Literature DB >> 35720023

Mechanism of Action of Zhi Gan Cao Decoction for Atrial Fibrillation and Myocardial Fibrosis in a Mouse Model of Atrial Fibrillation: A Network Pharmacology-Based Study.

Lei Gao1,2, Chenjing Kan1,2, Xin Chen1,2, Shengsong Xu1,2, Kaihu Shi1,2.   

Abstract

Atrial fibrillation (AF), a commonly seen cardiac disease without optimal curative treatment option, is usually treated by traditional Chinese medicine in China. The Zhi-Gan-Cao decoction (ZGCD) is an alternative medicine for clinical use and has definitive effects. It remains to be defined regarding the specific components and related mechanisms of ZGCD for the treatment of AF. We determined the primary constituents and major targets of the herbs in ZGCD using the TCMSP, HERB, and BATMAN-TCM databases. The UniProt databank database amended and combined the prospective names to supply objective data and records. Every target connected to AF was generated using the GeneCards databank, Drugbank database, TTD, Disgenet database, and OMIM. After identifying possible common targets between ZGCD and AF, the interface network illustration "ZGCD component-AF-target" was created using Cytoscape. We obtained 175 constituents and 839 targets for seven herbal drug categories in the ZGCD and identified 1008 targets of AF. After merging and removing repetitions, 136 collective targets between the ZGCD and AF were removed using the Cytoscape system. These renowned targets were generated from 38 suitable components from among the 157 components. GO enhancement examination and KEGG enrichment analysis by Metascape identified the close connection between the critical target genes and 20 signaling pathways. Then, we injected isoproterenol subcutaneously into the mouse and gave gavage with roasted licorice soup. Two weeks later, mouse were processed and sampled for testing. The results of HE and Masson staining showed that ZGCD effectively alleviated the degree of myocardial fibrosis. As indicated by qRT-PCR and Western blotting, ZGCD significantly reduced COL1A1, COL1A2, COL3A1, and TGF-β1 in myocardial fibrotic tissue to reduce myocardial fibrosis and treat AF by interfering with the expression of COL1A1, COL1A2, COL3A1, and TGF-β1 in myocardial tissue. ZGCD may treat AF by lowering the degree of myocardial fibrosis.
Copyright © 2022 Lei Gao et al.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35720023      PMCID: PMC9203184          DOI: 10.1155/2022/4525873

Source DB:  PubMed          Journal:  Comput Math Methods Med        ISSN: 1748-670X            Impact factor:   2.809


1. Introduction

Atrial fibrillation (AF), the most persistent arrhythmia clinically found, affects approximately 33 million people across the globe [1], with one out of four middle-aged people suffering from AF in Europe and the United States [2] and 1% inflicted population in Asia [3]. The incidence of AF continues to increase directly with increase in age, and a large study conducted between 1990 and 2010 in the UK [4] reported that the AF incidence (mainly in patients older than 75 years) is related to the global AF rate. The global mortality rates have increased. AF is a global problem that endangers human life and health. Thus far, there have been many achievements with regard to AF diagnosis and treatment. However, due to complex mechanisms involved in the occurrence and development of AF, there is currently no specific optimal treatment method that can provide a clinically beneficial effect. Specific instructions have been defined in traditional Chinese medicine (TCM) for the treatment of cardiac diseases, including arrhythmia [5]. The Zhi-Gan-Cao decoction (ZGCD), a classical formula of Chinese herbs, comprises ginger, licorice, cassia twig, ginseng, donkey-hide gelatin, Ophiopogon japonicus, hemp seed, Rehmannia, and jujube, among which licorice and ginseng are the most important ingredients. In China, the ZGCD has a subtle effect on arrhythmia [6]. Previous research has indicated that the activation of endothelial cells, cardiac remodeling, cardiomyocyte action potential, and platelet activation are involved in the mechanism of action of ZGCD [7-10]. A key component of ZGCD, Zhigancao, whose main components are glycyrrhizinate and glycyrrhetinic acid, plays a pivotal role in the treatment of arrhythmia [11]. Another main component, ginseng, has a definite effect on the treatment of arrhythmia [12-14]. Previous studies have shown that the ZGCD can modulate AF [8, 15], although the specific effect of ZGCD on the therapeutic targets of AF has not been explored previously. The main purpose of this study is to provide a theoretical approach that is clinically applicable to facilitate the better treatment of AF. The novelty of the current study if to focus on Chinese medicine to determine whether ZGCD can inhibit the activation of major molecular targets and signaling axis that have a connection with AF onset and progression. Accordingly, we planned to use network pharmacological systems to examine, explore, and evaluate the targets, components, and pathways involved in the multiple facets of the interactions and supervisory systems that are involved in the electrophysiology, cardiomyocyte proliferation, and apoptosis. By constructing a murine myocardial fibrosis model, we planned to evaluate whether ZGCD can treat AF by alleviating myocardial fibrosis, which could provide a basis for more intensive future research into the mechanisms of ZGCD for the disease on the one hand, and ascertain the development of novel approaches and drugs for AF treatment on the other.

