Literature DB >> 35713402

Cre/lox regulated conditional rescue and inactivation with zebrafish UFlip alleles generated by CRISPR-Cas9 targeted integration.

Fang Liu1, Sekhar Kambakam1, Maira P Almeida1,2, Zhitao Ming1, Jordan M Welker1,2, Wesley A Wierson1,3, Laura E Schultz-Rogers1,2, Stephen C Ekker4, Karl J Clark4, Jeffrey J Essner1,2, Maura McGrail1,2.   

Abstract

The ability to regulate gene activity spatially and temporally is essential to investigate cell-type-specific gene function during development and in postembryonic processes and disease models. The Cre/lox system has been widely used for performing cell and tissue-specific conditional analysis of gene function in zebrafish. However, simple and efficient methods for isolation of stable, Cre/lox regulated zebrafish alleles are lacking. Here, we applied our GeneWeld CRISPR-Cas9 targeted integration strategy to generate floxed alleles that provide robust conditional inactivation and rescue. A universal targeting vector, UFlip, with sites for cloning short homology arms flanking a floxed 2A-mRFP gene trap, was integrated into an intron in rbbp4 and rb1. rbbp4off and rb1off integration alleles resulted in strong mRFP expression,>99% reduction of endogenous gene expression, and recapitulated known indel loss-of-function phenotypes. Introduction of Cre led to stable inversion of the floxed cassette, loss of mRFP expression, and phenotypic rescue. rbbp4on and rb1on integration alleles did not cause phenotypes in combination with a loss-of-function mutation. Addition of Cre led to conditional inactivation by stable inversion of the cassette, gene trapping and mRFP expression, and the expected mutant phenotype. Neural progenitor Cre drivers were used for conditional inactivation and phenotypic rescue to showcase how this approach can be used in specific cell populations. Together these results validate a simplified approach for efficient isolation of Cre/lox-responsive conditional alleles in zebrafish. Our strategy provides a new toolkit for generating genetic mosaics and represents a significant advance in zebrafish genetics.
© 2022, Liu, Kambakam, Almeida et al.

Entities:  

Keywords:  CRISPR-Cas9; Cre/lox; GeneWeld; conditional rescue and inactivation; developmental biology; genetics; genomics; precision targeted integration; zebrafish

Mesh:

Substances:

Year:  2022        PMID: 35713402      PMCID: PMC9270027          DOI: 10.7554/eLife.71478

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.713


Introduction

The ability to regulate gene activity spatially and temporally is essential to investigate cell-type-specific gene function during development and in postembryonic processes and disease models. Conditional gene inactivation can be achieved with the Cre/lox system in which the bacteriophage Cre recombinase promotes site-specific recombination at compatible loxP sites engineered in a gene of interest (Sauer and Henderson, 1988). Effective application of Cre/lox in vertebrates requires the isolation of transgenic lines expressing Cre, and gene modification to introduce loxP sequences at desired locations. Homologous recombination driven site-directed genetic modification in embryonic stem cells enabled creation of the mouse Cre/lox resource that contains more than 2500 Cre drivers and lox conditional gene alleles (Bult et al., 2019). In zebrafish, the lack of embryonic stem cell technology and inefficient homologous recombination in the early embryo necessitated alternative approaches to generate Cre/lox tools (Carney and Mosimann, 2018). Tol2 transposon transgenesis (Balciunas et al., 2006; Kawakami et al., 2000) combined with defined promoters (Mosimann et al., 2011) or BAC recombineering (Förster et al., 2017) has been used to develop Cre lines, and a rich source of zebrafish cell-type-specific Cre drivers has been generated by random Tol2 transposon enhancer trap screens (Jungke et al., 2015; Marquart et al., 2015; Tabor et al., 2019; Zhong et al., 2019). Cre/lox regulated conditional control of gene function in zebrafish was previously limited to generation of knock out alleles by random Tol2 transposon insertional mutagenesis with a floxed/FRT gene trap, which can be reverted by Cre or Flip-mediated recombination (Clark et al., 2011; Ni et al., 2012; Trinh et al., 2011). Only recently have gene editing methods been developed in zebrafish to simplify Cre driver isolation (Almeida et al., 2021; Kesavan et al., 2018) and generate genuine lox-regulated conditional alleles by targeted integration (Burg et al., 2018; Han et al., 2021; Hoshijima et al., 2016; Li et al., 2019; Sugimoto et al., 2017). These advances in zebrafish Cre/lox genetics are being driven by rapidly evolving methods for homology directed gene editing using CRISPR-Cas9 and TALEN endonucleases. We and others recently demonstrated CRISPR-Cas9 targeted integration is an efficient method to isolate zebrafish proneural specific Cre and CreERT2 drivers that are expressed under the control of endogenous gene regulatory elements (Almeida et al., 2021; Kesavan et al., 2018). Efforts to introduce loxP sequences directly into the zebrafish genome by somatic gene targeting was first described using TALENs to target a double-strand break in the cdrh2 gene, followed by repair from a DNA oligonucleotide template containing homologous sequences flanking a loxP site (Bedell et al., 2012). This approach was expanded upon using CRISPR-Cas9 to create a floxed allele in two zebrafish genes by sequential loxP oligonucleotide targeting at sites flanking an exon, and demonstrated robust gene knockdown and loss of function after Cre-mediated exon excision (Burg et al., 2018). Although this approach is effective for creating a Cre/lox regulated allele, a single integration event of a floxed cassette with a linked reporter has distinct advantages, including only one generation of targeting and fluorescent genotyping of the integration allele. The first example of a germline floxed conditional allele with linked reporter used a single TALEN site downstream of an exon (Hoshijima et al., 2016). The repair template consisted of a linear cassette containing 1 kb long homology arms flanking a floxed exon plus reporter, to replace the endogenous exon by homologous recombination. A similar strategy using long homology arms was used to isolate a zebrafish conditional shha allele by integration of a modified Flex invertible gene trap (Ni et al., 2012), called Zwitch, by homologous recombination from an intact plasmid (Sugimoto et al., 2017). Stable inversion of the Zwitch cassette by Cre led to effective shha gene knockdown and defective shha signaling. More recently homology-independent targeting strategies have been described to generate conditional knockouts with a linked reporter, or bidirectional knockin of a dual reporter gene trap cassette, providing a method for labeling conditional gene knockout cells (Han et al., 2021; Li et al., 2019). As an alternative to isolation of stable germline conditional alleles, rapid tissue-specific gene knockdown and cell labeling can be achieved by somatic targeting with a floxed Cas9-2A-GFP; U6:gRNA transposon in a Cre-specific transgenic background, allowing for simultaneous bi-allelic inactivation with GFP cell labeling (Hans et al., 2021). Together, these approaches provide effective conditional gene knockdown strategies with varying degrees of complexity in design and execution. However, there is still a need for a simple method to efficiently recover robust conditional alleles through a single gene engineering event. To address this need for a simple method to recover zebrafish germline conditional alleles in a single generation, we applied our GeneWeld CRISPR-Cas9 knock in strategy (Welker et al., 2021; Wierson et al., 2020) to target integration of a highly mutagenic floxed gene trap into an intron in two genes. We previously showed our GeneWeld strategy simplifies targeting vector assembly and enhances the efficiency of on target integration (Almeida et al., 2021; Wierson et al., 2020). In the present study, we built a universal vector, UFlip, which is derived from the GeneWeld pGTag and pPRISM targeted integration vectors (Almeida et al., 2021; Wierson et al., 2020), and the Tol2 Gene Breaking Transposon vectors (Clark et al., 2011; Ichino et al., 2020). The GeneWeld vectors contain sites for cloning short homology arms flanking a cargo of interest, and universal gRNA sites for efficient CRISPR-Cas9 cutting in vivo. In the UFlip vector, homology arm cloning sites flank a floxed gene trap cassette that contains a 2A-mRFP primary reporter based on the Tol2 RP2 gene trap (Clark et al., 2011; Ichino et al., 2020). The cassette also contains a heart or lens BFP secondary reporter for transgenic identification. Using 48 bp flanking short homology arms to drive integration at unique intron target gRNA sites, we recovered precise UFlip integration alleles in rbbp4 and rb1 with frequencies of 4–14%. We demonstrate that each molecular component in the floxed UFlip cassette functions as expected in vivo. Integration alleles with UFlip in the active, gene ‘off’ orientation show mRFP expression from the gene trap in the expected gene-specific pattern. UFlip ‘off’ alleles lead to >99% knock down of gene expression compared to wild-type levels and recapitulate indel mutant phenotypes, demonstrating highly effective loss of function by primary transcript splicing into the gene trap. Recombination of an ‘off’ allele by Cre injection or a transgenic Cre source leads loss of RFP expression, stable inversion of the UFlip cassette to the passive orientation, and robust conditional rescue of mutant phenotypes. UFlip ‘on’ alleles are phenotypically normal in combination with loss-of-function mutations. Recombination of an ‘on’ allele by Cre injection or a transgenic Cre source leads to induction of RFP expression, stable cassette inversion, and robust conditional inactivation. These results demonstrate GeneWeld UFlip CRISPR targeted integration is an effective approach to generate zebrafish Cre/lox conditional alleles that can be used for cell type-specific genetic mosaic analysis. The ability to perform conditional inactivation as well as conditional rescue provides a significant advance in zebrafish genetics.

Results

UFlip, a universal vector to generate stable Cre/lox regulated conditional alleles by CRISPR-Cas9 targeted integration

The Universal Flip (UFlip) vector was designed to be used with the GeneWeld strategy for CRISPR-Cas9 targeted integration driven by short homology (Wierson et al., 2020). The vector contains a cassette with a floxed gene trap plus secondary marker flanked by cloning sites for homology arms (HA) complementary to the genomic CRISPR target site, and universal gRNA sites (UgRNA) for in vivo liberation of the cassette after injection into zebrafish embryos (Figure 1A). The gene trap was derived from the gene-breaking Tol2 transposon RP2 that has previously been shown to lead to >99% knockdown of gene expression (Clark et al., 2011; Ichino et al., 2020). RP2 was modified by insertion of the porcine teschvirus-1 2A peptide sequence in between the splice acceptor and mRFP, which enables expression of a primary fluorescent reporter from the gene trap without creating a fusion protein. The ocean pout antifreeze gene transcriptional terminator follows the mRFP cDNA. Like our recently published endogenous Cre driver lines (Almeida et al., 2021), the primary gene trap reporter is followed by a secondary marker that drives tissue-specific expression of blue fluorescent protein (BFP) from the Xenopus gamma crystallin 1 (gcry1) lens promoter or the zebrafish myosin light chain 7 (myl7) cardiac muscle promoter, simplifying identification of an integration allele. Alternating pairs of loxP and lox2272 sites oriented head to head flanking the cassette are designed to drive two Cre recombination events that invert and lock the cassette in place, a design strategy described previously to generate floxed conditional alleles in mice (Robles-Oteiza et al., 2015; Schnütgen et al., 2003) and zebrafish (Sugimoto et al., 2017). rox sites flanking the entire cassette provide an alternative method for inversion using Dre recombinase (Figure 1A), which we demonstrate below provides highly efficient recovery of inverted alleles through the germline. Integration of UFlip into an intron in the active, gene ‘off’ orientation is expected to lead to premature transcriptional termination of the primary transcript in the gene trap and splicing of upstream exons into 2A-mRFP (Figure 1B), resulting in a loss-of-function allele. In contrast, integration of UFlip into an intron in the passive, gene ‘on’ orientation is not predicted to interrupt endogenous gene expression, since RNA polymerase will read through the cassette in the intron, which is then spliced out of the mature transcript (Figure 1C). For clarity, the UFlip alleles described here are referred to as ‘off’ when the cassette was integrated in the active, gene trap orientation. Alleles are designated ‘on’ when UFlip was integrated in the passive orientation, that leads to removal of the UFlip cassette during splicing and allows proper functioning of the gene.
Figure 1.

The UFlip floxed gene trap vector for isolation of conditional gene alleles generated by GeneWeld CRISPR-Cas9 targeted integration.

(A) Diagram of the UFlip. The vector contains a floxed rox loxP lox2272 gene trap plus secondary marker loxP lox2272 rox cassette. The cassette is flanked by cloning sites for homology arms (HA) complementary to a genomic CRISPR target site, and universal gRNA sites (UgRNA) for in vivo liberation of the targeting cassette. (B) Gene ‘off’ alleles are generated by integration of the UFlip cassette into an intron in the active orientation, leading to transcription termination and splicing of the primary transcript in the mRFP gene trap. (C) Gene ‘on” alleles are generated by integration of the UFlip cassette into an intron in the passive orientation. This is driven by cloning the genomic 5’ homology arm downstream of the UFlip cassette, and cloning the genomic 3’ homology arm upstream of the UFlip cassette. Integration at the genomic CRISPR-Cas9 target site occurs in the opposite orientation. During transcription RNA polymerase reads through the integrated UFlip cassette, which is spliced out with the intron during processing of the primary transcript. (D) Cre-mediated recombination at an ‘off’ allele locks the cassette in the ‘on’ orientation. The first recombination occurs stochastically at either lox2272 or loxP sites. The diagram shows the intermediate that forms if the first recombination occurs at the lox2272 sites. (E) Cre-mediated recombination at an ‘on’ allele locks the cassette in the ‘off’ orientation. The first recombination occurs stochastically at either lox2272 or loxP sites. The diagram shows the intermediate that forms if the first recombination occurs at the lox2272 sites. BFP, blue fluorescent protein; gcry1, gamma crystallin 1 promoter; myl7, cardiac myosin light chain 7 promoter; 2 A, porcine teschvirus-1 2A peptide; mRFP, monomeric red fluorescent protein; pA, transcription termination and polyadenylation signal; SA, splice acceptor.

The UFlip floxed gene trap vector for isolation of conditional gene alleles generated by GeneWeld CRISPR-Cas9 targeted integration.

