47 | 66.01 | [M-H]- | 595.1654 | 595.1668 | −2.4 | C27H32O15 | Toralactone 9-gentiobioside | 595.1644; 271.0598; 256.0364 | Jue-Ming-Zi |
| 48 | 67.11 | [M-H]− | 539.1787 | 539.177 | 3.1 | C25H32O13 | Oleuropein | 539.1797; 377.1249; 275.0904 | Nv-Zhen-Zi |
| 49 | 67.45 | [M-H]- | 491.1189 | 491.1195 | −1.2 | C23H24O12 | Aurantio-obtusin-beta-D-glucoside | 491.1203; 476.0939; 461.0657; 313.0344 | Jue-Ming-Zi |
| 50 | 69.42 | [M-H]− | 595.1658 | 595.1668 | −1.8 | C27H32O15 | Rubrofusarin 6-gentiobioside | 595.1732; 271.0617; 256.0372 | Jue-Ming-Zi |
| 51 | 69.98 | [M-H]- | 417.1205 | 417.1191 | 3.3 | C21H22O9 | Isoliquiritin | 417.1173; 255.0684 | Gan-Cao |
| 52 | 72.96 | [M-H]− | 565.1583 | 565.1563 | 3.6 | C26H30O14 | Cassiaside B | 567.1592; 271.0608; 256.0388 | Jue-Ming-Zi |
| 53 | 77.18 | [M-H]− | 591.1755 | 591.1719 | 6 | C28H32O14 | Linarin | 313.0628; 283.0627; 268.0374 | Xiao-Ji/Mo-Han-Lian |
| 54 | 77.41 | [M-H]− | 1071.3565 | 1071.3562 | 0.3 | C48H64O27 | Oleonuezhenide | 1071.3606; 909.3632; 771.2355; 685.2372; 523.1854; 453.1389; 299.1130 | Nv-Zhen-Zi |
| 55 | 79.22 | [M + H]+ | 309.0864 | 309.087 | −1.9 | C17H12N2O4 | Flazin | 291.0755; 263.0806; 206.0832; 205.0750 | Gua-Lou |
| 56 | 81.97 | [M-H]− | 431.1001 | 431.0984 | 4 | C21H20O10 | Aloe-emodin-8-O-glucoside | 431.0938; 268.0364; 240.0412 | Da-Huang |
| 57 | 82.89 | [M-H]− | 1071.3643 | 1071.3562 | 7.5 | C48H64O27 | Nuezhenoside G13 | 1071.3577; 909.2898; 685.2326; 523.1806; 453.1380 | Nv-Zhen-Zi |
| 58 | 83.55 | [M-H]− | 431.0999 | 431.0984 | 3.5 | C21H20O10 | Emodin-8-O-glucoside | 431.0976; 269.0446; 225.0544 | Da-Huang |
| 59 | 84.45 | [M-H]− | 313.0355 | 313.0354 | 0.4 | C16H10O7 | Wedelolactone | 313.0340; 298.0102; 269.0067 | Mo-Han-Lian |
| 60 | 86.3 | [M + H]+ | 728.4003 | 728.3978 | 3.5 | C36H53N7O9 | Citrusin Ⅲ | 728.3985; 700.4058; 587.3143; 474.2357 | Chen-Pi |
| 61 | 87.68 | [M-H]− | 313.0343 | 313.0354 | −3.4 | C16H10O7 | Laccaic acid D | 313.0335; 269.0438; 241.0527; 226.0273 | Da-Huang |
| 62 | 88.43 | [M + H]+ | 477.3209 | 477.3211 | −0.3 | C28H44O6 | Polyporusterone B | 477.3249; 459.3132; 441.3084; 423.2857; 357.2080 | Zhu-Ling |
| 63 | 90.46 | [M + FA-H]− | 841.4624 | 841.4591 | 3.9 | C42H68O14 | Eclalbasaponin C | 841.4601; 795.4505; 675.4136; 633.3990 | Mo-Han-Lian |
| 64 | 90.52 | [M + H]+ | 479.3379 | 479.3367 | 2.5 | C28H46O6 | Polyporusterone A | 479.3353; 461.3243; 443.3103; 425.3071 | Zhu-Ling |
| 65 | 90.63 | [M-H]− | 837.3933 | 837.3914 | 2.2 | C42H62O17 | Licorice saponin G2 | 837.3879; 351.0558 | Gan-Cao |
| 66 | 91.49 | [M-H]− | 875.4100 | 875.4104 | −0.5 | C42H68O17S | Eclalbasaponinn VI | 875.4086; 713.3535 | Mo-Han-Lian |
| 67 | 92.31 | [M + FA-H]− | 973.5361 | 973.5378 | −1.7 | C48H80O17 | Saikosaponin f | 973.5380; 927.5314; 781.4683 | Chai-Hu |
| 68 | 92.38 | [M-H]− | 837.3916 | 837.3914 | 0.2 | C42H62O17 | Licorice saponin Q2 | 837.3922; 351.0539 | Gan-Cao |
| 69 | 92.43 | [M-H]− | 329.2321 | 329.2333 | −3.8 | C18H34O5 | Tianshic acid | 329.2324; 229.1442; 211.1327; 183.1390; 171.1023 | Gua-Lou |