2. Data and Methods

2.1. Data Preparation

The Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP; https://old.tcmsp-e.com/tcmsp.php) [16] was used for drug information acquisition. The main ingredients of the ZDCD, Gillian and Fresh Rehmannia root, were not found in the TCMSP. Thus, high-throughput experimental and reference-guided TCM databases HERB (http://herb.ac.cn/) [17] and BATMAN-TCM (http://bionet.ncpsb.org.cn/batman-tcm/) [18] were utilized to obtain this information. Next, the ingredients were screened by using the TCMSP. The drug targets' protein names were converted into gene names of the Human Gene Database (GeneCards; https://www.genecards.org/) [19] via the UniProt database (https://www.uniprot.org/). The enrichment analysis was performed using Metascape (https://metascape.org) [20] and using AF gene data from the GeneCards and Drug Bank (https://www.drugbank.ca/) [21].

2.2. Screening of Ingredients and Detection of Targets in the ZGCD

To determine the molecular drug composition of ZGCD, a systematic search of the TCMSP was performed for the title of each dynamic constituent of the ZGCD, and their chemical and structural similarities with commonly available prescription medications were compared on the US Food and Drug Administration website (https://www.fda.gov/). The pharmaceutical additives that serve therapeutic importance were evaluated using the aforementioned criteria. As the Gillian and Fresh Rehmannia root's main ingredients could not be found in the TCMSP, a high-throughput experimental and reference-guided TCM database (http://herb.ac.cn/) was used. Thereafter, the ingredients were screened by using the TCMSP. The major ingredients of the ZGCD include licorice, ginger, cassia twig, ginseng, donkey-hide gelatin, Ophiopogon japonicus, and hemp seed. The chemical structure of each drug was derived after “jujube” was entered into the TCMSP database. For obtaining the structure of the drug and targets, the evaluation settings were ground on the oral bioavailability (OB; 30%) and drug-likeness (DL 0.18). Several studies have shown that testing criteria can be used to exclude unsuitable pharmaceutical ingredients [22-24]. As aforementioned, HERB (http://herb.ac.cn/) was used as the Gillian and Fresh Rehmannia root's main ingredients could not be found on the TCMSP, and the ingredients were screened by using the TCMSP.

2.3. Target Screening of AF

The GeneCards (HTTPS://http://www.genecards.org/) record likely delivers comprehensive and manageable statistics for all projected and annotated human genes, which are used by numerous researchers who undertake network pharmacology research [25, 26]. We used “atrial fibrillation” as the keyword to retrieve the target obtained by GeneCards in AF. On the bioinformatics platform (https://www.bioinformatics.com.cn/) [27], the targets of ZGCD and AF were projected in a framework. Consequently, a Venn plot was constructed to obtain collective targets between herbs used in ZGCD and also to identify the shared targets of ZGCD and AF as it might be advantageous to identify the cooperative engagements of ZGCD herbal components, which would be valuable for studying the therapeutic effects of ZGCD on AF.

2.4. Drug Target–AF Network Building and Analysis

A medication network was built using Cytoscape software (version 3.8.2) Bisogenet [28] widget for active drug candidates via TCMSP/HERB/BATMAN-TCM as well as via the GeneCards dataset for genetic variants in glioma. Using Cytoscape, two PPI networks were constructed and validated: one for the scanned ZGCD target and one for the known AF target. The topology study gradually weeded out the central network after integrating the two systems into candidate networks. The examination was accomplished via the CytoNCA (24) plug-in in Cytoscape to determine the following six metrics: eigen-vector centrality (EC), closeness centrality (CC), degree centrality (DC), local average connectivity (LAC), topology intermediateness (BC), and network centrality (NC). The ideal hub network was selected using the aforementioned methods.

2.5. Protein–Protein Interaction Network Construction

The 132 abovementioned common targets were input into The Search Tool for the Retrieval of Interacting Genes (STRING, v11.0, https://stringdb.org) for recovery by selecting the smallest required interconnection rating of more than two-fifths [29]; then, the PPI system of the ZGCD was evaluated for suitable components in addition to the AF-related targets.

2.6. Gene Ontology (GO) and Pathway-Enrichment Examination

The execution of GO and path enhancement examination of multiple items on Metascape (https://metascape.org//) were undertaken using the “Home sapiens” mode. KEGG-based enrichment pathway results were utilized for potential molecular mechanism analysis of PL@RM on AF. We used R-Studio to plot the pathways related to AF in the bubble chart.