(A) Diagram of the UFlip. The vector contains a floxed rox loxP lox2272 gene trap plus secondary marker loxP lox2272 rox cassette. The cassette is flanked by cloning sites for homology arms (HA) complementary to a genomic CRISPR target site, and universal gRNA sites (UgRNA) for in vivo liberation of the targeting cassette. (B) Gene ‘off’ alleles are generated by integration of the UFlip cassette into an intron in the active orientation, leading to transcription termination and splicing of the primary transcript in the mRFP gene trap. (C) Gene ‘on” alleles are generated by integration of the UFlip cassette into an intron in the passive orientation. This is driven by cloning the genomic 5’ homology arm downstream of the UFlip cassette, and cloning the genomic 3’ homology arm upstream of the UFlip cassette. Integration at the genomic CRISPR-Cas9 target site occurs in the opposite orientation. During transcription RNA polymerase reads through the integrated UFlip cassette, which is spliced out with the intron during processing of the primary transcript. (D) Cre-mediated recombination at an ‘off’ allele locks the cassette in the ‘on’ orientation. The first recombination occurs stochastically at either lox2272 or loxP sites. The diagram shows the intermediate that forms if the first recombination occurs at the lox2272 sites. (E) Cre-mediated recombination at an ‘on’ allele locks the cassette in the ‘off’ orientation. The first recombination occurs stochastically at either lox2272 or loxP sites. The diagram shows the intermediate that forms if the first recombination occurs at the lox2272 sites. BFP, blue fluorescent protein; gcry1, gamma crystallin 1 promoter; myl7, cardiac myosin light chain 7 promoter; 2 A, porcine teschvirus-1 2A peptide; mRFP, monomeric red fluorescent protein; pA, transcription termination and polyadenylation signal; SA, splice acceptor. The process by which Cre recombination leads to stable inversion of the UFlip cassette is illustrated in Figure 1D, E (Schnütgen et al., 2003). Introduction of Cre leads to stochastic recombination at either the loxP or the lox2272 pairs of recombinase sites. Figure 1D, E show the intermediate results after 1 recombination event at the lox2272 sites. In the intermediate the cassette has inverted from ‘off’ to ‘on’ (Figure 1D) or from ‘on’ to ‘off’ (Figure 1E), resulting in a pair of loxP sites flanking one of the lox2272 sites. Recombination at the head to tail oriented loxP sites removes the intervening lox2272, resulting in a cassette flanked by a single pair of incompatible loxP and lox2272 sites. This prevents further recombination and produces stable inversion of the cassette.

Isolation of rbbp4 and rb1 UFlip conditional alleles

To test the ability of the UFlip cassette to generate zebrafish Cre-responsive conditional alleles, we chose to target integration of UFlip two genes, retinoblastoma binding protein 4 (rbbp4) and retinoblastoma 1 (rb1). We had previously isolated indel mutations in both genes that show strong loss-of-function phenotypes at the morphological and cellular level (Schultz et al., 2018; Schultz-Rogers et al., 2022; Solin et al., 2015). Intronic genomic DNA was amplified from wild-type WIK fish, cloned, sequenced, and analyzed to locate unique Cas9 gRNA sites that were shared among fish and that did not map to repetitive elements or retrotransposons. Cas9 target sites were identified in rbbp4 intron 4 and rb1 intron 6 (Table 1) and synthetic guides ordered from Synthego (https://www.synthego.com). Efficient indel formation at the intronic gRNA sites was confirmed by co-injection of gRNA and Cas9 mRNA into single-cell embryos, followed by extraction of genomic DNA at 2 dpf. A PCR amplicon surrounding the target site was directly sequenced followed by ICE analysis (https://ice.synthego.com/#/). The rbbp4 intron 4 and rb1 intron 6 guides showed 50% and 95% indel formation at the target site, respectively (Figure 2A, B). UFlip targeting vectors were assembled with 48 bp 5’ and 3’ homology arms complementary to the DNA flanking the Cas9 genomic DNA double strand break site (Table 1). One cell stage WIK embryos were co-injected with targeting vector (10 pg), Cas9 mRNA (150 pg), universal gRNA (25 pg), and gene-specific gRNA (25 pg). Four to six embryos with positive expression of the primary mRFP reporter and secondary BFP reporter were selected to test for evidence of on target integration by PCR amplification of the 5’ and 3’ junctions (data not shown). Primary and secondary reporter positive siblings were raised to adulthood. rbbp4 intron 4 was targeted with the UFlip-2A-mRFP cassette in the active orientation to recover an ‘off’ allele. Embryos expressing the primary reporter mRFP in the nervous system, where rbbp4 is normally expressed, and the lens:BFP secondary marker, were raised to adulthood. Two out of seven adult F0 fish transmitted embryos with widespread mRFP and lens BFP expression (Table 2; Table 2—source data 1). One adult transmitted an allele with precise 5’ and 3’ junctions at the intron target site. F1 embryos were raised to adulthood and the presence of the precise rbbp4-2A-mRFP-off, gcry1:BFP (rbbp4) allele confirmed by fin clip and sequencing (Figure 2C). An F1 adult with the precise integration allele was outcrossed to WIK to establish an F2 family of the rbbp4 allele.
Table 1.

Genome intronic CRISPR gRNA sites and UFlip targeting vector homology arm sequences.

GeneGenomic sgRNA with PAM5' Homology arm3' Homology arm
rbbp4 GTTGAAGGATTAAGAGTTAAGGG AAAATCTGCTAGCTGTATATTGTTCTTATTTGAT GAAGAAGACCCTTA ACTCTTAATCCTTCAACTTCGTTGCAAAAAAGTCA GTTGTGTAAAGGT
rb1 ATTAGAAGAGAGTCCCAATGGGG CCTTGATTACAGTTTCTGCTTTTGTGAG TGTACTGTAGTTTGCCCTAA TCTTCTCTCAGGGTTACATGTTTAATGGATAGTGTGT CCATGTTGTCA
Figure 2.

rbbp4 and rb1 intronic gRNA efficiency and F1 UFlip allele junction analysis.

(A) rbbp4 gene model with sequence of the intron 4 reverse strand gRNA. Gel image of PCR amplicons surrounding the target site from 8 Cas9 plus gRNA injected and 1 uninjected (U) embryo. Amplicons from embryo #3 and the uninjected embryo were sequenced and analyzed with Synthego’s ICE software, and indicate 50% indel efficiency at the target site. Plot shows the range and percentage of indels present in the sequences. PAM sequence shown in bold and underlined. (B) rb1 gene model with sequence of the intron 6 reverse strand gRNA. Gel image of PCR amplicons surrounding the target site from eight embryos injected with Cas9 and the gRNA (1-8), and two uninjected embryos (U). Amplicons from embryo #1 and an uninjected embryo were sequenced and analyzed with Synthego’s ICE software, and indicate 95% indel efficiency at the target site. Plots show the range and percentage of indels present in the sequences. PAM sequences shown in bold and underlined. (C) 5’ and 3’ genomic-UFlip integration junctions were PCR amplified from F1 transgenic zebrafish fin clip genomic DNA. The PCR products were sequenced and aligned to the reference sequence expected for a precise integration at the genomic target site. Capitalized red nucleotides represent 48 bp homology arms. Lowercase green nucleotides represent random inserted sequences.

Table 2.

Recovery of rbbp4 and rb1 UFlip floxed conditional alleles by GeneWeld CRISPR-Cas9 targeted integration.

UFlip alleleTargeted IntronHomology arm length bp/bpInjected F0 embryo secondary marker expressionGermline transmission of secondary markerGermline transmission of precise integration allele
rbbp4off is61 448/4819% (26/134)29% (2/7)14% (1/7)
rb1off is58 648/4847% (34/73)9% (3/33)6% (2/33)
rb1off is63 648/4848% (60/125)25% (2/8)12.5% (1/8)
rb1on is57 648/4843% (61/101)20% (5/25)4% (1/25)

rbbp4 and rb1 intronic gRNA efficiency and F1 UFlip allele junction analysis.

(A) rbbp4 gene model with sequence of the intron 4 reverse strand gRNA. Gel image of PCR amplicons surrounding the target site from 8 Cas9 plus gRNA injected and 1 uninjected (U) embryo. Amplicons from embryo #3 and the uninjected embryo were sequenced and analyzed with Synthego’s ICE software, and indicate 50% indel efficiency at the target site. Plot shows the range and percentage of indels present in the sequences. PAM sequence shown in bold and underlined. (B) rb1 gene model with sequence of the intron 6 reverse strand gRNA. Gel image of PCR amplicons surrounding the target site from eight embryos injected with Cas9 and the gRNA (1-8), and two uninjected embryos (U). Amplicons from embryo #1 and an uninjected embryo were sequenced and analyzed with Synthego’s ICE software, and indicate 95% indel efficiency at the target site. Plots show the range and percentage of indels present in the sequences. PAM sequences shown in bold and underlined. (C) 5’ and 3’ genomic-UFlip integration junctions were PCR amplified from F1 transgenic zebrafish fin clip genomic DNA. The PCR products were sequenced and aligned to the reference sequence expected for a precise integration at the genomic target site. Capitalized red nucleotides represent 48 bp homology arms. Lowercase green nucleotides represent random inserted sequences.

Recovery of rbbp4 and rb1 UFlip floxed conditional alleles by GeneWeld CRISPR-Cas9 targeted integration.

We initially targeted rb1 intron 6 with the original UFlip-mRFP primary reporter construct designed to create an in-frame fusion of the polypeptide with mRFP. We recovered rb1-mRFP-off, gcry1:BFP (rb1) and rb1-mRFP-on, gcry1:BFP (rb1) alleles with frequencies of 6% (2/33) for rb1 and 4% (1/25) for rb1 (Table 2; Table 2—source data 1). 5’ and 3’ junction PCR and sequence analysis of F1 embryos showed the integrations were precise, except for the 5’ junction in the allele transmitted by the second rb1 founder #26 (Figure 2C). The 5’ junction included a duplication of the 5’ Homology Arm sequence that flanked a 115 bp segment of the vector backbone. The rb1 founder #18 transmitting the precise allele was lost, therefore we moved forward with the allele from founder #26. As shown below, the 153 bp insertion on the 5’ side of the rb1 integration did not appear to affect the functionality of the allele. F1 adults were outcrossed to wildtype WIK to establish rb1 and rb1 families. We subsequently targeted the same rb1 intron six site with the updated UFlip-2A-mRFP vector, which allows expression of mRFP without creating a fusion protein with the targeted gene polypeptide. We recovered 2/8 (12.5%) founders transmitting lens:BFP +alleles with ubiquitous expression of the mRFP primary reporter (Table 2; Table 2—source data 1). Founder F0#14 transmitted two alleles, one with precise junctions, the other with a precise 3’ junction and a 5’ junction with a homology arm duplication and insertion of 19 bp (Figure 2C). F1s from this founder will be used to establish the line rb1. For the experiments outlined below demonstrating Cre-meditated rb1 conditional rescue and inactivation, we used the established F3 generation rb1 and rb1 lines generated with the original UFlip construct, which did not show the mRFP gene trap reporter expression. The UFlip construct contains rox sites flanking the entire cassette to allow the use of Dre recombination to recover an allele of the opposite orientation when starting with the rbbp4 allele (Figure 3A). To test this, we injected Dre synthetic mRNA into F1 and F2 rbbp4 embryos. Injected embryos were raised to adulthood and five F1 and six F2 adults were outcrossed to wildtype WIK. Embryos were screened for expression of the primary mRFP reporter and the linked BFP secondary marker. Three of 5 F1 adults, and 4/6 F2 adults, transmitted both the mRFP/BFP positive original ‘off’ allele to their progeny, as well as the mRFP negative/BFP positive Dre-inverted ‘on’ allele (Table 3). The frequency of embryos inheriting the inverted allele vs. the original allele ranged from 7.7% to 43.2% (Table 3). We confirmed the rbbp4 allele recovered by Dre recombination contained the expected 5’ and 3’ junctions by PCR amplification and sequencing (Figure 3B, C). A single F2 adult was used to establish an F3 family of the rbbp4 allele. These results demonstrate efficient Dre mediated recombination at rox sites in the germline, and a simple method for isolation of an alternative conditional allele starting with one UFlip allele.
Figure 3.

Dre mRNA injection into rbbp4/+ embryos leads to inversion of the UFlip cassette and efficient germline recovery of an inverted rbbp4 allele.

(A) Diagram illustrating Dre-mediated inversion of the rbbp4 allele to the on orientation. Repeated inversion of the cassette will continue as long as Dre is present. The final allele is predicted to be in the inverted ‘on’ orientation at a frequency of 50%. (B) PCR junction analysis of 8 embryos from an F1 adult that had been injected with Dre mRNA at the one-cell stage. Three embryos positive for expression of the lens BFP secondary marker show the expected 5’ and 3’ junction PCR amplicons for the inverted rbbp4 allele. (C) Sequence analysis confirms Dre-mediated inversion of the cassette from the ‘off’ to ‘on’ orientation in BRP+/RFP - embryos.

Table 3.

Germline recovery of rbbp4 allele by Dre-mediated inversion of rbbp4.

Adult rbbp4off/+BFP-/RFP- embryosBFP+/RFP + embryos (Off) original alleleBFP+/RFP- embryos (On) inverted allele% transmission of On inverted allele/total BFP+
F1 Female #1483700
F1 Female #276621115% (11/73)
F1 Female #32516524% (5/21)
F1 Female #42013213% (2/15)
F1 Female #5191200
F2 Female #1182427.7% (2/26)
F2 Female #250251943.2% (19/44)
F2 Female #3364049.1% (4/44)
F2 Female #4221400
F2 Male #1139871413.9% (14/101)
F2 Male #2372800

Experimental group 1: F1 embryos from the F0 founder rbbp4/+ adult crossed to WIK were injected with 15 pg Dre mRNA. Inversion was confirmed by PCR on genomic DNA isolated from -injected embryos . 5 sibling injected embryos were raised to adulthood and were outcrossed to WIK. F2 embryos were screened for Primary (RFP+) and Secondary (BFP+) marker expression. Embryos inheriting the original rbbp4 allele show expression of both markers. Embryos inheriting an allele that was inverted from “off” to “on” by Dre recombination show expression of the secondary marker (BFP+) but lose expression of the primary marker due to the inverted orientation of the cassette. Experimental group 2: The same experiment was performed with an adult F1 rbbp4/+ female crossed to WIK. F2 Dre mRNA injected embryos were raised to adulthood, and 7 adults screened for transmission of the inverted rbbp4 allele to the F3 generation.

Dre mRNA injection into rbbp4/+ embryos leads to inversion of the UFlip cassette and efficient germline recovery of an inverted rbbp4 allele.

(A) Diagram illustrating Dre-mediated inversion of the rbbp4 allele to the on orientation. Repeated inversion of the cassette will continue as long as Dre is present. The final allele is predicted to be in the inverted ‘on’ orientation at a frequency of 50%. (B) PCR junction analysis of 8 embryos from an F1 adult that had been injected with Dre mRNA at the one-cell stage. Three embryos positive for expression of the lens BFP secondary marker show the expected 5’ and 3’ junction PCR amplicons for the inverted rbbp4 allele. (C) Sequence analysis confirms Dre-mediated inversion of the cassette from the ‘off’ to ‘on’ orientation in BRP+/RFP - embryos. Experimental group 1: F1 embryos from the F0 founder rbbp4/+ adult crossed to WIK were injected with 15 pg Dre mRNA. Inversion was confirmed by PCR on genomic DNA isolated from -injected embryos . 5 sibling injected embryos were raised to adulthood and were outcrossed to WIK. F2 embryos were screened for Primary (RFP+) and Secondary (BFP+) marker expression. Embryos inheriting the original rbbp4 allele show expression of both markers. Embryos inheriting an allele that was inverted from “off” to “on” by Dre recombination show expression of the secondary marker (BFP+) but lose expression of the primary marker due to the inverted orientation of the cassette. Experimental group 2: The same experiment was performed with an adult F1 rbbp4/+ female crossed to WIK. F2 Dre mRNA injected embryos were raised to adulthood, and 7 adults screened for transmission of the inverted rbbp4 allele to the F3 generation.

rbbp4 allele provides robust gene knockdown and loss of function

To demonstrate that integration of the UFlip cassette in the active, ‘off’ orientation leads to effective gene knockdown we examined gene expression by quantitative PCR in rbbp4 homozygotes. Homozygous rbbp4 3 dpf larvae show a>99% reduction in rbbp4 mRNA levels in comparison to wild type sibling larvae (Figure 4A, B; Figure 4—source data 1). In comparison to wild-type larvae, the rbbp4 allele is easily identifiable by primary reporter gene trap RFP expression in the retina, brain, and mesodermal tissues, and secondary marker lens specific BFP expression (Figure 4C, D arrowhead). In trans-heterozygous combination with the established loss-of-function indel allele rbbp4 (Figure 4D, E), the rbbp4 allele recapitulates the microcephaly and microphthalmia phenotypes found in rbbp4 homozygotes (Schultz et al., 2018; Schultz-Rogers et al., 2022). In comparison to control, anti-activated caspase 3 labeling and quantification in sectioned rbbp4 2 dpf head tissue reveals extensive apoptosis throughout the midbrain (** p<0.01) and retina (** p<0.01) (Figure 4F, G). This cellular phenotype is not significantly different from our previous description of apoptosis in rbbp4 homozygotes (Figure 4F–H). Together these results demonstrate the rbbp4 allele causes robust gene knockdown by the primary reporter RFP gene trap, induces the expected pattern of RFP expression, and recapitulates the rbbp4 strong loss of phenotype at the molecular, cellular, and morphological levels.
Figure 4.