| 70 | 92.84 | [M + FA-H]− | 971.5221 | 971.5221 | 0 | C48H78O17 | Saikosaponin C | 971.5298; 925.5173; 779.4491 | Chai-Hu |
| 71 | 93.06 | [M + H]+ | 373.1279 | 373.1282 | −0.7 | C20H20O7 | Isosinensetin | 373.1273; 358.1037; 343.0798; 327.0469; 315.0846 | Chen-Pi |
| 72 | 93.76 | [M-H]− | 821.3955 | 821.3965 | −1.2 | C42H62O16 | Glycyrrhizic acid | 821.3917; 351.0547 | Gan-Cao |
| 73 | 93.95 | [M + H]+ | 505.3522 | 505.3524 | −0.3 | C30H48O6 | 16-oxoalisol A | 505.3533; 487.3406; 469.3321; 451.3202; 415.2838 | Ze-Xie |
| 74 | 95.05 | [M + FA-H]− | 825.4663 | 825.4642 | 2.5 | C42H68O13 | Saikosaponin a | 825.4712; 779.4602; 617.4064 | Chai-Hu |
| 75 | 95.06 | [M-H]- | 821.3985 | 821.3965 | 5.4 | C42H62O16 | Licoricesaponin K2 | 821.3906; 351.0533 | Gan-Cao |
| 76 | 95.15 | [M + H-H2O]+ | 529.3507 | 529.3524 | −2.6 | C32H50O7 | 23-Acetyl 16-oxoalisol A | 529.3515; 469.3311; 451.3193 | Ze-Xie |
| 77 | 95.28 | [M-H]− | 299.0550 | 299.0561 | −3.7 | C16H12O6 | Chrysoeriol | 299.0549; 284.0293; 256.0356 | Gua-Lou |
| 78 | 95.46 | [M-H]− | 329.0673 | 329.0667 | 1.9 | C17H14O7 | Aurantio-obtusin | 329.0648; 314.0405; 299.0156; 271.0213; 243.0268 | Jue-Ming-Zi |
| 79 | 95.67 | [M + H]+ | 373.1286 | 373.1282 | 1.1 | C20H20O7 | Sinensetin | 373.1273; 357.0950; 343.0785; 329.0995; 312.0967 | Chen-Pi |
| 80 | 96.38 | [M + FA-H]− | 825.4676 | 825.4642 | 4.1 | C42H68O13 | Saikosaponin d | 825.4818; 779.4634; 617.4057 | Chai-Hu |
| 81 | 96.7 | [M-H]− | 633.4017 | 633.4008 | 1.4 | C36H58O9 | Ecliptasaponin D | 633.3991; 587.3928; 161.0441 | Mo-Han-Lian |
| 82 | 97.58 | [M-H]− | 283.0254 | 283.0248 | 2.1 | C15H8O6 | Rhein | 283.0222; 239.0324; 211.0381; 183.0422 | Da-Huang/Jue-Ming-Zi |
| 83 | 98.09 | [M + H]+ | 403.1369 | 403.1387 | −4.6 | C21H22O8 | Nobiletin | 403.1395; 388.1163; 373.0913; 355.0816 | Chen-Pi |
| 84 | 98.24 | [M + FA-H]− | 867.4801 | 867.4748 | 6.2 | C44H70O14 | 3″-O-Acetylsaikosaponin a | 867.4818; 821.0471; 779.4587; 617.4067 | Chai-Hu |
| 85 | 99.74 | [M + H]+ | 433.1472 | 433.1493 | −4.9 | C22H24O9 | 3′,4′,3,5,6,7,8-Heptamethoxyflavone | 433.1506; 418.1273; 403.1035 | Chen-Pi |
| 86 | 99.11 | [M-H]− | 357.0986 | 357.098 | 1.7 | C19H18O7 | Chrysoobtusin | 357.0974; 342.0733; 327.0492; 312.0254; 284.0296 | Jue-Ming-Zi |
| 87 | 99.84 | [M + H]+ | 487.3413 | 487.3418 | −1 | C30H46O5 | Alisol C | 487.3464; 469.3333; 451.3233; 397.2749 | Ze-Xie |
| 88 | 100.33 | [M + H]+ | 249.1482 | 249.1485 | −1.3 | C15H20O3 | AtractylenolideⅢ | 231.1368; 203.1423; 189.0903; 163.0747; 149.0582 | Bai-Shu/Cang-Shu |
| 89 | 101.14 | [M-H]− | 343.0830 | 343.0823 | 2 | C18H16O7 | Obtusin | 343.0820; 328.0580; 313.0339; 285.0377 | Jue-Ming-Zi |
| 90 | 101.71 | [M-H]− | 283.0612 | 283.0612 | 1.8 | C16H12O5 | Obtusifolin | 283.0609; 268.0371; 240.0416; 239.0334 | Jue-Ming-Zi |
| 91 | 100.69 | [M + H]+ | 373.1282 | 373.1282 | 0.1 | C20H20O7 | Tangeretin | 373.1292; 358.1056; 343.0806 | Chen-Pi |
| 92 | 103.48 | [M-H]− | 269.0462 | 269.0455 | 2.4 | C15H10O5 | Emodin | 269.0449; 241.0482; 225.0544 | Da-Huang/Jue-Ming-Zi/Zhu-Ling |
| 93 | 103.92 | [M + H]+ | 529.3540 | 529.3524 | 2.9 | C32H48O6 | 23-Acetyl alisol C | 569.3588; 469.3347; 451.3241; 433.3152 | Ze-Xie |