2.7. Experimental Study: Drugs and Reagents

We used isoproterenol (ISO; National Medicine Standard: H50020020), purchased from Nanjing, Jiangsu, as the drug for developing the model. This model has the characteristics of high stability, easy operability, and high imitability and is currently one of the accepted methods for preparing animal models of myocardial fibrosis [30]. The ZGCD was provided by the Chinese Pharmacy of Jiangsu Hospital of Integrated Traditional Chinese and Western Medicine after ZGCD freeze-dried powder was prepared by water extraction and alcohol precipitation at the Jiangsu Provincial Hospital on Integration of Chinese and Western Medicine. Related detection reagents, RIPA lysis buffer (P0013B), protease phosphatase inhibitor mixture (P1049), BCA protein quantification kit (P0010S), and sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer (5×; P0015L) as well as the SDSSDS-PAGE gel preparation kit (P0012A) were obtained from Beyotime (Shanghai, China). COL1A1 antibody (1 : 1000, 72026) was purchased from Proteintech (Massachusetts, USA). The COL1A2 antibody (1 : 1000, 14695-1-AP) and COL3A1 antibody (1 : 500, 22734-1-AP) were purchased from Proteintech (Chicago, USA). TGF-β1 (1 : 1000, ab215715) and anti-GAPDH antibodies (1 : 10000, ab8245) were supplied by Abcam (Cambridge, UK). The RNAiso Plus (9109), PrimeScript™ RT reagent Kit with gDNA Eraser (RR047A), and TB Green® Premix Ex Taq™ (RR420A) were supplied by Takara (Shiga, Japan). The design and synthesis of mouse COL1A1, COL1A2, COL3A1, TGF-β1, and β-actin primers were made by Sangong Biotech (Shanghai, China), with results presented in Table 1.
Table 1

The primer sequence of COL1A1, COL1A2, COL3A1, TGF-β1, and β-actin.

GenePrimer sequence
COL1A1Forward5′TGAACGTGGTGTACAAGGTC3′
Reverse5′CCATCTTTACCAGGAGAACCAT′3

COL1A2Forward5′GCCTAGCAACATGCCAATATTT3′
Reverse5′GAATACTGAGCAGCAAAGTTCC′3

COL3A1Forward5′GAAAGAATGGGGAGACTGGAC3′
Reverse5′TACCAGGTATGCCTTGTAATCC3′

TGF-β1Forward5′CCAGATCCTGTCCAAACTAAGG3′
Reverse5′CTCTTTAGCATAGTAGTCCGCT′3

β-ActinForward5′CTACCTCATGAAGATCCTGACC′
Reverse5′CACAGCTTCTCTTTGATGTCAC′3

2.8. Animal Model

All animal experiments have gotten the approval from the Institutional Animal Care and Use Committee of Jiangsu Provincial Academy of Chinese Medicine. Healthy male specific pathogen-free C57BL/6 mice (weight: 18 ± 2 g) supplied by Shanghai Slack (production license number: SCXK (Shanghai) 2015-0002) were allowed to acclimatized to the breeding environment (temperature: 25°C, relative humidity: 45%) for 1 week and then assigned randomly into three groups: control, model, and ZGCD. The model and ZGCD groups were subcutaneously administered ISO 5 mg/kg/d to construct a mouse myocardial fibrosis model, whereas the control group received a subcutaneous injection of 1 mL/kg/d normal saline; in addition, the ZGCD group was administered 50 g/kg ZGCD daily by gavage. Two weeks later, all mice were anaesthetized with 45 mg/kg 2.5% pentobarbital sodium that was intraperitoneally injected, and blood samples were collected from the heart, stored at -80°C for 15 min of centrifugalization (3000 rpm) to obtain serum. After mouse death, the mouse's chest cavity was opened using a lateral incision, and the heart was removed. One part of the heart was placed in 4% formalin solution for hematoxylin-eosin (HE) and Masson staining, and the other part was subjected to quick liquefrozen for Wester blotting (WB) and polymerase chain reaction (PCR).

2.9. HE and Masson Staining

A sufficient amount of the fixed sample was placed in a 4% paraformaldehyde solution in the embedding box and then placed in an automatic dehydrator for dehydration. Following complete dehydration, paraffin embedding was performed, and the paraffinized tissue sections were obtained using a manual rotary pathological microtome. The paraffinized tissue slices were placed on an automatic slicer for baking, and 1 hour later, the slices were considered ready; some slices were put into the automatic pathological staining machine and taken out after the specified cycle was run; other slices were stained using the Masson staining kit. The slices were automatically machine-mounted, placed in a fume hood to air dry. They were taken out the next day into a slicing box for storage at indoor temperature, for the final observation and photographing under an optical microscope. We checked at least five random areas of each section and used an automated photo and image analysis system (Image-Pro Plus v6.0, USA) for semiquantitative evaluation.

2.10. qT-PCR Analysis

RNAiso Plus was used to lyse the ground mouse heart tissue, which was mixed with chloroform and then centrifuged (12000 rpm) for 15 min. After extraction, the obtained supernatant was mixed with isopropanol, followed by 10 min of centrifugalization (12,000 rpm). Following supernatant removal, 75% alcohol was used for precipitate washing. The supernatant was discarded again, and the extracted RNA was dissolved in diethyl pyrocarbonate water, followed by reverse translation into cDNA according to the Takara's reverse transcription kit instructions. Finally, the Takara fluorescent quantitative PCR kit was used to detect reverse-transcribed cDNA. When the set threshold was reached, the cycle number (CT value) of the fluorescent signal in each reaction tube was recorded. 2−△△Ct was responsible for the identification of gene expression differences.