Molecular and phenotypic characterization of rbbp4 and rbbp4 alleles.

(A) Diagram of the rbbp4 allele. (B) Plot of RT-qPCR results from wild type +/+ (n=3), heterozygous rbbp4(n=3), and homozygous rbbp4 (n=3) larvae showing the relative level of rbbp4 mRNA transcript using reference gene rps6kb1b. Primer pairs were located in exons 4 and 5, or downstream exons 11 and 12. (C – E) Gross phenotype of rbbp4 (C), rbbp4 (D), and rbbp4 (E) 5 dpf larvae. Arrowhead in (D) points to overlap of rbbp4 primary reporter and gcry1:BFP secondary reporter expression in the lens, which appears purple. (F – H) Caspase-3 and HuC/D labeling of sectioned head tissue from 2 dpf rbbp4 (F) rbbp4 (G) and rbbp4 (H) embryos. (I) Diagram of the rbbp4 allele. (J) Plot of RT-qPCR results from wild type +/+ (n=3), heterozygous rbbp4 (n=3), and homozygous rbbp4 (n=3) larvae showing the relative level of rbbp4 mRNA transcript using reference gene rps6kb1b. Primer pairs were located in exons 4 and 5, or downstream exons 11 and 12. (K, L) Gross phenotype of rbbp4 (K) and rbbp4 (L) 5 dpf larvae. The rbbp4 allele secondary marker gcry1:BFP expression is visible in the lens. Caspase-3 and HuC/D labeling of sectioned head tissue from 2 dpf rbbp4 (M) and rbbp4 (N) embryos. OT, optic tectum; R, retina; Th, thalamic region. Error bars represent mean ± s.e.m. Scale bars: 200 μm (C–E, K, L), 50 μm (F–H, M,N).

Plot of quantification of caspase-3a labeled cells in rbbp4 (n=3), rbbp4 (n=4), and rbbp4 (n=4). rbbp4 vs. rbbp4 midbrain (** p<0.01) and retina (** p<0.01). rbbp4 vs. rbbp4 midbrain (n.s. p=0.6865) and retina (n.s. p=0.6778). Error bars represent mean ± s.e.m. with two-tailed t-test.

Molecular and phenotypic characterization of rbbp4 and rbbp4 alleles.

(A) Diagram of the rbbp4 allele. (B) Plot of RT-qPCR results from wild type +/+ (n=3), heterozygous rbbp4(n=3), and homozygous rbbp4 (n=3) larvae showing the relative level of rbbp4 mRNA transcript using reference gene rps6kb1b. Primer pairs were located in exons 4 and 5, or downstream exons 11 and 12. (C – E) Gross phenotype of rbbp4 (C), rbbp4 (D), and rbbp4 (E) 5 dpf larvae. Arrowhead in (D) points to overlap of rbbp4 primary reporter and gcry1:BFP secondary reporter expression in the lens, which appears purple. (F – H) Caspase-3 and HuC/D labeling of sectioned head tissue from 2 dpf rbbp4 (F) rbbp4 (G) and rbbp4 (H) embryos. (I) Diagram of the rbbp4 allele. (J) Plot of RT-qPCR results from wild type +/+ (n=3), heterozygous rbbp4 (n=3), and homozygous rbbp4 (n=3) larvae showing the relative level of rbbp4 mRNA transcript using reference gene rps6kb1b. Primer pairs were located in exons 4 and 5, or downstream exons 11 and 12. (K, L) Gross phenotype of rbbp4 (K) and rbbp4 (L) 5 dpf larvae. The rbbp4 allele secondary marker gcry1:BFP expression is visible in the lens. Caspase-3 and HuC/D labeling of sectioned head tissue from 2 dpf rbbp4 (M) and rbbp4 (N) embryos. OT, optic tectum; R, retina; Th, thalamic region. Error bars represent mean ± s.e.m. Scale bars: 200 μm (C–E, K, L), 50 μm (F–H, M,N).

Quantification of activated caspase-3a labeled cells in rbbp4, rbbp4, and rbbp4 2 dpf embryo midbrain and retina.

Plot of quantification of caspase-3a labeled cells in rbbp4 (n=3), rbbp4 (n=4), and rbbp4 (n=4). rbbp4 vs. rbbp4 midbrain (** p<0.01) and retina (** p<0.01). rbbp4 vs. rbbp4 midbrain (n.s. p=0.6865) and retina (n.s. p=0.6778). Error bars represent mean ± s.e.m. with two-tailed t-test.

rbbp4 allele maintains rbbp4 function

In the rbbp4 allele, the UFlip cassette is predicted to be read through by RNA polymerase and then removed from the primary transcript when intron 4 is spliced out (Figure 4I). To test whether the rbbp4 allele alters normal rbbp4 mRNA expression levels RT-qPCR was performed on 3 dpf rbbp4 heterozygous and rbbp4 homozygous larvae. rbbp4 heterozygotes showed ~25% reduction in wild-type rbbp4 mRNA levels, while rbbp4 homozygotes showed ~40% reduction (Figure 4J, Figure 4—source data 1). This suggests the integrated UFlip cassette may impact splicing rate, stability, or other processing of the primary transcript. However, neither rbbp4 heterozygotes nor rbbp4 trans-heterozygous show a gross phenotype in 5 dpf larvae (Figure 4K and L) or evidence of apoptosis in the developing midbrain and retina at 2 dpf (Figure 4M and N). Therefore, the level of processed, mature rbbp4 transcript is enough to maintain wild type levels of rbbp4 activity.

Cre/lox recombination of rbbp4 leads to stable inversion and conditional gene rescue

To test the ability of the UFlip cassette to undergo stable inversion and provide conditional rescue, we first used Cre mRNA injection. A total of 12.5 pg Cre synthetic mRNA was injected into embryos from a cross between rbbp4 and rbbp4 heterozygous adults (Figure 5A–G). In comparison to uninjected rbbp4 larvae (Figure 5B), 5 dpf rbbp4 injected larvae show normal morphology and an absence of RFP expression (Figure 5C). Confocal live imaging of 2 dpf in injected rbbp4 confirmed loss of RFP and rescue of the cell death phenotype in the retina (Figure 5—figure supplement 1A–L). Stable inversion of the rbbp4 cassette to the ‘on’ orientation was confirmed by PCR and sequence analysis, which showed the expected sequences at the 5’ and 3’ junctions after inversion at the lox sites (Figure 5—figure supplement 1M–P). Activated caspase 3 labeling in 2 dpf sectioned head tissue showed a nearly complete absence of apoptosis in the midbrain (** p<0.01) and retina (**** p<0.0001) compared to controls (Figure 5D–F, Figure 5—source data 1). Genomic DNA quantitative PCR of the original 5’ and 3’ rbbp4 allele junction fragments in the Cre injected embryos indicated a 93% reduction (Figure 5G, Figure 5—source data 1). Together these data demonstrate Cre mediated recombination at the incompatible pairs of loxP and lox2272 sites in the rbbp4 allele leads to efficient, stable inversion of the cassette to the ‘on’ orientation, which results in robust conditional rescue of the rbbp4 loss-of-function phenotype.
Figure 5.

Ubiquitous and cell-type specific Cre-mediated conditional rescue with rbbp4-off.

(A) Diagram of expected Cre mediated inversion of rbbp4 to on orientation. (B) Gross morphological phenotype of microcephaly and microphthalmia in 5 dpf transheterozygous rbbp4larva. (C) Cre injected 5 dpf transheterozygous rbbp4larva shows rescue of gross phenotype and loss of mRFP expression. (D) Activated caspase-3a labeling throughout midbrain and retina section from 2 dpf transheterozygous rbbp4embryo. (E) Absence of activated caspase-3a labeling in midbrain and retina of 2 dpf transheterozygous rbbp4embryo after Cre injection. (F) Quantification of caspase-3a labeling in control rbbp4(n=3) and Cre injected rbbp4 (n=3) midbrain (** p<0.01) and retina (**** p<0.0001). (G) Genomic DNA qPCR quantification of rbbp4 original orientation 5’ and 3 junctions in control rbbp4 (n=3) and Cre injected rbbp4 (n=3). Cre injection reduced the level of rbbp4 original orientation 5’ (>93%) and 3’ junctions (>93%). (H – J”) Activated caspase-3A and Cre labeling in sectioned head tissue from 2 dpf rbbp4 (H-H"), ascl1b-2A-Cre; rbbp4 (I-I"), and neurod1-2A-Cre; rbbp4 (J-J") embryos. (K) Quantification of caspase-3a labeling in rbbp4(n=3), ascl1b-2A-Cre; rbbp4 (n=3) and neurod1-2A-Cre; rbbp4 (n=3).rbbp4vs. ascl1b-2A-Cre; rbbp4 midbrain (n.s. p=0.3248) and retina (n.s. p=0.8153), and neurod1-2A-Cre; rbbp4 midbrain (n.s. p=0.7794) and retina (n.s. p=0.9365). OT, optic tectum; R, retina; Th, thalamic region. Error bars represent mean ± s.e.m. with two-tailed t-test. Scale bars: 200 μm (B, C), 50 μm (D, E, H – J). 10 μm (H’ – J”).

(A – D) Gross morphology and mRFP expression in uninjected rbbp4 (A) and rbbp4 (B), and Cre injected rbbp4 (C) and rbbp4 (D) 5 dpf larva. Confocal live images of mRPF expression and transmitted light in 2 dpf retina from uninjected rbbp4 (E, I), uninjected rbbp4 (F, J), Cre injected rbbp4 (G, K) and rbbp4 (H, L). (M, N) 5’ and 3’ junctions of the inverted allele detected by genomic DNA PCR. (O) PCR amplicon genotyping of the rbbp4 exon 2 4 bp deletion allele. (P) Sequence of the 5’ and 3 junction amplicons confirms rbbp4 stable inversion to the on orientation by Cre. Scale bar: 200 μm (A - D). 20 μm (E - L).

(A) Genomic DNA qPCR quantification of rbbp4 original orientation 5’ and 3 junctions in control rbbp4 (n=3) and in ascl1b-2A-Cre; rbbp4(n=3). (B) Genomic DNA qPCR quantification of rbbp4 original orientation 5’ and 3 junctions in control rbbp4 (n=3) and in neurod1-2A-Cre; rbbp4(n=3). Error bars represent mean ± s.e.m.

Figure 5—figure supplement 1.

Live imaging and molecular analysis of rbbp4 conditional rescue by Cre injection.

(A – D) Gross morphology and mRFP expression in uninjected rbbp4 (A) and rbbp4 (B), and Cre injected rbbp4 (C) and rbbp4 (D) 5 dpf larva. Confocal live images of mRPF expression and transmitted light in 2 dpf retina from uninjected rbbp4 (E, I), uninjected rbbp4 (F, J), Cre injected rbbp4 (G, K) and rbbp4 (H, L). (M, N) 5’ and 3’ junctions of the inverted allele detected by genomic DNA PCR. (O) PCR amplicon genotyping of the rbbp4 exon 2 4 bp deletion allele. (P) Sequence of the 5’ and 3 junction amplicons confirms rbbp4 stable inversion to the on orientation by Cre. Scale bar: 200 μm (A - D). 20 μm (E - L).

Ubiquitous and cell-type specific Cre-mediated conditional rescue with rbbp4-off.

(A) Diagram of expected Cre mediated inversion of rbbp4 to on orientation. (B) Gross morphological phenotype of microcephaly and microphthalmia in 5 dpf transheterozygous rbbp4larva. (C) Cre injected 5 dpf transheterozygous rbbp4larva shows rescue of gross phenotype and loss of mRFP expression. (D) Activated caspase-3a labeling throughout midbrain and retina section from 2 dpf transheterozygous rbbp4embryo. (E) Absence of activated caspase-3a labeling in midbrain and retina of 2 dpf transheterozygous rbbp4embryo after Cre injection. (F) Quantification of caspase-3a labeling in control rbbp4(n=3) and Cre injected rbbp4 (n=3) midbrain (** p<0.01) and retina (**** p<0.0001). (G) Genomic DNA qPCR quantification of rbbp4 original orientation 5’ and 3 junctions in control rbbp4 (n=3) and Cre injected rbbp4 (n=3). Cre injection reduced the level of rbbp4 original orientation 5’ (>93%) and 3’ junctions (>93%). (H – J”) Activated caspase-3A and Cre labeling in sectioned head tissue from 2 dpf rbbp4 (H-H"), ascl1b-2A-Cre; rbbp4 (I-I"), and neurod1-2A-Cre; rbbp4 (J-J") embryos. (K) Quantification of caspase-3a labeling in rbbp4(n=3), ascl1b-2A-Cre; rbbp4 (n=3) and neurod1-2A-Cre; rbbp4 (n=3).rbbp4vs. ascl1b-2A-Cre; rbbp4 midbrain (n.s. p=0.3248) and retina (n.s. p=0.8153), and neurod1-2A-Cre; rbbp4 midbrain (n.s. p=0.7794) and retina (n.s. p=0.9365). OT, optic tectum; R, retina; Th, thalamic region. Error bars represent mean ± s.e.m. with two-tailed t-test. Scale bars: 200 μm (B, C), 50 μm (D, E, H – J). 10 μm (H’ – J”).

Live imaging and molecular analysis of rbbp4 conditional rescue by Cre injection.