| 94 | 105.86 | [M + H]+ | 233.1524 | 233.1536 | −5.2 | C15H20O2 | AtractylenolideⅡ | 233.1525; 215.1422; 187.1459; 151.0739; 131.0836 | Bai-Shu/Cang-Shu |
| 95 | 106.28 | [M + FA-H]− | 535.3663 | 535.364 | 4.2 | C30H50O5 | Alisol A | 535.3638; 489.3587; 471.3460; 339.2671 | Ze-Xie |
| 96 | 107.04 | [M + H]+ | 515.3723 | 515.3731 | −1.6 | C32H50O5 | 23-Acetyl alisol B | 515.3677; 497.3630; 455.3520; 437.3419; 419.3314 | Ze-Xie |
| 97 | 109.33 | [M + H]+ | 231.1381 | 231.138 | 0.6 | C15H18O2 | Atractylenolide Ⅰ | 231.1381; 185.1321; 155.0869; 143.0841 | Bai-Shu/Cang-Shu |
| 98 | 109.49 | [M + H]+ | 515.3718 | 515.3731 | −2.5 | C32H50O5 | Alisol B 11-monoacetate | 515.3781; 497.3652; 419.336; 383.29558; 365.2857 | Ze-Xie |
| 99 | 114.28 | [M + H]+ | 527.3736 | 527.3731 | 0.9 | C33H50O5 | Dehydropachymic acid | 527.3689; 509.3714; 467.3473; 449.3215 | Zhu-Ling |
| 100 | 116.53 | [M + H]+ | 515.3741 | 515.3731 | 2.1 | C32H50O5 | 23-Acetyl alisol B Isomer | 515.3773; 437.3437; 419.3320; 357.2828; 339.2677 | Ze-Xie |
FIGURE 2Effects of HZRG on MCD induced NASH mice. (A) Body weight; (B) liver/body weight ratio; (C) Representative H&E and ORO staining images of liver sections (magnification ×200); (D,E) Liver TG and TC content; (F,G) Serum ALT and AST levels. Data are expressed as mean ± SD, 10 animals were allocated for each group. * p < 0.05, ** p < 0.01; *** p < 0.001 between groups.
FIGURE 3HZRG modulates gut microbiota in NASH mice. (A) PCoA analysis based on the weighted UniFrac analysis of OTUs; (B) PCoA analysis based on the unweighted UniFrac analysis of OTUs; (C) Venn Diagram; (D) Mean Phylum abundance of OTUs; (E) Mean family abundance of OTUs; (F) Pathways that based on PICRUST functional prediction. Data are expressed as mean ± SD of 9 or 10 animals per group.
FIGURE 4HZRG enhances fecal BA excretion. (A) The total fecal BA concentration; (B) The alteration of BA classification; (C) Fecal BA profile; (D) Volcano plot shows the change of BA species upon HZRG intervention (Red-increase, green-decrease); (E) Spearman correlation analysis of the relative abundance of microbial species and the BAs. Data are expressed as mean ± SD, n = 10 per group. * p < 0.05, ** p < 0.01between groups.
FIGURE 5HZRG inhibits BA reabsorption. (A) The model of BA transport in the intestine; (B) The protein expression of intestinal BA receptors; (C) The mRNA expression of BA transporters; (D) Intestinal tight junction protein expression; (E) Serum BA profile; (F,G) The alteration of secondary BA species; (H) The correlation of altered secondary BAs and the genes regulating BA transport. Data are expressed as mean ± SD, n = 10 per group. * p < 0.05, ** p < 0.01; *** p < 0.001 between groups.
FIGURE 6HZRG suppressed hepatic inflammation. (A) The serum concentration of TNFα; (B) The protein expression of liver TLR4, P-P65, P65. (C) IHC staining of liver macrophage biomarker F4/80; (D,E) The mRNA expression of liver Tnfα were and IL-1β. Data were shown as mean ± SD, * p < 0.05, ** p < 0.01 between groups.
FIGURE 7Graphic summary of the study.