2.11. Western Blot Analysis

The RIPA-lysed ground mouse myocardial tissue was treated with centrifugalization (12,000 rpm, 15 min) to collect the supernatant. Protein concentration was measured with the use of the BCA protein quantification kit. Equal amount of 10 μL protein samples were separated by sodium dodecyl sulfonate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a polyvinylidene difluoride (PVDF) membrane (230 mA, 2.5 h) that was subjected to 1 h of cultivation with 5% bovine serum albumin solution. The PVDF membrane was then cut out according to the different molecular weights of the protein and placed in the antibody-incubation box. The diluted corresponding Ι antibodies were used for overnight incubation (4°C). After incubation, the corresponding II antibody was placed into the box for 2 h of indoor cultivation. ECL (Beyotime, Shanghai, China) was employed for the identification of the expression of the corresponding protein bands in the bioimager and ImageJ software (Image J Software, Bethesda, USA) for the gray value analysis of the protein band, with GAPDH as an internal reference.

2.12. Statistical Processing

SPSS (v24.0) was employed for statistical analysis. Measurement data of each group are given mean ± standard deviation (). The comparison of multisample means adopts a single-factor analysis of variance. When it was in a normal distribution, the mean from pairwise comparisons was obtained using the Student's t-test; when the variances between groups were equal, the least-significant difference test was used; and when the variances were nonuniform, the Games–Howell test was adopted. The level of significance was p < 0.05.

3. Results

3.1. Herbs in the ZGCD Constituents and Its Targets

OB ≥ 30% and DL ≥ 0.18 in the TCMSP databank and a cutoff ≥ 20 in the BATMAN-TCM databank were set to monitor suitable components of cassia twig, licorice, ginger, jujube, ginseng, donkey-hide gelatin, Ophiopogon japonicus, fresh Rehmannia root, and hemp seed. Upon adding some significant components of the literature, 175 components were identified. The constituents of the aforementioned constituents were then typed into the UniProt databank, and these targets' information was supplemented with Swiss target prediction databank. Upon elimination of duplicates, 839 targets in the ZGCD components were obtained (Table 2).
Table 2

The constituents' number and targets projected with regard to the herbs in the ZGCD.

HerbsComponents numberPredicted targets number
Liquorice92235
Fresh Rehmannia root644
Ginseng22118
Jujube29211
Donkey-hide gelatin3400
Ophiopogon japonicus 18243
Hemp seed6114
Ginger557
Cassia twig1166

3.2. Common Targets between ZGCD and AF

The keyword “atrial fibrillation” was searched in the GeneCards database, Drugbank, DTT, OMIM, and Disgenet, which returned 1008 targets after removing the duplicates. In the bioinformatics online platform, 839 ZGCD targets and 1008 AF targets were entered, and the Venn diagram B was drawn (Figure 1). After the duplicates were removed, 157 common targets were identified between the ZGCD and AF. Furthermore, we discovered that these targets only originated from 136 active compounds, whereas the remaining 38 potential elements in ZGCD had no overlap with AF targets.
Figure 1

Target matching is presented in Venn diagram to illustrate the overlap between the ZGCD and AF targets. Targets of herbs in the ZGCD are represented in red, and the targets of AF are shown in green.

3.3. ZGCD-Component-AF-Target Network Analysis

In total, 36 and 157 virtual components and shared targets, respectively, between ZGCD and AF, were typed into Cytoscape 3.7.1 for the development of a visual representation in the network diagram showing the relationships between components and targets fitted to ZGCD and AF, in that order (Figure 2).
Figure 2

The network drawing for the interaction of the ZGCD-component-AF target.

Brown represents eight herbal medicines in the ZGCD; purple, yellow, orange, and dark blue represent 136 common targets (Table 3); green, orange, pink, yellow, light cyan, purple, crimson, teal, and light red represent effective components of licorice, ginseng, jujube, Ophiopogon japonicus, cassia twig, hemp seed, donkey-hide gelatin, fresh Rehmannia root, and ginger, respectively (Table 4); the red line represents common effective components of different herbs. The assessment of degree shows the number of projected correlations between constituents and targets. The degree value is proportional to the importance of the component.
Table 3

The top 10 effective constituents of herbs in ZGCD.

NumberDegreeConstituentsLiquoriceGinsengJujubeDonkey-hide gelatin Ophiopogon japonicus Hemp seedGingerCassia twig
173Quercetin
238Lysine
334Stigmasterol
429Kaempferol
529Luteolin
620Beta-sitosterol
719Beta-carotene
815Arachidonic acid
9147-Methoxy-2-methyl isoflavone
10121-Methoxyphaseollidin

ZGCD: Zhi-Gan-Cao decoction; AF: atrial fibrillation.

Table 4

The targets between ZGCD and AF (157).