(A – D) Gross morphology and mRFP expression in uninjected rbbp4 (A) and rbbp4 (B), and Cre injected rbbp4 (C) and rbbp4 (D) 5 dpf larva. Confocal live images of mRPF expression and transmitted light in 2 dpf retina from uninjected rbbp4 (E, I), uninjected rbbp4 (F, J), Cre injected rbbp4 (G, K) and rbbp4 (H, L). (M, N) 5’ and 3’ junctions of the inverted allele detected by genomic DNA PCR. (O) PCR amplicon genotyping of the rbbp4 exon 2 4 bp deletion allele. (P) Sequence of the 5’ and 3 junction amplicons confirms rbbp4 stable inversion to the on orientation by Cre. Scale bar: 200 μm (A - D). 20 μm (E - L).

qPCR quantification of rbbp4 allele inversion by ascl1b-2A-Cre and neurod1-2A-Cre.

(A) Genomic DNA qPCR quantification of rbbp4 original orientation 5’ and 3 junctions in control rbbp4 (n=3) and in ascl1b-2A-Cre; rbbp4(n=3). (B) Genomic DNA qPCR quantification of rbbp4 original orientation 5’ and 3 junctions in control rbbp4 (n=3) and in neurod1-2A-Cre; rbbp4(n=3). Error bars represent mean ± s.e.m. To test whether cell type-specific Cre sources could be used to rescue rbbp4 activity in distinct cell populations (Figure 5H–K), we used our previously published endogenous proneural Cre driver lines ascl1b-2A-Cre, gcry1:GFP and neurod1-2A-Cre, gcry1:GFP (Almeida et al., 2021). 2 dpf larvae from rbbp4 crossed with ascl1b-2A-Cre/+; rbbp4 were sectioned and head tissue labeled to detect activated caspase 3. In comparison to control rbbp4 embryos, ascl1b-2A-Cre; rbbp4 embryos appeared to have reduced caspase labeling in the midbrain, where Cre is expressed (Figure 5H–I’), but the change was not significant (n.s. p=0.3248) (Figure 5K; Figure 5—source data 1). ascl1b isn’t expressed in the retina and consistent with this, Cre labeling was not detected in this tissue (Figure 5I”). As expected, there was no significant change in caspase labeling or levels in retinal sections from ascl1b-2A-Cre; rbbp4 embryos (n.s. p=0.8152) (Figure 5I" and K). To confirm expression of functional Cre recombinase and inversion of the cassette by ascl1b-2A-Cre, 5’ and 3’ junction genomic DNA qPCR showed >30% inversion of the cassette (Figure 5—figure supplement 2; Figure 5—figure supplement 2—source data 1). Testing for conditional rescue with the neurod1-2A-Cre driver showed there was no significant rescue of apoptosis in the brain (n.s. p=0.7794) and retina (n.s. p=0.9365) where neurod1-2A-Cre is expressed (Figure 5J, K; Figure 5—source data 1). 5’ and 3’ junction genomic DNA qPCR confirmed 30% inversion of the rbbp4 allele to the ‘on’ orientation (Figure 5—figure supplement 2; Figure 5—figure supplement 2—source data 1). Together, these results demonstrate a ubiquitous source of Cre can robustly rescue the loss-of-function phenotype of the rbbp4 allele. ascl1b-2A-Cre led to a modest rescue in the developing midbrain, possibly due to expression of ascl1b in a subset of proneural progenitors in this tissue. The complete absence of rescue by neurod1-2A-Cre indicates rbbp4 isn’t required for survival in this progenitor population. These interpretations are supported by the results of conditional gene inactivation experiments with the rbbp4 allele described below. rbbp4 cell-type-specific inactivation with ascl1b-2A-Cre leads to the expected apoptotic mutant phenotype in the midbrain, whereas inactivation with neurod1-2A-Cre did not result in apoptosis in either the midbrain or retina (Figure 6).
Figure 5—figure supplement 2.

qPCR quantification of rbbp4 allele inversion by ascl1b-2A-Cre and neurod1-2A-Cre.

(A) Genomic DNA qPCR quantification of rbbp4 original orientation 5’ and 3 junctions in control rbbp4 (n=3) and in ascl1b-2A-Cre; rbbp4(n=3). (B) Genomic DNA qPCR quantification of rbbp4 original orientation 5’ and 3 junctions in control rbbp4 (n=3) and in neurod1-2A-Cre; rbbp4(n=3). Error bars represent mean ± s.e.m.

Figure 6.

Ubiquitous and cell-type specific Cre-mediated conditional inactivation with rbbp4-on.

(A) Diagram of expected Cre-mediated inversion of rbbp4 to “off” orientation. (B) Normal morphological phenotype in 5 dpf transheterozygous rbbp4larva. (C) Induction of microcephaly and microphthalmia and mRFP expression in Cre injected 5 dpf transheterozygous rbbp4larva. (D) Absence of activated caspase-3a labeling in sectioned tissue from 2 dpf uninjected transheterozygous rbbp4embryo. (E) Activated caspase-3a labeling in the midbrain and retina of 2 dpf transheterozygous rbbp4embryo after Cre injection. (F) Quantification of caspase-3a labeling in control rbbp4(n=3) and Cre-injected rbbp4(n=3) midbrain (* p<0.05) and retina (* p<0.05). (G) Genomic DNA qPCR quantification of rbbp4 original orientation 5’ and 3 junctions in control rbbp4 (n=3) and Cre injected rbbp4 (n=3). (H – K”) Activated caspase-3a and Cre labeling in sectioned head tissue from 2 dpf ascl1b-2A-Cre; rbbp4 (H-H"), ascl1b-2A-Cre; rbbp4 (I-I"), neurod1-2A-Cre; rbbp4 (J-J"), and neurod1-2A-Cre; rbbp4 (K-K"), embryos. Green arrowheads, activated caspase-3a-positive cells. White arrowheads, hypercondensed and fragmented nuclei. (L) Quantification of caspase-3a labeling in ascl1b-2A-Cre; rbbp4 (n=4) and ascl1b-2A-Cre; rbbp4 (n=6) midbrain (** p<0.01) and retina (n.s. p=0.8543). (M) Quantification of caspase-3a labeling in neurod1-2A-Cre; rbbp4 (n=3) and neurod1-2A-Cre; rbbp4 (n=3) midbrain (n.s. p=0.3739) and retina (n.s. p=0.6433). OT, optic tectum; R, retina; Th, thalamic region. Error bars represent mean ± s.e.m. with two-tailed t-test. Scale bars: 200 μm (B, C), 50 μm (D, E, H – K). 10 μm (H’ – K”).

(A – D) Gross morphology and mRFP expression in uninjected rbbp4 (A) and rbbp4 (B), and Cre injected rbbp4 (C) and rbbp4 (D) 5 dpf larva. Confocal live images of mRPF expression and transmitted light in 2 dpf retina from uninjected rbbp4 (E, I), uninjected rbbp4 (F, J), Cre injected rbbp4 (G, K) and rbbp4 (H, L). (M, N) 5’ and 3’ junctions of the inverted allele detected by genomic DNA PCR. (O) PCR amplicon genotyping of the rbbp4 exon 2 4 bp deletion allele. (P) Sequence of the 5’ and 3 junction amplicons confirms rbbp4 stable inversion to the ‘off’ orientation by Cre.

Bright field and mRFP fluorescence images of rbbp4 (A, A’), ascl1b-2A-Cre; rbbp4 (B, B’), and neurod1-2A-Cre; rbbp4 (C, C’). White arrowheads point to blue lens expression from the rbbp4 allele and lens GFP expression from the 2A-Cre drivers. (D) Genomic DNA qPCR quantification of rbbp4 original orientation 5’ and 3 junctions in control rbbp4 (n=3) and ascl1b-2A-Cre; rbbp4 (n=3). (E) Genomic DNA qPCR quantification of rbbp4 original orientation 5’ and 3 junctions in control rbbp4 (n=3) and neurod1-2A-Cre; rbbp4 (n=3). Error bars represent mean ± s.e.m. Scale bars: 200 μm.

Ubiquitous and cell-type specific Cre-mediated conditional inactivation with rbbp4-on.

(A) Diagram of expected Cre-mediated inversion of rbbp4 to “off” orientation. (B) Normal morphological phenotype in 5 dpf transheterozygous rbbp4larva. (C) Induction of microcephaly and microphthalmia and mRFP expression in Cre injected 5 dpf transheterozygous rbbp4larva. (D) Absence of activated caspase-3a labeling in sectioned tissue from 2 dpf uninjected transheterozygous rbbp4embryo. (E) Activated caspase-3a labeling in the midbrain and retina of 2 dpf transheterozygous rbbp4embryo after Cre injection. (F) Quantification of caspase-3a labeling in control rbbp4(n=3) and Cre-injected rbbp4(n=3) midbrain (* p<0.05) and retina (* p<0.05). (G) Genomic DNA qPCR quantification of rbbp4 original orientation 5’ and 3 junctions in control rbbp4 (n=3) and Cre injected rbbp4 (n=3). (H – K”) Activated caspase-3a and Cre labeling in sectioned head tissue from 2 dpf ascl1b-2A-Cre; rbbp4 (H-H"), ascl1b-2A-Cre; rbbp4 (I-I"), neurod1-2A-Cre; rbbp4 (J-J"), and neurod1-2A-Cre; rbbp4 (K-K"), embryos. Green arrowheads, activated caspase-3a-positive cells. White arrowheads, hypercondensed and fragmented nuclei. (L) Quantification of caspase-3a labeling in ascl1b-2A-Cre; rbbp4 (n=4) and ascl1b-2A-Cre; rbbp4 (n=6) midbrain (** p<0.01) and retina (n.s. p=0.8543). (M) Quantification of caspase-3a labeling in neurod1-2A-Cre; rbbp4 (n=3) and neurod1-2A-Cre; rbbp4 (n=3) midbrain (n.s. p=0.3739) and retina (n.s. p=0.6433). OT, optic tectum; R, retina; Th, thalamic region. Error bars represent mean ± s.e.m. with two-tailed t-test. Scale bars: 200 μm (B, C), 50 μm (D, E, H – K). 10 μm (H’ – K”).

Live imaging and molecular analysis of rbbp4 conditional inactivation by Cre injection.

(A – D) Gross morphology and mRFP expression in uninjected rbbp4 (A) and rbbp4 (B), and Cre injected rbbp4 (C) and rbbp4 (D) 5 dpf larva. Confocal live images of mRPF expression and transmitted light in 2 dpf retina from uninjected rbbp4 (E, I), uninjected rbbp4 (F, J), Cre injected rbbp4 (G, K) and rbbp4 (H, L). (M, N) 5’ and 3’ junctions of the inverted allele detected by genomic DNA PCR. (O) PCR amplicon genotyping of the rbbp4 exon 2 4 bp deletion allele. (P) Sequence of the 5’ and 3 junction amplicons confirms rbbp4 stable inversion to the ‘off’ orientation by Cre.

Induction of primary reporter RFP expression and qPCR quantification of rbbp4 allele inversion by ascl1b-2A-Cre and neurod1-2A-Cre.

Bright field and mRFP fluorescence images of rbbp4 (A, A’), ascl1b-2A-Cre; rbbp4 (B, B’), and neurod1-2A-Cre; rbbp4 (C, C’). White arrowheads point to blue lens expression from the rbbp4 allele and lens GFP expression from the 2A-Cre drivers. (D) Genomic DNA qPCR quantification of rbbp4 original orientation 5’ and 3 junctions in control rbbp4 (n=3) and ascl1b-2A-Cre; rbbp4 (n=3). (E) Genomic DNA qPCR quantification of rbbp4 original orientation 5’ and 3 junctions in control rbbp4 (n=3) and neurod1-2A-Cre; rbbp4 (n=3). Error bars represent mean ± s.e.m. Scale bars: 200 μm.

Cre/lox recombination of rbbp4 leads to efficient conditional gene inactivation and recapitulates morphological and cellular loss-of-function phenotypes

To assess whether Cre recombination of the rbbp4 allele to the ‘off’ orientation would lead to conditional inactivation and induction of expression of the gene trap mRFP, we first used 12.5 pg Cre mRNA injection into embryos from a cross between rbbp4 and rbbp4 heterozygous adults (Figure 6). In comparison to uninjected rbbp4 larvae which appear morphologically normal (Figure 6B), 5 dpf rbbp4 mRNA-injected larvae display the rbbp4 microcephaly and microphthalmia loss-of-function phenotype, and induction of RFP expression (Figure 6C). Sectioned tissue from 2 dpf embryos showed a significant increase in activated caspase 3 labeling throughout the midbrain (* p<0.05) and retina (* p<0.05) (Figure 6D–F; Figure 6—source data 1), consistent with the rbbp4 mutant apoptotic cellular phenotype. Confocal live imaging in 2 dpf control and injected rbbp4 embryos confirmed induction of the gene trap RFP expression and cell death in the retina (Figure 6—figure supplement 1A–L). PCR junction analysis and sequencing (Figure 6—figure supplement 1M–P), and genomic DNA qPCR analysis of 5’ and 3’ junctions (Figure 6G; Figure 6—source data 1) confirmed robust stable inversion of the rbbp4 allele to the ‘off’ orientation (82%–84% efficiency) correlated with induction of the rbbp4 loss-of-function phenotype.
Figure 6—figure supplement 1.

Live imaging and molecular analysis of rbbp4 conditional inactivation by Cre injection.

(A – D) Gross morphology and mRFP expression in uninjected rbbp4 (A) and rbbp4 (B), and Cre injected rbbp4 (C) and rbbp4 (D) 5 dpf larva. Confocal live images of mRPF expression and transmitted light in 2 dpf retina from uninjected rbbp4 (E, I), uninjected rbbp4 (F, J), Cre injected rbbp4 (G, K) and rbbp4 (H, L). (M, N) 5’ and 3’ junctions of the inverted allele detected by genomic DNA PCR. (O) PCR amplicon genotyping of the rbbp4 exon 2 4 bp deletion allele. (P) Sequence of the 5’ and 3 junction amplicons confirms rbbp4 stable inversion to the ‘off’ orientation by Cre.

