| Literature DB >> 35719722 |
Gunjan Purohit1, Martonio Ponte Viana2, Oleh Khalimonchuk3.
Abstract
Membrane contact sites are recognized as critical means of intercompartmental communication. Here, we describe a protocol for engineering and validating a synthetic bridge between the inner and outer mitochondrial membranes to support functioning of the endogenous mitochondrial contact site and cristae organizing system (MICOS). A chimeric protein, MitoT, is stably expressed in cultured mammalian cells to bridge the mitochondrial membranes. This approach can be a valuable tool to study the function of the MICOS complex and associated proteins. For complete details on the use and execution of this protocol, please refer to Viana et al. (2021).Entities:
Keywords: Biotechnology and bioengineering; Cell Biology; Cell Membrane; Cell culture; Cell isolation; Flow Cytometry/Mass Cytometry; Metabolism; Microscopy; Molecular Biology
Mesh:
Substances:
Year: 2022 PMID: 35719722 PMCID: PMC9204730 DOI: 10.1016/j.xpro.2022.101454
Source DB: PubMed Journal: STAR Protoc ISSN: 2666-1667
Figure 1Design and cloning of MitoT construct
(A) Relevant indicated fragments of the IM-resident SCO1 and OM-residing TOMM20 proteins were amplified individually by overlap extension PCR strategy. In the second round of PCR amplifications, the respective amplicons were used to generate a single recombinant DNA fragment (MitoT) containing indicated portions of SCO1, TOMM20, a hexa-histidine tag, an unstructured linker region (E. coli LacI sequence), and BamH1 and EcoRI restriction sites at the 5′- and 3′-flanking ends, respectively.
(B) The MitoT DNA fragment generated by overlap extension PCR and its host pCDNA3-eGFP vector were digested with BamHI and EcoRI restriction enzymes. The digested fragments were purified and ligated to yield pCDNA3-MitoT-eGFP vector.
(C) The E. coli DH5α competent cells were transformed with the resulting pCDNA3-MitoT-eGFP vector and transformed clones identified by plasmid isolation and restriction digestion. The verified positive clone was further propagated for endotoxin free plasmid isolation and sequence validation.
Figure 2Generation and isolation of MitoT-expressing cells
Mouse embryonic fibroblasts were transfected with pCDNA3-MitoT-eGFP vector, cultured and harvested as explained in the text. Antibiotic-resistant cells were then profiled and processed by FACS. Importantly, FACS profiling revealed two distinct cell populations with low (GFPlo) and high (GFPhi) eGFP expression. Cells from the GFPlo group were confirmed to be the desired cell population and collected for further analyses.
Figure 3Selection of stable MitoT-expressing clones
The selected cells were cultured under antibiotic selective conditions to produce stable clones of the MitoT-eGFP-expressing cells. The surviving clones were preserved and used in subsequent imaging studies.
Figure 4Visualization of MitoT-GFP expression, its colocalization with mitochondria, and ultrastructure analysis
(A) Collected MitoT-eGFP-expressing cells (GFPhi and GFPlo) were treated with MitoTracker Deep Red dye (MTR) and live-imaged by confocal fluorescent microscopy to ensure proper mitochondrial localization of the MitoT-eGFP synthetic protein. Scale bar, 20 μm.
(B) Representative TEM images of OMA1 KO and OMA1 KO_MitoT cells that have been treated with an uncoupler CCCP or left untreated. Induced expression of MitoT in OMA1 KO cells mitigates abnormal mitochondrial cristae morphology that becomes visible upon uncoupling. Scale bar, 0.4 μm. Images adopted from Viana et al. (2021).
Figure 5Isolation of MitoT-GFP expressing mitochondria and alkaline extraction of mitochondrial proteins
(A) Workflow for isolation of MitoT-expressing mitochondria.
(B) Workflow for alkaline sodium carbonate extraction and fractionation of mitochondrial proteins.
(C) Representative immunoblots of MitoT-eGFP and control mitochondrial proteins at indicated pH or without Na2CO3 treatment (-). These experiments demonstrate retention of MitoT-eGFP in the extraction-resistant fractions (P), thereby indicating membrane anchoring of the protein. HSPD1 and NDUFA9 were used as controls for soluble and membrane associated mitochondrial proteins respectively. P = pellet fraction, S = Soluble fraction, T = Total protein (10% of fraction loaded).