NumberDegreeNameNumberDegreeNameNumberDegreeName
1111PTGS2542CD40LG1071GAA
270PPARG552CDKN1A1081GJA5
367NOS2562CYP1A11091HADHA
464PTGS1572EGFR1101HSPA5
561SCN5A582F31111HSPB1
658F10592GJA11121HTT
747ADRB2602HIF1A1131IGF1
838DPP4612IL101141IKBKB
931ADRA1B622IL21151KCNA2
1026ACHE632IL61161KCNA3
1122F7642LEP1171KCNA5
1221KCNH2652MMP91181KCNC1
1316NOS3662MTR1191KCND2
1414ADRA1D672MYC1201KCND3
1510MAOB682PLAT1211KCNE5
168ADRA1A692PON11221KCNIP2
178CASP3702PPARA1231KCNK2
187AKT1712RNASE11241KCNQ1
197NR3C2722RNF2071251MAOA
206BCL2732RYR31261MAP2K4
216CHRM2742SELE1271MMP3
226DRD2752STAT11281MYBPC3
235MAPK1762TGFB11291NFE2L2
245XDH772TP531301NKX2-1
254CASP9782VCAM11311NPPA
264CAT792VKORC11321PCNA
274CCND1801ABCA11331PECAM1
284CYP3A4811ADRA2A1341PLG
294HMOX1821ADRB11351POLG
304ICAM1831AGXT21361PRODH
314IL1B841ALB1371RAF1
324MMP1851APOE1381SCN10A
334NR1I2861APP1391SELP
344PRKCA871ATP1A21401SERPINE1
354TNF881AVP1411SLC19A2
363ADORA1891CACNA1D1421SLC22A6
373ADRA2B901CACNA1S1431SLC25A4
383CASP8911CACNA2D11441SOD2
393CETP921CASP11451SPP1
403CYP1A2931CCL21461TERT
413IFNG941COL1A11471TFAP2B
423MMP2951COL1A21481TH
433NFKBIA961COL3A11491THBD
443SOD1971CRP1501TLR4
453VEGFA981CTNNB11511TNFRSF1A
462ADRA2C991CXCL81521TNNC1
472ANK31001CYP2B61531TNNI2
482APOB1011CYP2E11541TNNI3
492APOH1021DLD1551TNNI3K
502APRT1031EDN11561TNNT1
512CAV11041FAS1571TNNT2
522CAV31051FOS
532CD361061FXN

ZGCD: Zhi-Gan-Cao decoction; AF: atrial fibrillation.

Subsequently, the network diagram was investigated with the use of a network analyzer. As shown in Table 3, out of 81, the top 10 constituents in ZGCD included quercetin (degree = 73), lysine (degree = 38), stigmasterol (degree = 34), kaempferol (degree = 29), luteolin (degree = 29), beta-sitosterol (degree = 20), beta-carotene (degree = 19), arachidonic acid (degree = 15), 7-methoxy-2-methyl isoflavone (degree = 14), and 1-methoxyphaseollidin (degree = 12). In Table 4, the suitable constituents of ZGCD, such as PTGS2 (degree = 111) and PTGS1 (degree = 64), displayed great action on AF medical handling through the cyclooxygenase family, which is pivotal in mediating the inflammatory reactions of AF. Moreover, ZGCD components, such as ADRB2 (degree = 47) and ADRA1B (degree = 36), strongly affected the adrenergic receptors which affected cardiomyocyte contraction. Concurrently, ZGCD affected myocardial fibrosis-related proteins, such as DPP4 [31]. The members of the collagen family related to myocardial fibrosis were also involved, such as collagen alpha-1(I) chain (COL1A1, degree = 1), collagen alpha-2(I) chain (COL1A2, degree = 1), and collagen alpha-3(I) chain (COL3A1, degree = 1). Furthermore, transforming growth factor-β1 (TGFB1, degree = 2), which is involved in myocardial fibrosis, is affected by ZGCD.

3.4. Examination of PPI Network

The abovementioned 157 common targets were entered into the STRING databank. The network interaction data of target interconnections were generated with a minimum necessary interaction score of >0.4. Each edge stands for the interplay between one protein and another. A greater degree of correlation indicated more lines and the target standing in this network (Figure 3).
Figure 3

(a) The protein–protein interaction (PPI) system; (b): PPI network targets (top 30).

3.5. GO Enrichment Analysis

The GO examination was executed using the Metascape data platform to clarify the mechanism that mediates the ZGCD behaviour in AF. After feeding 157 common targets to the Metascape data platform, cell components, biological process mechanism targets, and molecular functions were shown distinctly. First, the outcomes indicated an amelioration of interaction target genes to 2,365 types of biological process, which mainly regulated the response to circulation. In addition, ZGCD could regulate the response to inorganic substances in the blood, wounding, and oxygen levels. The regulation of ion transport by ZGCD is noteworthy. Additionally, the avascular process in the circulatory system and the apoptotic signaling pathway was identified. Second, the enrichment of 149 cell constituents was focused on different cell membrane edifices, such as tissue raft, plasma membrane protein complex, contractile fibers, perinuclear cytoplasmic region, and integral components of the synaptic membrane. Moreover, the main cell constituents comprised platelet alpha granules, the external aspect of the plasma membrane, troponin complex, extracellular matrix, and the lumen of the endoplasmic reticulum. Third, 186 molecular utility-related procedures, which mainly encompassed protein activity and receptor binding, were shown. Contrary to our expectation, ZGCD could control adrenergic receptor activity, outward rectifier potassium channel activity, cofactor binding, protein homodimerization activity, and kinase binding. On the other hand, receptor regulator activity and tetrapyrrole, protease, protein domain-specific, and troponin T binding were also important mechanisms that were shown (Figure 4).
Figure 4