Proneural Cre/lox rbbp4 conditional inactivation reveals cell-type-specific requirement for rbbp4 in ascl1b progenitor survival

We conducted the same experimental approach as described above using the endogenous proneural Cre driver lines ascl1b-2A-Cre, gcry1:GFP and neurod1-2A-Cre, gcry1:GFP , but in combination with the rbbp4 allele to test for cell-type-specific conditional inactivation (Figure 6H–M). Embryos from rbbp4 + crossed with ascl1b-2A-Cre/+; rbbp4 adults were examined for induction of gene trap RFP expression and assessed for Cre-mediated allele inversion by 5’ and 3’ junction genomic qPCR (Figure 6—figure supplement 2; Figure 6—figure supplement 2—source data 1). Three dpf ascl1b-2A-Cre/+; rbbp4 larvae show RFP expression throughout the brain and neural tube and a 20% inversion rate (Figure 6—figure supplement 2 B, B’, D). Although the larvae appeared morphologically normal, compared to controls the sectioned tissue from 2 dpf embryos showed a significant increase in activated caspase 3 labeling in the midbrain tectum and dorsal thalamic region (** p<0.01) (Figure 6H–I and L; Figure 6—source data 1). Activated caspase 3 labeling was not detected in the retina (n.s. p=0.08543), consistent with the lack of retinal expression of ascl1b and Cre (Figure 6H”–I” and L). Conditional inactivation of rbbp4 with neurod1-2A-Cre also lead to induction of RFP expression in both the brain and the retina, albeit at lower levels, and 20% cassette inversion efficiency (Figure 6—figure supplement 2 C, C’, E; Figure 6—figure supplement 2—source data 1), However, in contrast to conditional inactivation with ascl1b-2A-Cre, inactivation with neurod1-2A-Cre did not lead to significantly different levels of caspase 3 labeling in the 2 dpf brain (n.s. p=0.3739) or retina (n.s. p=0.6434) compared to controls (Figure 6J–K, M; Figure 6—source data 1). These results suggest Cre-mediated conditional inactivation of rbbp4 in the ascl1b neural progenitor population leads to apoptosis. Although rbbp4 is expressed in the neurod1 population as shown by induction of RFP, the absence of apoptosis indicates rbbp4 may not be required for survival in committed progenitors or newborn neurons. These results support two critical conclusions: First, conditional inactivation of rbbp4 with ubiquitous Cre leads to efficient stable inversion of the cassette from ‘on’ to ‘off’, and replicates the rbbp4 loss-of-function phenotype. Second, rbbp4 can be inactivated in a cell-type-specific manner that reveals a potential cell-specific function for rbbp4 in ascl1b-neural progenitor cell survival.
Figure 6—figure supplement 2.

Induction of primary reporter RFP expression and qPCR quantification of rbbp4 allele inversion by ascl1b-2A-Cre and neurod1-2A-Cre.

Bright field and mRFP fluorescence images of rbbp4 (A, A’), ascl1b-2A-Cre; rbbp4 (B, B’), and neurod1-2A-Cre; rbbp4 (C, C’). White arrowheads point to blue lens expression from the rbbp4 allele and lens GFP expression from the 2A-Cre drivers. (D) Genomic DNA qPCR quantification of rbbp4 original orientation 5’ and 3 junctions in control rbbp4 (n=3) and ascl1b-2A-Cre; rbbp4 (n=3). (E) Genomic DNA qPCR quantification of rbbp4 original orientation 5’ and 3 junctions in control rbbp4 (n=3) and neurod1-2A-Cre; rbbp4 (n=3). Error bars represent mean ± s.e.m. Scale bars: 200 μm.

rb1 allele provides robust gene knockdown and loss of function

To validate the UFlip approach for generating conditional alleles at a second locus, we characterized the activity of the rb1 and rb1 alleles (Figure 7). RT-qPCR of homozygous rb1 3 dpf larvae with primers spanning rb1 exons 6–8 showed >99% knockdown of rb1 mRNA levels in comparison to wild-type sibling larvae (Figure 7A, B; Figure 7—source data 1). To simplify identification of trans heterozygous rb1 mutant larvae, we isolated an rb1 exon 2 CRISPR integration allele, rb1-stop-myl7:GFP (rb1-stop) using a targeting vector design similar to our recently published method to isolate endogenous Cre lines in proneural genes (Almeida et al., 2021). The stop-myl:GFP cassette contains three translation termination codons, in each of the three reading frames, followed by a transcription terminator plus a myl7:GFP secondary marker (Figure 7—figure supplement 1A, B). The rb1 allele is larval lethal in combination with the rb1 indel mutation and homozygous rb1 5 dpf larvae show the same level of increased numbers of pH3 labeled cells throughout the midbrain (n.s. p=0.2951) and retina (n.s. P=0.1534) (Figure 7—figure supplement 1C; Figure 7—figure supplement 1—source data 1) as rb1/ homozygotes (Schultz et al., 2018). Trans-heterozygous rb1 larvae from a cross between rb1 and rb1 heterozygotes are easily distinguished from siblings by the expression of lens BFP by the rb1 allele (Figure 7D arrowhead) and heart GFP by the rb1 allele (Figure 7D asterisk). rb1 5 dpf larvae appear morphologically normal compared to wild type, with the exception of the lack of a swim bladder (Figure 7C, D), similar to rb1/ larvae (Figure 7E). In contrast to wild type (Figure 7F), 5 dpf sectioned head tissue shows pH3-labeled cells throughout the rb1 midbrain (*** p<0.001) and retina (**** p<0.0001), like rb1/ trans-heterozygotes (Figure 7F–H; Figure 7—figure supplement 2A; Figure 7—source data 1) and rb1 and rb1/ homozygotes (Figure 7—figure supplement 1C). Together these results demonstrate the rb1 allele provides robust gene knockdown and recapitulates the zebrafish rb1 loss-of-function morphological and cellular phenotypes.
Figure 7.

Molecular and phenotypic characterization of rb1 and rb1 alleles.

(A) Diagram of the rb1 allele. (B) Plot of RT-qPCR results from wild type +/+ (n=3), heterozygous rb1 (n=3), and homozygous rb1 (n=3) larvae showing the relative level of rb1 mRNA transcript using reference gene rps6kb1b. Primer pairs were located in exons 6 and 8, or downstream exons 23 and 24. (C – E) Gross phenotype of wildtype +/+ (C), rb1 (D), and rb1 (E) 5 dpf larvae. Arrowhead in D points to rb1 allele gcry1:BFP secondary reporter expression in lens. Asterisk marks the rb1 allele mly7:GFP secondary reporter expression in heart. (F – H) pH3 and HuC/D labeling of sectioned head tissue from 5 dpf +/+ (F), rb1 (G), and rb1 (H). (I) Diagram of the rb1 allele. (J) Plot of RT-qPCR results from wild type +/+ (n=3), heterozygous rb1 (n=3), and homozygous rb1 (n=3) larvae showing the relative level of rb1 mRNA transcript using reference gene rps6kb1b. Primer pairs were located in exons 6 and 8, or downstream exons 23 and 24. (K, L) Gross phenotype of wildtype +/+ (K), heterozygous rb1 (L) and transheterozygous rb1 (M) 5 dpf larvae. Arrowhead in L, M points to rb1 allele gcry1:BFP secondary reporter expression in lens. Asterisk in M marks the rb1 allele mly7:GFP secondary reporter expression in heart. pH3 and HuC/D labeling of sectioned head tissue from 5 dpf +/+ (N), heterozygous rb1 (O) and transheterozygous rb1 (P).OT, optic tectum; R, retina; Th, thalamic region. Error bars represent mean ± s.e.m. Scale bars: 200 μm (C–E, K–M), 50 μm (F–H, N–P).

(A) Diagram of rb1 gene model with exon 2 gRNA, the stop-PRISM-myl7:GFP targeting vector, and the resulting rb1-stop-myl7:GFP allele after GeneWeld CRISPR-Cas9 targeted integration. (B) F1 adult rb1-stop 5’ and 3’ junction analysis shows precise integration of the stop-PRISM cassette at the exon 2 target site. (C) Immunolocalization and quantification of pH3-labeled cells in control +/+ (n=3), rb1 (n=3), rb1 (n=3), and rb1/ (n=3) 5 dpf sectioned head tissue in the midbrain optic tectum and thalamic region (top row) and retina (bottom row) in both rb1 and rb1/ homozygotes. rb1 vs. +/+midbrain (**** p<0.0001) and retina (**** p<0.0001), rb1 vs. rb1/ midbrain (n.s. p=0.2951) and retina (n.s. p=0.1534). Th, thalamic region; OT, optic tectum; R, retina. Error bars represent mean ± s.e.m. with two-tailed t-test. Scale bars: 50 μm.

(A) Quantification of pH3 labeled cells in 5 dpf wild type +/+ (n=3), transheterozygous rb1 (n=3), and transheterozygous rb1/ (n=3) larvae. rb1 larvae show a significant difference in pH3 levels from wildtype in the midbrain (*** p<0.001) and retina (**** p<0.0001). Associated with Figure 5 panels F, G, H. (B) Quantification of pH3-labeled cells in 5 dpf wild type +/+ (n=3), heterozygous rb1(n=3), and transheterozygous rb1 (n=3) larvae. rb1 larvae show a significant difference in pH3 levels from wildtype in the midbrain (** p<0.01) and retina (** p<0.01). Error bars represent mean ± s.e.m. with two-tailed t-test. Associated with Figure 5 panels N, O, P.

Figure 7—figure supplement 1.

The rb1-stop integration allele recapitulates the rb1Δ7 indel loss-of-function phenotype.

(A) Diagram of rb1 gene model with exon 2 gRNA, the stop-PRISM-myl7:GFP targeting vector, and the resulting rb1-stop-myl7:GFP allele after GeneWeld CRISPR-Cas9 targeted integration. (B) F1 adult rb1-stop 5’ and 3’ junction analysis shows precise integration of the stop-PRISM cassette at the exon 2 target site. (C) Immunolocalization and quantification of pH3-labeled cells in control +/+ (n=3), rb1 (n=3), rb1 (n=3), and rb1/ (n=3) 5 dpf sectioned head tissue in the midbrain optic tectum and thalamic region (top row) and retina (bottom row) in both rb1 and rb1/ homozygotes. rb1 vs. +/+midbrain (**** p<0.0001) and retina (**** p<0.0001), rb1 vs. rb1/ midbrain (n.s. p=0.2951) and retina (n.s. p=0.1534). Th, thalamic region; OT, optic tectum; R, retina. Error bars represent mean ± s.e.m. with two-tailed t-test. Scale bars: 50 μm.

Figure 7—figure supplement 2.

Quantification of pH3 labeled cells in rb1stop, rb1/, and rb1 mutant larvae.

(A) Quantification of pH3 labeled cells in 5 dpf wild type +/+ (n=3), transheterozygous rb1 (n=3), and transheterozygous rb1/ (n=3) larvae. rb1 larvae show a significant difference in pH3 levels from wildtype in the midbrain (*** p<0.001) and retina (**** p<0.0001). Associated with Figure 5 panels F, G, H. (B) Quantification of pH3-labeled cells in 5 dpf wild type +/+ (n=3), heterozygous rb1(n=3), and transheterozygous rb1 (n=3) larvae. rb1 larvae show a significant difference in pH3 levels from wildtype in the midbrain (** p<0.01) and retina (** p<0.01). Error bars represent mean ± s.e.m. with two-tailed t-test. Associated with Figure 5 panels N, O, P.

Molecular and phenotypic characterization of rb1 and rb1 alleles.

(A) Diagram of the rb1 allele. (B) Plot of RT-qPCR results from wild type +/+ (n=3), heterozygous rb1 (n=3), and homozygous rb1 (n=3) larvae showing the relative level of rb1 mRNA transcript using reference gene rps6kb1b. Primer pairs were located in exons 6 and 8, or downstream exons 23 and 24. (C – E) Gross phenotype of wildtype +/+ (C), rb1 (D), and rb1 (E) 5 dpf larvae. Arrowhead in D points to rb1 allele gcry1:BFP secondary reporter expression in lens. Asterisk marks the rb1 allele mly7:GFP secondary reporter expression in heart. (F – H) pH3 and HuC/D labeling of sectioned head tissue from 5 dpf +/+ (F), rb1 (G), and rb1 (H). (I) Diagram of the rb1 allele. (J) Plot of RT-qPCR results from wild type +/+ (n=3), heterozygous rb1 (n=3), and homozygous rb1 (n=3) larvae showing the relative level of rb1 mRNA transcript using reference gene rps6kb1b. Primer pairs were located in exons 6 and 8, or downstream exons 23 and 24. (K, L) Gross phenotype of wildtype +/+ (K), heterozygous rb1 (L) and transheterozygous rb1 (M) 5 dpf larvae. Arrowhead in L, M points to rb1 allele gcry1:BFP secondary reporter expression in lens. Asterisk in M marks the rb1 allele mly7:GFP secondary reporter expression in heart. pH3 and HuC/D labeling of sectioned head tissue from 5 dpf +/+ (N), heterozygous rb1 (O) and transheterozygous rb1 (P).OT, optic tectum; R, retina; Th, thalamic region. Error bars represent mean ± s.e.m. Scale bars: 200 μm (C–E, K–M), 50 μm (F–H, N–P).

The rb1-stop integration allele recapitulates the rb1Δ7 indel loss-of-function phenotype.

(A) Diagram of rb1 gene model with exon 2 gRNA, the stop-PRISM-myl7:GFP targeting vector, and the resulting rb1-stop-myl7:GFP allele after GeneWeld CRISPR-Cas9 targeted integration. (B) F1 adult rb1-stop 5’ and 3’ junction analysis shows precise integration of the stop-PRISM cassette at the exon 2 target site. (C) Immunolocalization and quantification of pH3-labeled cells in control +/+ (n=3), rb1 (n=3), rb1 (n=3), and rb1/ (n=3) 5 dpf sectioned head tissue in the midbrain optic tectum and thalamic region (top row) and retina (bottom row) in both rb1 and rb1/ homozygotes. rb1 vs. +/+midbrain (**** p<0.0001) and retina (**** p<0.0001), rb1 vs. rb1/ midbrain (n.s. p=0.2951) and retina (n.s. p=0.1534). Th, thalamic region; OT, optic tectum; R, retina. Error bars represent mean ± s.e.m. with two-tailed t-test. Scale bars: 50 μm.

Quantification of pH3 labeled cells in rb1stop, rb1/, and rb1 mutant larvae.

(A) Quantification of pH3 labeled cells in 5 dpf wild type +/+ (n=3), transheterozygous rb1 (n=3), and transheterozygous rb1/ (n=3) larvae. rb1 larvae show a significant difference in pH3 levels from wildtype in the midbrain (*** p<0.001) and retina (**** p<0.0001). Associated with Figure 5 panels F, G, H. (B) Quantification of pH3-labeled cells in 5 dpf wild type +/+ (n=3), heterozygous rb1(n=3), and transheterozygous rb1 (n=3) larvae. rb1 larvae show a significant difference in pH3 levels from wildtype in the midbrain (** p<0.01) and retina (** p<0.01). Error bars represent mean ± s.e.m. with two-tailed t-test. Associated with Figure 5 panels N, O, P.

rb1 allele maintains rb1 function

The rb1 allele (Figure 7I) was examined for its effect on rb1 mRNA expression and gene activity. RT-qPCR of rb1 heterozygotes and rb1 homozygotes showed 84% and 83% levels, respectively, of rb1 mRNA compared to wild-type controls (Figure 7J; Figure 5—source data 1). Like wildtype, heterozygous rb1 and trans-heterozygous rb1 5 dpf larvae appear morphologically normal (Figure 7K–M). pH3 labeling in 5 dpf sectioned head tissue showed no significant difference between wild type (+/+) and rb1 (Figure 7N, O; Figure 7—figure supplement 2B; Figure 7—figure supplement 2—source data 1) in the midbrain (n.s. p=0.1118) and a slightly significant increase in the retina (* p>0.05). In rb1 transheterozygous larvae an increase in pH3 labeled cells was detected in the midbrain (** p<0.01) and retina (** p0.01) (Figure 7P; Figure 7—figure supplement 2B; Figure 7—source data 1). However, the actual increase in number was minor, from 10 to ~30, in contrast to hundreds of pH3-positive cells in homozygous mutant rb1 tissues. Together, these results demonstrate the rb1 allele knocks down rb1 mRNA expression and gene activity as expected, while the rb1 allele does not significantly disrupt either.