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| ATCC | Cat# 68233 | |
| Ampicillin | AMRESCO | Cat# 0339 |
| G-418 | US Biological | Cat# 108321-42-2 |
| QIAquick gel extraction kit | QIAGEN | Cat# 28706 |
| QIAquick spin miniprep kit | QIAGEN | Cat# 27106 |
| Plasmid midi kit | QIAGEN | Cat# 12143 |
| Luria Bertani Agar | Millipore | Cat# MP113002032 |
| Luria Bertani Broth Miller | US Biological | Cat# L1520 |
| Gel/PCR Purification kit | QIAGEN | Cat# 28004 |
| BamHI-HF restriction enzyme | NEB | Cat# R3101S |
| EcoRI-HF restriction enzyme | NEB | Cat# R3136S |
| T4 DNA Ligase enzyme | Thermo Fisher Scientific | Cat# EL0011 |
| 10× T4 DNA Ligase buffer | Thermo Fisher Scientific | Cat# B69 |
| Lipofectamine 3000 reagent | Thermo Fisher Scientific | Cat# L3000015 |
| Hoechst 33342 | Invitrogen | Cat# H3570 |
| MitoTrackerTM DeepRed FM | Thermo Fisher Scientific | Cat# M22426 |
| FluroBrite DMEM medium | Thermo Fisher Scientific | Cat# A1896702 |
| RNase | Thermo Fisher Scientific | Cat# AM9782 |
| DMEM-High Glucose | HyClone | Cat# SH30243.01 |
| FBS | HyClone | Cat# SH30396.03 |
| Pen/Strep Mix | HyClone | Cat# 15070063 |
| PBS (calcium, magnesium free) | HyClone | Cat# SH30256.FS |
| Trypsin-EDTA | HyClone | Cat# SH30236.02 |
| Opti-MEM I medium | Gibco | Cat# 31985070 |
| Phusion Hot Start II High-Fidelity PCR Master Mix | Thermo Fisher Scientific | Cat# F565L |
| Sodium cacodylate trihydrate | Electron Microscopy Sciences | Cat# 12300 |
| Carbonyl cyanide m-chlorophenyl hydrazone (CCCP) | Sigma-Aldrich | Cat# C2759 |
| Glutaraldehyde (50%) | Electron Microscopy Sciences | Cat# 16320 |
| Agarose, low melting temperature | Bio-Rad | Cat# 162-0017 |
| Osmium tetroxide (4%) | Electron Microscopy Sciences | Cat# 19170 |
| Lead citrate trihydrate | Electron Microscopy Sciences | Cat# 17810 |
| Uranyl acetate | Electron Microscopy Sciences | Cat# 22400 |
| Spurr, Low Viscosity Embedding kit | Electron Microscopy Sciences | Cat# 14300 |
| EMS grid 200 mesh, Nickle | Electron Microscopy Sciences | Cat# EMS-200-Ni |
| Double-end molds | Ted Pella | Cat# 10590 |
| Nuclease-free water | Thermo Fisher Scientific | Cat# AM9937 |
| SuperscriptTM IV first-strand synthesis system | Thermo Fisher Scientific | Cat# 18091050 |
| HEPES | Sigma-Aldrich | Cat# 54457 |
| D-Sorbitol | Sigma-Aldrich | Cat# S1876 |
| Sucrose | Sigma-Aldrich | Cat# S0389 |
| Ethylenediaminetetraacetic acid (EDTA) | Sigma-Aldrich | Cat# E9884 |
| Mouse Embryonic Fibroblasts, Wild Type | Gift from C. Lopez-Otin (U. Oviedo), | N/A |
| Mouse Embryonic Fibroblasts, OMA1_KO | Gift from C. Lopez-Otin (U. Oviedo), | N/A |
| Fwd BamHI-SCO1 primer | Eurofins ( | N/A |
| Rev SCO1-LacI primer | Eurofins ( | N/A |
| Fwd LacI TOMM20 primer | Eurofins ( | N/A |
| Rev TOMM20-His-EcoRI primer 5′CAAGAATTCGTGATGGTGATGGTG | Eurofins ( | N/A |
| pcDNA3-eGFP | Addgene | Cat# 13031; RRID: Addgene_13031 |
| ImageJ Software | NIH ( | |
| Microsoft Excel 365 | Microsoft Inc. | |
| FlowJo 10 | FlowJo Inc. | |
| 35 mm No. 1.0 glass bottom dishes | MatTek Corp. | Cat# P35G-1.0-14-C |
| 0.2 μm Filter | Fisherbrand | Cat# 09-720-511 |
| FACSCalibur II | BD Biosciences | N/A |
| Cytek DxP10 flow cytometer | Cytek Biosciences | N/A |
| Nikon A1R-Ti2 confocal microscope system | Nikon Inc. | N/A |
| Countess automated cell counter | Thermo Fisher Scientific | Cat# C10281 |
| Leica UC7 ultramicrotome | Leica microsystems | N/A |
| Hitachi H7500 transmission electron microscope | Hitachi | N/A |
| Vacuum Oven | Thermo Fisher Scientific | Cat# 3618-1CE |
| T100 Thermal cycler | Bio-Rad | N/A |
| Beckman DU-640 UV-Vis spectrophotometer | Beckman | N/A |
LB agar plates containing ampicillin antibiotic
| Reagent | Final concentration | Amount/volume |
|---|---|---|
| Premixed LB Agar powder | 1× | 37 g |
| Ultrapure water | N/A | Adjust to 1 L |
| Ampicillin | 100 μg/mL | 1 mL |
| 1 L |
Antibiotic added LB agar plates can be stored at 4°C for 2–3 weeks.