GO analysis. Natural procedures, cellular constituents, and molecular functions are examples of molecular functions. (a) Barplot BP, (b) Dotplot BP, (c) Barplot CC, (d) Dotplot CC, (e) Barplot MF, and (f) Dotplot MF (p 0.05). BP: biological process; CC: cellular component; MF: molecular function.

3.6. Examination of KEGG Pathway Enhancement

A total of 355 KEGG pathways were identified based on 157 common targets. The 20 most essential pathways were identified using a bar plot plus a dot plot (Figure 5). The relevance of advancement was represented by p in the figure, and the greater the intensity of the color, the greater was the weight of the enhancement. Hypertrophic cardiomyopathy, HIF-1 (hypoxiainducible factor-1) distinguishing pathway, and adrenergic alarm signaling in cardiomyocytes were sorted, and both notable and conspicuously enhanced paths were identified that significantly contributed to the pathogenesis of myocardial fibrosis (Figures 6 and 7). Furthermore, the AGE-RAGE (advanced glycation end products and their receptor) indicative pathway is critical in diabetes, nonalcoholic fatty liver disease, tryptophan metabolism, and other metabolic pathways.
Figure 5

The examination of the KEGG pathway enhancement in AF diagnosed with ZGCD. ZGCD: Zhi-Gan-Cao decoction; AF: atrial fibrillation.

Figure 6

Hypertrophic cardiomyopathy identified by the examination of KEGG pathway enhancement.

Figure 7

Network diagram of the interaction of the ZGCD–KEGG pathway–AF target.

Network Analyzer was thereafter used to show the network diagram. As shown in Figure 8 and Table 5, the top 10 of the 20 KEGG pathways in ZGCD were pathways in cancer (degree = 65), proteoglycans in cancer (degree = 65), malaria (degree = 42), adrenergic alarm signaling in cardiomyocytes (degree = 41), AGE-RAGE gating pathway in diabetes-related complications (degree = 36), oxytocin-indicating path (degree = 35), Alzheimer disease (degree = 31), fluid shear stress and atherosclerosis (degree = 28), Epstein–Barr virus infection (degree = 27), and HIF-1 signaling pathway (degree = 20).
Figure 8

Pathological changes of myocardial fibrosis induced by isoproterenol: (a) paraffinized cardiac tissue slices stained with hematoxylin and eosin (HE, 100x); (b) slices stained with Masson's trichrome (100x). ∗p < 0.05 vs. control, #p < 0.05 vs. model.

Table 5

157 KEGG pathways between ZGCD and AF.

No.DegreeName
165Pathways in cancer
265Proteoglycans in cancer
342Malaria
441Adrenergic signaling in cardiomyocytes
536AGE-RAGE signaling pathway in diabetic complications
635Oxytocin signaling pathway
731Alzheimer disease
828Fluid shear stress and atherosclerosis
927Epstein–Barr virus infection
1020HIF-1 signaling pathway
1120Nonalcoholic fatty liver disease
1219Hypertrophic cardiomyopathy
1314Huntington disease
1412Thyroid cancer
1510Epithelial cell signaling in Helicobacter pylori infection
1610Transcriptional misregulation in cancer
1710Longevity-regulating pathway
188Allograft rejection
198Tryptophan metabolism
207Complement and coagulation cascades

3.7. Pathological Changes of Mouse Myocardial Tissue

Two weeks after the mice were subcutaneously injected with ISO, the fibrous connective tissue in ISO-induced myocardial fibrosis in the model group, compared with the control group, showed significant proliferation, obvious deformation of myocardial cells, and increased collagen deposition, as indicated by the HE and Masson staining. The above-described performance was significantly reduced in the ZGCD group versus the model group (Figure 8).

3.8. QRT-PCT Detects the Expression of COL1A1, COL1A2, COL3A1, and TGF-β1 mRNA

Two weeks after modeling, the model group exhibited evidently elevated COL1A1, COL1A2, COL3A1, and TGF-β1 mRNA expression than the control group. While COL1A1, COL1A2, COL3A1, and TGF-β1 mRNA in the myocardial tissue of ZGCD-intervened mice was markedly reduced versus the model group (Figure 9).
Figure 9

QRT-PCR detects the mRNA expression of genes related to myocardial fibrosis in mice. (a) mRNA expression of COL1A1. (b) mRNA expression of COL1A2. (c) mRNA of COL3A1. (d) mRNA expression of TGF-β1.