Cre/lox recombination of rb1 leads to stable inversion and conditional gene rescue

To test the rb1 and rb1 alleles for Cre-mediated conditional rescue and inactivation, we used the same approach as outlined above for the conditional rbbp4 and rbbp4 alleles. First, 12.5 pg Cre mRNA injection was used to test for recombinase mediated inversion and conditional gene rescue in embryos from a cross between rb1/+and rb1/+adults (Figure 8A–G). Stable inversion of the rb1 cassette to the ‘on’ orientation was confirmed by PCR and sequence analysis, which showed the expected sequences at the 5’ and 3’ junctions after inversion at the lox sites (Figure 8—figure supplement 1). In comparison to uninjected rb1/ larvae (Figure 8B), 5 dpf rb1/ injected larvae showed a significant reduction in the number of pH3-labeled cells in the midbrain (** p<0.01) and retina (** p<0.01) (Figure 8C, F; Figure 8—source data 1). Genomic DNA quantitative PCR of the original 5’ and 3’ rb1 allele junction fragments in the Cre injected embryos indicated a>78% inversion rate (Figure 8G; Figure 8—source data 1). Together these data demonstrate Cre mediated recombination of the rb1 allele leads to efficient, stable inversion of the cassette to the ‘on’ orientation and conditional rescue of the rb1 loss-of-function phenotype.
Figure 8.

Ubiquitous and proneural neurod1-specific Cre-mediated conditional rescue with rb1.

(A) Diagram of expected Cre-mediated inversion of rb1 to on orientation. (B, C) pH3 and HuC/D labeling of larval sectioned head tissue from 5 dpf transheterozygous rb1 (B – B”) and Cre injected rb1 (C – C”). (D, E) pH3 and Cre labeling of larval sectioned head tissue from 5 dpf transheterozygous rb1 (D – D”) and neurod1-2A-Cre; rb1 (E – E”). (F) Quantification of pH3-positive cells in control rb1 (n=3) and Cre injected rb1 (n=3) midbrain (** p<0.01) and retina (** p<0.01). (G) Genomic DNA qPCR quantification of rb1 original orientation DNA 5’ and 3’ junctions in control rb1 (n=3) and Cre injected rb1 (n=3). (H) Quantification of pH3-positive cells in rb1 (n=3) and neurod1-2A-Cre; rb1 (n=3) midbrain (** p<0.01) and retina (* p<0.05). (I) Genomic DNA qPCR quantification of rb1 original orientation DNA 5’ and 3’ junctions in control rb1 (n=3) and neurod1-2A-Cre; rb1 (n=3). Error bars represent mean ± s.e.m. with two-tailed t-test. Scale bars: 50 μm (B - E), 10 μm (B’ – E”).

(A) Diagram of expected Cre-mediated inversion of rb1 to on orientation with primers for junction analysis. (B) Gross morphology in 5 dpf larva uninjected rb1 and rb1, and Cre injected rb1 and rb1. (C, D) 5’ and 3’ junctions of the inverted allele detected by genomic DNA PCR. (E) Sequence of the 5’ and 3 junction amplicons confirms rb1 stable inversion to the on orientation by Cre. Scale bar 200 μm (B).

Figure 8—figure supplement 1.

Molecular analysis of rb1 inversion and conditional rescue by Cre injection.

(A) Diagram of expected Cre-mediated inversion of rb1 to on orientation with primers for junction analysis. (B) Gross morphology in 5 dpf larva uninjected rb1 and rb1, and Cre injected rb1 and rb1. (C, D) 5’ and 3’ junctions of the inverted allele detected by genomic DNA PCR. (E) Sequence of the 5’ and 3 junction amplicons confirms rb1 stable inversion to the on orientation by Cre. Scale bar 200 μm (B).

Ubiquitous and proneural neurod1-specific Cre-mediated conditional rescue with rb1.

(A) Diagram of expected Cre-mediated inversion of rb1 to on orientation. (B, C) pH3 and HuC/D labeling of larval sectioned head tissue from 5 dpf transheterozygous rb1 (B – B”) and Cre injected rb1 (C – C”). (D, E) pH3 and Cre labeling of larval sectioned head tissue from 5 dpf transheterozygous rb1 (D – D”) and neurod1-2A-Cre; rb1 (E – E”). (F) Quantification of pH3-positive cells in control rb1 (n=3) and Cre injected rb1 (n=3) midbrain (** p<0.01) and retina (** p<0.01). (G) Genomic DNA qPCR quantification of rb1 original orientation DNA 5’ and 3’ junctions in control rb1 (n=3) and Cre injected rb1 (n=3). (H) Quantification of pH3-positive cells in rb1 (n=3) and neurod1-2A-Cre; rb1 (n=3) midbrain (** p<0.01) and retina (* p<0.05). (I) Genomic DNA qPCR quantification of rb1 original orientation DNA 5’ and 3’ junctions in control rb1 (n=3) and neurod1-2A-Cre; rb1 (n=3). Error bars represent mean ± s.e.m. with two-tailed t-test. Scale bars: 50 μm (B - E), 10 μm (B’ – E”).

Molecular analysis of rb1 inversion and conditional rescue by Cre injection.

(A) Diagram of expected Cre-mediated inversion of rb1 to on orientation with primers for junction analysis. (B) Gross morphology in 5 dpf larva uninjected rb1 and rb1, and Cre injected rb1 and rb1. (C, D) 5’ and 3’ junctions of the inverted allele detected by genomic DNA PCR. (E) Sequence of the 5’ and 3 junction amplicons confirms rb1 stable inversion to the on orientation by Cre. Scale bar 200 μm (B).

neurod1-specific rb1 conditional rescue demonstrates rb1 is required to suppress neurod1 neural progenitor cell cycle entry

The proneural neurod1-2A-Cre, gcry1:GFP driver was used to test for conditional gene rescue of rb1 in the neurod1 progenitor population. Five dpf larvae from adult rb1 crossed with neurod1-2A-Cre/+; rb1 was labeled with antibodies to Cre and pH3 (Figure 8D–I). In comparison to control rb1 larvae, neurod1-2A-Cre/+; rb1 larvae showed a significant reduction in pH3 positive cells in the midbrain (* p<0.05) and retina (** p<0.01) where Cre is expressed (Figure 8D–H; Figure 8—source data 1). Rescue of the phenotype correlated with >34% Cre mediated inversion of rb1 to the ‘on’ orientation (Figure 8I; Figure 8—source data 1). The results demonstrate cell-type-specific conditional rescue and a requirement for rb1 to suppress cell cycle entry in neurod1 progenitors.

Cre/lox recombination of rb1 leads to efficient conditional gene inactivation and recapitulates cellular rb1 loss-of-function phenotype

Conditional rescue using the rb1 allele was first tested by injection of 12.5 pg Cre mRNA into embryos from a cross between heterozygous rb1 and rb1 adults to induce inversion from the passive to the active orientation (Figure 9A). At 3 dpf rb1 uninjected and injected larvae appear morphologically normal like control rb1 larvae (Figure 9—figure supplement 1 A, B). However, in comparison to uninjected control sectioned head tissue (Figure 9B), Cre injected rb1 showed increased levels of pH3 labeling throughout the brain and retina (Figure 9C), similar to the loss-of-function phenotype of rb1/ and rb1/ (Figure 7D and E). Quantification showed a significant increase in the number of pH3-positive cells in injected larvae in both the midbrain (**** p<0.0001) and retina (** p<0.01) (Figure 9F; Figure 9—source data 1). Induction of the mutant phenotype correlated with >80% inversion rate by Cre recombination (Figure 9G; Figure 9—source data 1). Stable inversion of the UFlip cassette in Cre injected embryos was confirmed by PCR junction analysis and sequencing of the junction amplicons (Figure 9—figure supplement 1 C–F). These results demonstrate Cre recombination leads to stable inversion of the UFlip cassette and conditional gene inactivation which replicates the rb1 loss-of-function phenotype at the cellular level.
Figure 9.

Ubiquitous and proneural neurod1-specific Cre-mediated conditional inactivation with rb1-on.

(A) Diagram of expected Cre mediated inversion of rb1 to ‘off’ orientation. (B, C) pH3 and HuC/D labeling of larval sectioned head tissue from 5 dpf transheterozygous rb1 (B – B”) and Cre injected rb1 (C – C”). (D, E) pH3 and Cre labeling of larval sectioned head tissue from 5 dpf transheterozygous rb1 (D – D”) and neurod1-2A-Cre; rb1 (E – E”). (F) Quantification of pH3-positive cells in control rb1 (n=3) and Cre rb1 (n=3) injected midbrain (**** p<0.0001) and retina (** p<0.01). (G) Genomic DNA qPCR quantification of rb1original orientation DNA 5’ and 3’ junctions in control rb1 (n=3) and Cre injected rb1 (n=3). (H) Quantification of pH3-positive cells in control rb1 (n=3) and neurod1-2A-Cre; rb1 (n=3) midbrain (*** p<0.001) and retina (* p<0.05). (I) Genomic DNA qPCR quantification of rb1 original orientation DNA 5’ and 3’ junctions in control rb1 (n=3) control and neurod1-2A-Cre; rb1 (n=3). Error bars represent mean ± s.e.m. with two-tailed t-test. Scale bars: 50 μm (B - E), 20 μm (B’ – E”).

(A) Diagram of expected Cre-mediated inversion of rb1 to “off” orientation with primers for junction analysis. (B) Gross morphology in 5 dpf larva uninjected rb and rb1, and Cre injected rb1 and rb1. (C, D) 5’ and 3’ junctions of the inverted allele detected by genomic DNA PCR. (E) Sequence of the 5’ and 3 junction amplicons confirms rb1 stable inversion to the “off” orientation by Cre. Scale bar 200 μm (B).

Figure 9—figure supplement 1.

Molecular analysis of rb1-on inversion and conditional inactivation by Cre injection.

(A) Diagram of expected Cre-mediated inversion of rb1 to “off” orientation with primers for junction analysis. (B) Gross morphology in 5 dpf larva uninjected rb and rb1, and Cre injected rb1 and rb1. (C, D) 5’ and 3’ junctions of the inverted allele detected by genomic DNA PCR. (E) Sequence of the 5’ and 3 junction amplicons confirms rb1 stable inversion to the “off” orientation by Cre. Scale bar 200 μm (B).

Ubiquitous and proneural neurod1-specific Cre-mediated conditional inactivation with rb1-on.

(A) Diagram of expected Cre mediated inversion of rb1 to ‘off’ orientation. (B, C) pH3 and HuC/D labeling of larval sectioned head tissue from 5 dpf transheterozygous rb1 (B – B”) and Cre injected rb1 (C – C”). (D, E) pH3 and Cre labeling of larval sectioned head tissue from 5 dpf transheterozygous rb1 (D – D”) and neurod1-2A-Cre; rb1 (E – E”). (F) Quantification of pH3-positive cells in control rb1 (n=3) and Cre rb1 (n=3) injected midbrain (**** p<0.0001) and retina (** p<0.01). (G) Genomic DNA qPCR quantification of rb1original orientation DNA 5’ and 3’ junctions in control rb1 (n=3) and Cre injected rb1 (n=3). (H) Quantification of pH3-positive cells in control rb1 (n=3) and neurod1-2A-Cre; rb1 (n=3) midbrain (*** p<0.001) and retina (* p<0.05). (I) Genomic DNA qPCR quantification of rb1 original orientation DNA 5’ and 3’ junctions in control rb1 (n=3) control and neurod1-2A-Cre; rb1 (n=3). Error bars represent mean ± s.e.m. with two-tailed t-test. Scale bars: 50 μm (B - E), 20 μm (B’ – E”).

Molecular analysis of rb1-on inversion and conditional inactivation by Cre injection.

(A) Diagram of expected Cre-mediated inversion of rb1 to “off” orientation with primers for junction analysis. (B) Gross morphology in 5 dpf larva uninjected rb and rb1, and Cre injected rb1 and rb1. (C, D) 5’ and 3’ junctions of the inverted allele detected by genomic DNA PCR. (E) Sequence of the 5’ and 3 junction amplicons confirms rb1 stable inversion to the “off” orientation by Cre. Scale bar 200 μm (B).

neurod1-specific rb1 conditional inactivation leads to neural progenitor cell cycle entry

The proneural neurod1-2A-Cre, gcry1:GFP driver was used to test for conditional inactivation of rb1 in the neurod1 progenitor population. 3 dpf larvae from adult rb1 crossed with neurod1-2A-Cre/+; rb1 was labeled with antibodies to Cre and pH3 (Figure 9D–I). In comparison to control rb1 larvae (Figure 9D), neurod1-2A-Cre/+; rb1 larvae showed a significant increase in pH3 positive cells in the midbrain (*** p<0.001) and retina (* p<0.05) where Cre is expressed (Figure 9E and H; Figure 9—source data 1). Induction of the mutant phenotype correlated with >25% inversion of rb1 to the ‘off’ orientation (Figure 9I; Figure 9—source data 1). The results are consistent with the rb1 conditional rescue experiment, and demonstrate a requirement for rb1 in suppressing cell cycle entry in the neurod1 progenitor cell population in the developing midbrain and retina. Overall, these analyses show conditional alleles generated by targeted integration of the floxed UFlip cassette provide robust control of gene activity. Combined with cell-type-specific Cre drivers, the alleles demonstrate cell-type-specific requirements for gene activity through both conditional inactivation and rescue.