LB broth containing ampicillin antibiotic
| Reagent | Final concentration | Amount/volume |
|---|---|---|
| Premixed LB broth powder | 1× | 25 g |
| Ultrapure water | N/A | Adjust to 1 L |
| Ampicillin | 100 μg/mL | 1 mL |
| 1 L |
FBS-containing DMEM-high glucose medium
| Reagent | Final concentration | Amount/volume |
|---|---|---|
| DMEM-high glucose media | 1× | 445 mL |
| FBS | 10% | 50 mL |
| P/S antibiotic solution | 1× | 5 mL |
| 500 mL |
MTE buffer
| Reagent | Final concentration | Amount/volume |
|---|---|---|
| 1 M HEPES, pH 7.6 | 20 mM | 2 mL |
| 1 M Sorbitol | 220 mM | 22 mL |
| 1 M Sucrose | 70 mM | 7 mL |
| 0.5 M EDTA | 1 mM | 200 μL |
| 100 mL |
Alkaline sodium bicarbonate solution
| Reagent | Final concentration | Amount/volume |
|---|---|---|
| Sodium bicarbonate (Na2CO3) | 0.1 M | 106 mg |
| Ultrapure water | N/A | Adjust to 100 mL |
| 100 mL |
Adjust to pH 7.5 and 11.5 with 1N NaOH.
TEM wash buffer
| Reagent | Final concentration | Amount/volume |
|---|---|---|
| Sodium cacodylate | 100 mM | 21.4 g |
| Ultrapure water | N/A | Adjust to 1 L |
| 1 L |
Adjust to pH 7.4 with 1N HCl.
2.5% Glutaraldehyde fixing solution
| Reagent | Final concentration | Amount/volume |
|---|---|---|
| Glutaraldehyde (50%) | 2.5% | 0.5 mL |
| TEM wash buffer | 100 mM | 9.5 mL |
| 10 mL |
1% Osmium tetroxide solution
| Reagent | Final concentration | Amount/volume |
|---|---|---|
| Osmium tetroxide (4%) | 1% | 2.5 mL |
| Ultrapure water | N/A | 7.5 mL |
| 10 mL |
Spurr’s epoxy solution
| Reagent | Final concentration | Amount/volume |
|---|---|---|
| Vinyl cyclohexene dioxide (ERL-4221) | 22.3% | 9 mL |
| Diglycidyl ether of polypropylene glycol (D.E.R. 736) | 17.3% | 7 mL |
| Nonenyl succinic anhydride (NSA) | 59.5% | 24 mL |
| N,N-dimethylethanolamine (DMAE) | 0.74% | 0.3 mL |
| Total | 40.3 mL |
1% Uranyl acetate solution
| Reagent | Final concentration | Amount/volume |
|---|---|---|
| Uranyl acetate | 1% | 0.5 g |
| Ultrapure water | N/A | 49.5 mL |
| 50 mL |
1% Lead citrate solution
| Reagent | Final concentration | Amount/volume |
|---|---|---|
| Lead citrate | 1% | 0.1 g |
| Ultrapure water | N/A | Up to 10 mL |
| Add 3 drops of 10 N NaOH. | ||
| 10 mL | ||
| Vector only control reaction | Ligation reaction | |
|---|---|---|
| Digested pcDNA3-eGFP vector | 100 ng | 100 ng |
| Digested MitoT insert | – | 20 ng |
| 10× T4 DNA Ligase Buffer | 2 μL | 2 μL |
| T4 DNA ligase | 1 μL | 1 μL |
| Nuclease Free Water | Adjust volume to 20 μL with ddH2O | Adjust volume to 20 μL with ddH2O |