3.9. Western Blotting Detects the Expression of COL1A1, COL1A2, COL3A1, and TGF-β1 Protein

Two weeks after modeling, the model group presented notably elevated COL1A1, COL1A2, COL3A1, and TGF-β1 protein expression in the myocardial tissue than the control group. While their protein levels were notably reduced in the myocardial tissue of mice in the ZGCD group versus the model group (Figure 10).
Figure 10

Western blotting was used to detect the expression of myocardial fibrosis protein in mice. (a) Western blotting was used to detect the expression of COL1A1, COL1A2, COL3A1, and TGF-β1 protein. (b) Statistical diagram of Western blotting results. ∗p < 0.05 vs. control, #p < 0.05 vs. model.

4. Discussion

4.1. Effect of ZGCD's Components on AF

136 common compounds in the ZGCD that include quercetin, stigmasterol, luteolin, kaempferol, and beta-sitosterol have good anti-inflammatory effects [32, 33]. Therefore, quercetin, stigmasterol, kaempferol, luteolin, and beta-sitosterol when used as anti-inflammatory drugs may have a good therapeutic effect on AF. Studies have reported that quercetin can modulate overactive AMPK to protect cardiomyocytes from apoptosis [34]. Cardiomyocyte apoptosis is an important factor in the remodeling of the cardiac structure during AF [35, 36]. Similarly, kaempferol, luteolin, and beta-sitosterol have antiapoptotic effects on cardiomyocytes. The fact that berberine benefits the management of AF is worth exploring. Besides, berberine has been clinically confirmed to be beneficial to AF treatment [37]. The existing studies have found that berberine inhibits AF by increasing the suitable refractory time of the atrium and elongating the atrial myocyte action potential duration [38]. Furthermore, berberine can specifically inhibit NOX isomers and directly affect ion channels to interfere with AF [39]. In addition, lysine is an essential component of the ZGCD in the treatment of AF. Studies on lysine have shown that when lysine is oxidised by lysine oxidase, it will cause interconnecting linkages among the lysine residues of lysine-rich proteins. Changes in the expression of lysine oxidase occur in numerous heart diseases and are considered the key aspects that mediate fibrosis in related tissues, including those in AF [40]. However, other studies on lysine and AF have not been reported. PTGS2 and PTGS1 belonging to cyclooxygenase are essential targets of atrial fibrillation. PTGS1 can promote platelet aggregation, and it can inhibit effectively anticoagulant, thereby playing the role of treating atrial fibrillation [41]. PTGS1 can induce the production of PTGS2, and PTGS2 is a critical link in triggering the subsequent inflammatory response. PTGS2 inhibitors have been used clinically. That is, nonsteroidal anti-inflammatory drugs can induce AF when treating related diseases [42]. It shows that ZGCD can interfere with atrial fibrillation by regulating PTGS2 and PTGS1. In summary, among the 136 active ingredients in the ZGCD, the intervention for AF mainly focuses on improving myocardial inflammation, apoptosis, and cardiac ion channels. However, most of the ingredients are currently not studied directly in the treatment of AF.

4.2. Myocardial Fibrosis-Related Protein in AF

Notably, related proteins involved in myocardial fibrosis are essential in AF treatment with ZGCD. These include COL1A1, COL1A2, and COL3A1 in the collagen family, and TGF-β1, which is an essential protein that mediates fibrosis. In the GO KEGG results, TGF-β1 in the cardiac hypertrophy pathway was closely related to AF. The development and manifestation of AF is associated with structural, electrical, and metabolic remodeling, which plays a fundamental part, and the key to the maintenance and recurrence of AF is atrial remodeling [43]. Atrial fibrosis is the primary pathological manifestation and sign of atrial structural remodeling, and the severity of AF increases proportionally with the degree of atrial fibrosis, which tends to become permanent [44]. Myocardial fibrosis will further cause myocardial hypertrophy [45]. Cardiac fibrosis, which is the pathological basis of AF, comprises various injury factors that cause abnormal collagen fiber deposition in the interstitium of cardiomyocytes. However, the pathogenesis of AF-related myocardial fibrosis remains unclear. Therefore, based on the pathogenetic role of myocardial fibrosis in AF, blocking and inhibiting myocardial fibrosis is an essential measure in the clinical treatment of AF. In subsequent experiments in mice, it was observed that ZGCD can significantly improve the degree of fibrosis and collagen deposition in mouse myocardial tissue. From the results of qRT-PCR and Western blotting detection, it can be seen that ZGCD can reduce the expression of COL1A1, COL1A2, and COL3A1 genes and proteins in the fibrotic pathway of mice with myocardial fibrosis. ZGCD has the same effect on TGF-β1 in the cardiac hypertrophy pathway. This is consistent with the results obtained from the network pharmacology analysis. Cardiac fibrosis is a myocardial scarring event featured in increased type I collagen deposition, as well as cardiac fibroblast activation and differentiation into myofibroblasts [46]. The main process involves damage to cardiomyocytes, including apoptosis, autophagy, oxidative stress, and inflammation [47, 48], and to the corresponding slave cardiomyocytes (CMS), endothelial cells, immune cells, macrophages, etc. [49]. During this process, CMS rapidly undergo apoptosis, and endothelial cells regulate the inflammatory response. Furthermore, the proliferating immune cells infiltrate the damaged myocardium to clear away the necrotic tissue and release various growth factors and cytokines like connective tissue growth factor and TGF-β [50, 51]. In response to these cytokines, cardiac fibroblasts are activated and activate extracellular matrix- (ECM-) producing cells in myocardial tissue. The cells producing the myocardial ECM are various myocardial interstitial cells [52-54], which can produce various collagen fibers in myocardial tissue. In the adult myocardium, the main components of myocardial tissue are type I collagen fibers (~85%) and type III collagen fibers (~11%), and the rest collagen fibers have types IV, V, VI, and other fibers [55]. When collagen deposits increase, the ratio and arrangement of various types of collagen will lead to myocardial fibrosis, which induces the release of more inflammatory factors, which further aggravates the process of fibrosis [56]. It can be seen that COL1A1, COL1A2, COL3A1, and TGF-β1, which are involved in stimulating the activation of cardiac fibroblasts, are essential in treating of myocardial fibrosis using ZGCD for AF. However, some limitations still exist in this study. Despite effectual components and quotidian target genes in the ZGCD and AF interactions have been identified through network pharmacology, the target gene has not been further identified to obtain key genes. Besides, the treatment effect of ZGCD on atrial fibrillation has not been fully investigated; was intervening myocardial fibrosis the only therapeutic mechanism for ZGCD on atrial fibrillation? Well-designed in vitro and in vivo experiments are needed in the follow-up study.