Discussion

In this study, we used GeneWeld CRISPR-Cas9 targeting to isolate Cre/lox regulated conditional alleles with linked reporters by integration of a floxed gene trap cassette, UFlip, at a single gRNA site in an intron. Gene ‘off’ and gene ‘on’ germline UFlip alleles were recovered for two genes, rbbp4 and rb1. Our results showed the UFlip cassette led to >99% gene knockdown at the molecular level, did not disrupt gene activity in the passive orientation, allowed stable Cre/lox mediated inversion for conditional inactivation or rescue, and recapitulated expected loss-of-function phenotypes at the morphological and cellular levels. We further demonstrated using proneural Cre drivers that conditional gene inactivation or rescue can be restricted to distinct neural progenitor cell populations. These studies revealed cell-type-specific requirements for gene activity that had previously only been inferred by global loss-of-function homozygous mutant analysis. Our approach is simple in design, efficient, generates effective Cre/lox regulated alleles for genetic mosaic analysis and can be applied to any gene of interest. We assembled UFlip vectors with 48 bp homology arms to generate integrations in rbbp4 and rb1 in both the ‘off’ and ‘on’ orientations. Of the four potential targeted integration alleles, we recovered three precise alleles at a frequency of 4–14% of founders screened. This frequency is lower than our previous reports using GeneWeld to knock in fluorescent reporters (22–100%) (Wierson et al., 2020) or 2A-Cre (10–100%) (Almeida et al., 2021; Wierson et al., 2020). In those studies, injected embryos showing expression of the fluorescent tag, or Cre-mediated switching of a floxed reporter, were selected and raised to adulthood to screen for germline transmission. In this report, some lines were generated with vectors that only enabled embryo selection based on expression of the secondary reporter, which does not reflect on target integration. In support of this, only 7 and 8 adults needed to be screened to recover the rbbp4 and rb1 2A-mRFP UFlip alleles, respectively, which showed mRFP expression in the injected embryos. This is in comparison to 25 adults that were screened to recover the original rb1 mRFP UFlip alleles. Moreover, starting with an allele in one orientation, it was straightforward to use Dre recombination at rox sites flanking the UFlip cassette to recover an allele in the opposite orientation. Dre/rox recombination has been shown to be highly efficient in somatic tissue (Park and Leach, 2013). By injection of Dre mRNA into rbbp4 embryos we readily recovered the rbbp4 allele in the next generation from 7/11 adults, demonstrating efficient Dre recombinase activity in the zebrafish germline. Previously reported methods for recovery of intron targeted floxed conditional alleles varied widely in frequency, from 12% for homology directed integration from a linear template with long 1–1.5 kb homology arms (Hoshijima et al., 2016), 53% by homologous recombination from a circular plasmid with 1 kb long homology arms (Sugimoto et al., 2017), to 56–60% for integration by Non-Homologous End Joining after preselection of a primary reporter (Han et al., 2021; Li et al., 2019). The simplicity of UFlip vector construction and ability to recover precise integrations, in either orientation, underscore the power of our approach for isolation of stable Cre/lox regulated conditional alleles. Similar to our previous findings when isolating endogenous Cre drivers (Almeida et al., 2021), the UFlip founders transmitted both precise and imprecise integration events. In some cases, the imprecise event was a simple homology arm duplication or short insertion at either the 5’ or 3’ junction, which would be predicted not to affect gene function since the integrated cassette is located in an intron. As predicted, the rb1 allele, from which we were able to establish a line, had a 5’ homology arm duplication separated by a 115 bp insertion. This did not affect the ability of the cassette to efficiently invert in response to Cre recombinase. When inverted into the passive orientation the cassette allowed effective conditional rescue, indicating the additional sequences in the intron flanking the cassette didn’t disrupt splicing or rb1 gene activity. For effective conditional gene inactivation, it is essential that the method leads to robust knockdown of wildtype mRNA expression and recapitulates loss-of-function phenotypes for genetic analysis. Our UFlip conditional construct is based on the Tol2 transposon RP2 gene trap, which contains a transcriptional terminator that effectively blocks transcription readthrough and reduces transcript levels by >99% (Clark et al., 2011; Ichino et al., 2020). The efficacy of gene knockdown by the UFlip gene trap was demonstrated by quantitative RT-qPCR and revealed >99% reduction in mRNA levels. Cre/lox-mediated inversion of the UFlip cassette from the passive to active orientation was highly efficient after Cre mRNA injection or exposure to a transgenic source of Cre, generating expected phenotypes in combination with loss-of-function mutations. The recently published Cre-regulated CRISPR indel targeting study provides a rapid method for conditional mutagenesis and phenotypic knockout in embryos (Hans et al., 2021). In contrast, a significant advantage of our stable conditional UFlip alleles rests on the strength of transcriptional termination by the UFlip cassette in the active orientation. In addition, Cre induction of conditional inactivation leads to mRFP fluorescent cell labeling, as described in other recent studies (Han et al., 2021; Hans et al., 2021; Li et al., 2019), which is critical for lineage tracing and capturing mutant cells for downstream genomics applications. We further validated effective UFlip conditional gene inactivation at the cellular level. We previously demonstrated that rb1 is required to prevent neural progenitor cell cycle re-entry in the developing zebrafish brain and rbbp4 is necessary for neural progenitor survival and differentiation (Schultz et al., 2018). Using our ascl1b-2A-Cre and neurod1-2A-Cre drivers in combination with rbbp4 and rb1 conditional alleles, we demonstrated the requirement for each gene could be examined specifically in the ascl1b or neurod1 neural progenitor populations. Rb1 is required to prevent cell cycle re-entry in ascl1b and neurod1 neural progenitors. Rbbp4 appears to be required for neural progenitor survival only in ascl1b progenitors. Further analysis with tamoxifen regulated CreERT2 drivers will refine our understanding of the requirement for these genes in neural progenitor survival and proliferation. These conditional genetic tools provide a foundation for future mechanistic studies investigating the interaction of rb1 and rbbp4 specifically in neural progenitor cell cycle regulation and differentiation but can also be used with other cell-type-specific Cre drivers. Our results illustrate the robustness of the UFlip conditional alleles for cell type-specific gene knockout analysis and their potential application in different developmental or disease model contexts. In summary, building on our previous streamlined GeneWeld approach for CRISPR-Cas short homology directed targeted integration, we describe an effective method for generating zebrafish floxed conditional alleles. We present a thorough molecular and phenotypic validation of the robustness of the UFlip floxed gene trap cassette for effective knockdown of gene expression and Cre/lox regulated conditional inactivation and rescue. UFlip alleles can be combined with any available cell or tissue-specific Cre driver for spatial and temporal gene knock out, enabling the investigation of gene function in specific developmental and post embryonic stages or disease models. The UFlip vector can be adapted to introduce a variety of gene modification cassettes, such as alternative exons and complete cDNAs. In contrast to Tol2 transposon binary UAS overexpression systems, targeted integration leads to control by endogenous gene regulatory elements and should increase phenotype consistency. The UFlip integration approach provides a powerful platform for generating new Cre/lox genetic tools to modify gene function at endogenous loci in zebrafish.

Materials and methods

Ethics declarations and approval for animal experiments

Use of zebrafish for research in this study was performed according to the Guidelines for Ethical Conduct in the Care and Use of Animals (APA, 1986), and carried out in accordance with Iowa State University Animal Care and Use Committee IACUC-18–279 and IACUC-20–058 approved protocols. All methods involving zebrafish were in compliance with the American Veterinary Medical Association (2020), ARRIVE (Percie du Sert et al., 2020) and NIH guidelines for the humane use of animals in research.

Zebrafish strains and maintenance

Zebrafish (Danio rerio) were maintained on an Aquaneering aquaculture system at 26 °C on a 14 hr light/10 hr dark cycle. The WIK strain of wild type zebrafish was obtained from the Zebrafish International Resource Center (https://zebrafish.org/home/guide.php). Other zebrafish lines used in this study were previously described: Tg(ascl1b-2A-Cre; gcry1:EGFP) and Tg(neurod1-2A-Cre; gcry1:EGFP) (Almeida et al., 2021); rb1Δ7 (Solin et al., 2015); rbbp4Δ4 (Schultz et al., 2018).

Contact for reagent and resource sharing

Further information and requests for resources and reagents should be directed to Maura McGrail (mmcgrail@iastate.edu).

Floxed UFlip vector for CRISPR-targeted integration to generate conditional alleles

The UFlip version 1.0 floxed mRFP gene trap vector for targeted integration (Figure 1A) was designed to be compatible with our previously published GeneWeld CRISPR-Cas9 targeted integration strategy (Wierson et al., 2020). The UFlip cassette was assembled in the pPRISM parent vector (Almeida et al., 2021) which has Universal UgRNA sequences on and BfuAI and BspQI type II restriction enzyme sites for cloning 5’ and 3’ homology arms on either side of the cassette, as previously described (Wierson et al., 2020). In the UFlip vector, the homology arm cloning sites flank head to head oriented rox sites that sit outside alternating pairs of head to head loxP and lox2272 sites for stable inversion after Cre mediated recombination (Robles-Oteiza et al., 2015; Schnütgen et al., 2003). Internal to the rox and lox sequences is the RP2 gene trap (Clark et al., 2011), consisting of a gene trap Splice Acceptor-mRFP-ocean pout (Zoarces americanus) antifreeze gene transcriptional termination and polyadenylation sequence (Gibbs and Schmale, 2000), followed by a tissue-specific lens gcry1:BFP or heart myl7:BFP secondary reporter. To assemble UFlip an intermediate vector was created by adding EagI and ClaI restriction sites to the pPRISM backbone by PCR. Six pairs of oligos, each containing the sequence of one of the rox, loxP or lox2272 sites, with complementary overhangs were ligated into the EagI and ClaI digested backbone. All three reading frames of the RP2 gene trap plus secondary reporter was directionally cloned into AvrII and SacI restriction sites located inside the pairs of rox/loxP/lox2272 sites. The UFlip version 2.0 vector was generated by mRFP primary reporter in the first version of the UFlipv1.0 vector was subsequently replaced with the porcine teschovirus-1 polyprotein 2 A peptide fused to mRFP. A UFlip version with a gene trap primary reporter containing the 2A-KalTA4 cDNA (Distel et al., 2009) for signal amplification using with a UAS:reporter is also available.

Intronic sgRNA target site selection, UFlip homology arm design and targeted integration

To identify CRISPR gRNA sites in introns, intronic sequences from four adult female and four adult make WIK fish were amplified from fin clip DNA using the proofreading enzyme KOD and sequenced to identify non-repetitive sequences that were shared among adults in the population. Gene specific and vector Universal UgRNA synthetic gRNAs with 2’-O-Methyl at first and last bases, 3’ phosphorothioate bonds between first 3 and last 2 bases, were ordered from Synthego . gRNA efficiency was determined by co-injection of 25 pg gRNA plus 300 pg Cas9 mRNA into one-cell stage embryos, followed by PCR amplification of the targeted intron and analysis of heteroduplex formation by gel electrophoresis. Amplicons were Sanger sequenced and the sequences analyzed for indel efficiency using Synthego’s Inference of CRISPR Edits (ICE) analysis software (https://ice.synthego.com/#/). The UFlip targeting vectors were built following the GeneWeld protocol (Welker et al., 2021). 48 bp 5’ and 3’ homology arms were designed to sequences flanking the genome intronic CRISPR-Cas9 target site. The homology arms were assembled by annealing complementary oligonucleotides with appropriate overhangs for cloning into the BfuAI and BspQI type IIS restriction enzyme sites that flank the UFlip cassette. To generate an active, gene ‘off’ allele, the 5’ and 3’ homology arms were cloned into the UFlip BfuAI and BspQI sites, respectively. To integrate the UFlip cassette in the passive, gene ‘on’ orientation, the position of the cloned 5’ and 3’ homology arms was reversed, with the 3’ homology arm cloned into the BfuAI site upstream of the cassette, and the 5’ homology arm cloned in the BspQI site downstream of the cassette. gRNA and homology arm oligonucleotide sequences are listed in Table 1. For synthesis of Cas9 mRNA the expression vector pT3TS-nCas9n (Addgene #46757) (Jao et al., 2013) was linearized with Xba I (New England Biolabs, R0145S). One μg linearized vector was purified with the PureYield Plasmid Miniprep System (Promega, A1223) and used as template for in vitro synthesis of capped mRNA with the Ambion mMessage Machine T3 Transcription Kit (Thermo Fisher, AM1348). in vitro synthesized mRNA was purified with the RNA Clean and Concentrator Kit RCC (Zymo, R1013). To target CRISPR-Cas9 driven integration of the UFlip cassette into intronic sites, a 2 nl volume containing 25 pg of genomic gRNA, 25 pg of UgRNA, 10 pg of UFlip targeting vector, and 300 pg Cas9 mRNA was co-injected into one-cell stage embryos from crosses between sequence validated adult fish. Larvae were screened at 3 dpf for expression of the lens gcry1:BFP or heart myl7:BFP secondary marker. Three to four BFP-positive embryos were selected for genomic DNA isolation and confirmation of on target integration by PCR sequence analysis of 5’ and 3’ junctions. BFP-positive sibling embryos were raised to adulthood. Primers, gRNA and homology arm oligonucleotide sequences are listed in Table 1 and Table 4.
Table 4.

Primer oligonucleotide sequences.

Primer nameSequencePurpose
rbbp4e × 4 FACCAAACACCCCTCCAAACCAGintron sequencing, sgRNA analysis and genome/vector 5' junction analysis
rbbp4e × 5 RAGTGCACTCTCCAGAGGGGTintron sequencing, sgRNA analysis and genome/vector 3' junction analysis
rb1e × 6 FCATGTTCCTCCTGGCCAAGgenome/vector 5' junction analysis
rb1e × 7 RCACAAGGTCATCTTCCATCTGgenome/vector 3' junction analysis
rb1e × 2 FGAGGAGCTCCAGTCCACTAACgenotyping and genome/vector 5' junction analysis
rb1e × 2 RCCCAAAACACAAGTGCGGTAAgenotyping and genome/vector 3' junction analysis
R-5'-junc-Stop-pPRISMCGGTGGCTGAGACTTAATTACTstop-PRISM genome/vector 5' junction analysis
F-3'-junc-(all)-pPRISMTTCAGATCAATTAACCCTCACCstop-PRISM genome/vector 3' junction analysis
RFPjATGACGTCCTCGGAGGAGGCUFlip genome/vector junction analysis
RFPj2CCTTGGTCACCTTCAGCTTGUFlip genome/vector junction analysis
BactinpAjGCAAACGGCCTTAACTTTCCUFlip genome/vector junction analysis
2ARCATAGGACCGGGGTTTTCTTUFlip and 2A-Cre genome/vector junction analysis
rb1e × 6 FCAGCTGGACCATGTTCCTCCQPCR
rb1e × 8 RCCCTGATTACGGCGTGATGTQPCR
rbbp4e × 4 FTAGTGACGTGCTGGTCTTTGQPCR
rppb4e × 5 RCAGGACAGACCATAACCTTCTTQPCR
rbbp4e × 11_1 FCTCTGTGTCTGAGGACAACATCQPCR
rbbp4e × 12_1 RTATCCCTGAACCTCAGTGTCTQPCR
rps6kb1b_1 FTCCTGATGACTCCACACTGAQPCR
rps6kb1b_1 RGGCGAGGTGAACGGATTTQPCR
BFP_FCTGCCTCATCTACAACGTCAAgenotyping
BFP_RCTTAGCGGGTTTCTTGGATCTATgenotyping
neujFTCCAACTGAACCCCAGAACTgenotyping
ascjFGTCAACATGGGCTTCCAGACgenotyping
rbbp4e × 2 FGCGTGATGACAGATCTCATATTGTTTTCCCgenotyping
rbbp4e × 2 RCTGGTGACATCTGGCAACCACTgenotyping

Isolation of stable zebrafish rbbp4 and rb1 UFlip and stop-PRISM integration alleles

To identify founder fish transmitting a UFlip allele, adults were outcrossed to wild-type WIK and embryos were screened for expression of the UFlip secondary reporter expressing BFP in the lens (gcry1:BFP) or heart (myl7:BFP). To identify on target integration alleles, genomic DNA was extracted from individual BFP-positive embryos by digestion in 50 mM NaOH at 95 °C for 30 min and neutralization by addition of 1/10th volume 1 M Tris-HCl pH 8.0. Genomic DNA/UFlip cassette 5’ and 3’ junctions were amplified by PCR with gene specific and UFlip primers listed in Table 4, followed by direct Sanger sequencing. BFP-positive sibling embryos from a founder that was transmitting a precise UFlip integration allele were raised to adulthood. F1 adult animals were fin clipped and the genotype of individuals confirmed by PCR and sequencing. Confirmed F1 adults were outcrossed to wild-type WIK, and F2 adults again were confirmed for the presence of a precise UFlip integration allele. Individual confirmed F2 adults were outcrossed to WIK to establish independent transgenic lines. The rb1-stop-PRISM-myl7:GFP allele was generated with a pPRISM (PRecise Integration with Secondary Marker) GeneWeld targeted integration vector containing a cassette with splice acceptor followed by three copies of TGA, TAA, TAG, the ocean pout (Zoarces americanus) antifreeze gene transcriptional termination and polyadenylation sequence (Gibbs and Schmale, 2000), and a myl7:eGFP-βactin polyadenylation secondary reporter. Previously described 5’ and 3’ homology arms complementary to the rb1 exon 2 CRISPR target site (Schultz et al., 2018; Wierson et al., 2020) were cloned into the BfuAI and BspQI type IIS restriction enzyme sites flanking the stop-PRISM-myl7:eGFP cassette. 25 pg of rb1 exon 2 genomic gRNA, 25 pg of UgRNA, 10 pg of rb1-stop-PRISM targeting vector, and 300 pg Cas9 mRNA were coinjected into one-cell stage embryos in a volume of 2 nl, and adult founders screened for transmission of the rb1-stop-PRISM-myl7:GFP allele. Precise 5’ and 3’ junctions were confirmed in heart myl7:eGFP expressing F2 fin clipped adults.