5. Conclusions

In conclusion, network pharmacology identified effectual components (81) and quotidian target genes (157) in the ZGCD and AF interactions. According to the PPI system, GO enhancement evaluation, and KEGG track enhancement evaluation, ZGCD may treat AF by lowering the degree of myocardial fibrosis. Finally, experiments in mice further demonstrated the therapeutic effect of ZGCD on myocardial fibrosis. The prospect of this study is to provide new therapeutic options for patients with atrial fibrillation.
  56 in total

1.  Isolation, characterization, and localization of cardiac collagen type VI. Associations with other extracellular matrix components.

Authors:  R I Bashey; A Martinez-Hernandez; S A Jimenez
Journal:  Circ Res       Date:  1992-05       Impact factor: 17.367

Review 2.  [Study of roasted liquorice decoction on arrhythmia].

Authors:  Xian Liu; Lu Jing
Journal:  Zhongguo Zhong Yao Za Zhi       Date:  2007-12

3.  Application of the myocardial tissue/silicon substrate microelectrode array technology on detecting the effection of Zhigancao Decoction medicated serum on cardiac electrophysiology.

Authors:  Juan Sun; Yanmei Lu; Huang Yan; Yujun Guo; Ainiwaer Aikemu
Journal:  Int J Clin Exp Med       Date:  2015-02-15

4.  Effects of luteolin in different doses on the cardiomyocyte apoptosis in rats with myocardial ischemia reperfusion.

Authors:  J P Li; R Yan; P L Ma; P Fu; H T Tian; L L Wang
Journal:  J Biol Regul Homeost Agents       Date:  2020 Nov-Dec       Impact factor: 1.711

Review 5.  Cardiac fibrosis - A short review of causes and therapeutic strategies.

Authors:  Svenja Hinderer; Katja Schenke-Layland
Journal:  Adv Drug Deliv Rev       Date:  2019-05-31       Impact factor: 15.470

6.  Epicatechin protective effects on bleomycin-induced pulmonary oxidative stress and fibrosis in mice.

Authors:  Saeedeh Shariati; Hadi Kalantar; Marzieh Pashmforoosh; Esrafil Mansouri; Mohammad Javad Khodayar
Journal:  Biomed Pharmacother       Date:  2019-03-20       Impact factor: 6.529

Review 7.  Ginkgo biloba extract for essential hypertension: a systemic review.

Authors:  X J Xiong; W Liu; X C Yang; B Feng; Y Q Zhang; S J Li; X K Li; J Wang
Journal:  Phytomedicine       Date:  2014-05-28       Impact factor: 5.340

8.  Temporal Trends in Incidence, Prevalence, and Mortality of Atrial Fibrillation in Primary Care.

Authors:  Deirdre A Lane; Flemming Skjøth; Gregory Y H Lip; Torben B Larsen; Dipak Kotecha
Journal:  J Am Heart Assoc       Date:  2017-04-28       Impact factor: 5.501

9.  The STRING database in 2017: quality-controlled protein-protein association networks, made broadly accessible.

Authors:  Damian Szklarczyk; John H Morris; Helen Cook; Michael Kuhn; Stefan Wyder; Milan Simonovic; Alberto Santos; Nadezhda T Doncheva; Alexander Roth; Peer Bork; Lars J Jensen; Christian von Mering
Journal:  Nucleic Acids Res       Date:  2016-10-18       Impact factor: 16.971

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.