Quantitative RT-PCR

Experiments to measure endogenous gene mRNA levels by Reverse Transcription-quantitative PCR were designed and performed according to MIQE and updated guidelines (Bustin et al., 2009; Taylor et al., 2019). Three biological replicates were performed, with each replicate representing embryos from a different mating pair of fish. At 3 dpf 20 randomly selected larvae from incrosses of heterozygous rbbp4, rbbp4, rb1, and rb1 were collected for RNA extraction and genotyping. Individual dissected head tissue was placed in RNAlater (Qiagen/Thermo Fisher AM7020) or DNA/RNA shield (Zymo Research R1100-50) and individual trunk tissue was placed in 50 mM NaOH for genotyping. Five heads of each genotype were pooled and total RNA extracted using the Direct-zol RNA Microprep kit (Zymo Research, R2060) and the quality determined using a Bioanalyzer 2100 (Agilent) at the Iowa State University DNA Facility. RNA samples with a RIN >5 were normalized to the same concentration, and first strand cDNA was synthesized using SuperScript III First-Strand Synthesis SuperMix (ThermoFisher, 11752050) containing random hexamer and oligo dT primers. Primers were designed to amplify ~200 bp amplicons with an annealing temperature of 60 °C. Primer optimization and validation was performed with 3 primer concentrations (100, 200, and 400 nM) and 3 cDNA amounts (5, 25, and 215 ng) with two replicates per condition. Primer efficiency was calculated as described (Bustin et al., 2009; Taylor et al., 2019) and primer pairs with 90–100% efficiency were used for qPCR of control and test samples. The sequence of rbbp4, rb1 and reference gene rps6kb1b qPCR primers are listed in Table 4. qPCR was performed on each sample in triplicate using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, 1725270) on a CFX Connect Real-Time System (Bio-Rad).

Cre and Dre-mediated inversion of UFlip alleles

For synthesis of Cre and Dre mRNAs, the expression vectors pT3TS-Cre (Clark et al., 2011) and pT3TS-Dre were linearized with SalI (New England Biolabs, R0138S) and BamHI (New England Biolabs, R0136S), respectively. 1 μg linearized vector was purified with the PureYield Plasmid Miniprep System (Promega, A1223) and used as template for in vitro synthesis of capped mRNA with the Ambion mMessage Machine T3 Transcription Kit (Thermo Fisher, AM1348). In vitro synthesized mRNA was purified with the RNA Clean and Concentrator Kit RCC (Zymo, R1013). A total of 12.5 pg Cre or 15 pg Dre mRNA was injected into one-cell stage embryos to promote recombination-mediated inversion of the UFlip cassette at lox or rox sites. UFlip cassette inversion in Cre or Dre injected 3 dpf larvae was confirmed by digestion of individual larvae in 50 mM NaOH at 95 °C for 30 min and neutralization by addition of 1/10th volume 1 M Tris-HCl pH 8.0. Genomic DNA/UFlip cassette 5’ and 3’ junctions were amplified by PCR with gene specific and UFlip primers listed in Table 4, followed by direct Sanger sequencing.

Zebrafish tissue embedding, sectioning, immunolocalization, and imaging

Zebrafish embryo and larvae fixation, embedding, sectioning, and immunolabeling was as described previously (Schultz et al., 2018). Zebrafish embryos and larvae were anesthetized in 160 µg/ml Ethyl 3-aminobenzoate methanesulfonate (Tricaine, MS-222) C9H11NO2·CH4SO3 (Sigma-Aldrich, 886-86-2) in E3 embryo media (Westerfield, 1995) and head and trunk dissected. Trunk tissue was placed in 20 µl 50 mM NaOH for genotyping. Heads were fixed in 4% paraformaldehyde overnight at 4 °C, incubated in 30% sucrose overnight at 4 °C, then processed and embedded in Tissue-Tek OCT (Fisher, 4583). Tissues were sectioned at 14–16 µm on a Microm HM 550 cryostat. Antibodies used for labeling: rabbit polyclonal anti-phospho-Histone H3 PH3 1:1000 (Cell Signaling Technology; 9701); mouse monoclonal anti-phospho-Histone H3 (Ser10), clone 3H10 1:500 (Millipore 05–806); mouse monoclonal anti-HuC/D 1:500 (Invitrogen A-21271); mouse monoclonal Anti-Cre recombinase 1:250 (Millipore-Sigma MAB3120); rabbit polyclonal anti-Caspase-3a 1:500 (BD Biosciences 559565); Alexa-594 (Invitrogen A-11005) and Alexa-488 (Invitrogen A-11008) conjugated secondary antibodies 1:500. Tissues were counterstained with 5 µg/ml DAPI, mounted in Fluoro-Gel II containing DAPI (Electron Microscopy Sciences 17985–50) and imaged on a Zeiss LSM800 laser scanning confocal microscope. For live imaging, some embryos and larvae were treated with 0.003% 1-phenyl 2-thiourea (Sigma, P7629) to inhibit pigment synthesis, anesthetized in Tricaine in embryo media (Westerfield, 1995) and mounted on slides in 1.2% low-melt agarose/embryo media/Tricaine. Fluorescence and bright field imaging were performed on a Zeiss SteREO Discovery V12 microscope equipped with an X-Cite 120 W Metal Halide lamp (Excilitas Technologies, X-Cite 120Q). Images were captured with a Cannon Rebel T3 camera using EOS Utility software (Cannon). Bright field and fluorescence images were merged in Photoshop (Adobe). Live imaging was also performed on a Leica M165 FC stereomicroscope equipped with EL 6000 light source and K5 passive cooled sCMOS camera using Leica LAS X Multi Channel Acquisition software. Live imaging of larval retina was performed on a Zeiss LSM800 laser scanning confocal microscope.

Quantification and statistical analyses

Quantification of proliferation and apoptosis was performed on three sections of immunolabeled head tissue for each individual, from three biological replicates of zebrafish embryos or larvae. Prism (GraphPad) software was used for two-tailed unpaired Student’s t-test with mean ± s.e.m. statistical analyses and production of bar graphs. This technical paper describes a novel strategy for conditional mutagenesis in zebrafish. It develops a simple approach to isolate mutagenic Cre/lox conditional alleles for tissue-specific gene inactivation. This work will be of great interest for the zebrafish community, advancing the exciting genetic manipulation tool box in this model organism. Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work. Decision letter after peer review: Thank you for submitting your article "Zebrafish Cre/lox regulated UFlip alleles generated by CRISPR/Cas targeted integration provide cell-type specific conditional gene inactivation" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Richard White as the Senior Editor. The reviewers have opted to remain anonymous. The reviewers have discussed their reviews with one another, and with the Reviewing editor and Senior Editor. All recognise the promise and potential of your approach, but the reviewers have identified a number of significant concerns. It was agreed that extensive revisions and new data, including additional controls and quantitation, would be needed in any revised version. Essential revisions: 1) Show the possibility to switch the On-Off orientation in a tissue-specific manner; in particular, demonstrate the ability to turn genes on (see comments from Reviewer 2). 2) Show the possibility to trace cells with the inactive gene via fluorescent reporter activation. 3) Test the utility of imprecise insertion, as it is not clear why it's needed to insert the construct with HDR in an intron. 4) Provide a quantitative assessment of the efficiency of flipping. 5) Strengthen the validation of the null phenotypes described, and of the expression of targeted genes. Full details of the requested revisions are given in the reviews below. Reviewer #1 (Recommendations for the authors): I have few major concerns that limit in my view the impact of the manuscript. The first is that the ability of following mutagenized cells that have undergone the cassette rearrangements from the Gene-ON to Gene -OFF orientation via fluorescent tagging of the endogenous gene is not presented here. This is in my opinion the main interesting feature of this approach and unfortunately is not shown here. Instead the putative mutagenized cells are revealed only by Cre expression that may be transient and doesn't allow to follow the inversion events. Secondly, the impact of inserting such a large cassette, containing multiple fluorescent reporter ORF and an extra promoter as a transgenesis marker, on the transcription of the gene targeted and the surrounding loci should be better assessed. Ideally this should be done via RNAseq strategies as this intronic insertion could potentially affect the transcriptional landscape of the targeted region. This analysis should also reveal the exact extent of WT transcript splicing events in the mutagenic configuration now generally estimated at less than 1%. Finally the authors build their strategy on their previously published GeneWeld strategy, using short homology harms to aim at precise integration in the targeted locus. This, as they discuss, reduce the efficiency of their approach compared to previously published strategies including non homology based approaches. Giving that small INDELS in an intronic integration of a large cassette most likely have little or no consequences, it is not clear to me why the use of non homology directed integration should not be favored here. At the very least, this should be tested as they have all the tools in hands to do in their target loci by targeting the same construct without the short homology harms and comparing the efficiency they obtain. I believe these three points would strengthen their conclusion and help scientists to choose the best strategy when designing their conditional KO strategy. Reviewer #2 (Recommendations for the authors): In addition to the issues noted in the public review, the authors should also address a few additional points: Improved presentation of data. The readability of the text and "scannability" of the figures could be improved. There are a probably unnecessarily large number of somewhat confusingly designated and not always clearly labeled figures, making more work than should be required for the reader to navigate and digest the key features of this manuscript. While I do appreciate that the authors have provided a very large amount of supporting data allowing the reader to "delve into the details," the authors should consider reorganizing (if possible reducing the number of) the figures, relabeling them for greater clarity and to make it easier for the reader to extract essential information. Genetic compensation. It would be useful for the authors to at least discuss or potentially address with data whether and to what extent compensation occurs in the context of their transgene "off" alleles, since transcriptional compensation of CRISPR mutants has been a substantial problem and if the authors methods demonstrably avoid this problem it would be another significant advantage of their method. The authors could potentially target a well characterized gene with CRISPR allele compensation and compare the effects of their targeted "off" insertion. Potential usefulness of imprecise insertions. Since imprecise insertions are more common than precise insertions, it would also be useful for the authors to at minimum discuss and if possible address with data using the different alleles they have generated whether or not imprecise insertions work as well as precise insertions for purposes of both disrupting (in "off" alleles) or allowing gene expression (in "on" alleles). Since these are intronic insertions and many of the imprecise insertions seem likely to leave the transgene largely intact, many of them may work just as well as precise insertions for their intended purposes. Also, The following line from page 4 last paragraph lines 123-124 "… gene off orientation knock down gene expression to>99% of wild type levels …" appears to say that it was knocked down less than 1% from WT levels as stated. It clearly is meant to say something closer to "gene expression was reduced BY >99% of wild type levels…" This turn of phrase was used more than once in the manuscript a careful combing of the manuscript for this error is warranted. Essential revisions: 1) Show the possibility to switch the On-Off orientation in a tissue-specific manner; in particular, demonstrate the ability to turn genes on (see comments from Reviewer 2). – Tissue-specific conditional inactivation: Using the conditional rbbp4 and rb1 alleles, we demonstrate using cell type specific proneural Cre drivers that each gene is required in the progenitor population during brain development. Conditional inactivation of rbbp4 to “off” with ascl1b-2A-Cre leads to apoptosis in the developing midbrain optic tectum (Figure 6, Figure 6—figure supplement 1 and 2). Conditional inactivation of rb1 to “off” with neurod1-2A-Cre leads to inappropriate cell cycle entry in the midbrain tectum and retina. (Figure 9, Figure 9—figure supplement 1). – Tissue-specific conditional rescue: Using the conditional rbbp4 and rb1 alleles we demonstrate the ability to turn a gene “on” and rescue a loss of function phenotype. Conditional rescue of rbbp4 to “on” with ascl1b-2A-Cre lead to a reduction in apoptosis in the midbrain, although not significant (Figure 5). Conditional rescue of rb1 to on with neurod1-2A-Cre was clear and robust (Figure 8 O), suppressing the mutant phenotype with significant reduction in the number of mutant cells throughout the midbrain and retina. – Ubiquitous conditional inactivation and rescue: By Cre injection, we demonstrate robust conditional inactivation (“on” to “off”) and induction of mutant phenotypes for both genes (Figures 6 and 9). We also demonstrate robust conditional activation (“off” to “on”) and rescue of mutant phenotypes for both genes (Figures 5 and 8). – In all cases we provide rigorous quantification and statistical analysis of phenotypic changes and measure the frequency of Cre-mediated recombination. 2) Show the possibility to trace cells with the inactive gene via fluorescent reporter activation. We corrected the mRFP gene trap in the UFlip vector by addition of the porcine virus teschovirus-1 2A peptide sequence. We isolated an rbbp4 and rbbp4 allele with this updated UFlip-2A-mRFPvector. The rbbp4 allele shows strong mRFP expression in the expected tissues (Figure 4 A – H) that is lost after Cre recombination (Figure 5, Figure 5 —figure supplement 1). The rbbp4 allele does not express mRFP (Figure 4 I-N), as expected. Introduction of Cre leads to recombination of the gene trap cassette into the active orientation and induction of mRFP expression (Figure 6, Figure 6 —figure supplement 1). 3) Test the utility of imprecise insertion, as it is not clear why it's needed to insert the construct with HDR in an intron. The rb1 allele used to establish an F3 generation has a 5’ junction with a homology arm duplication and 115 bp insertion (Figure 2C). This did not impact the function of the allele or the ability of Cre to recombine from “off” to “on”, leading to conditional rescue. The value of using HDR is an increase in the frequency of on target integration, therefore fewer adults need to be screened to identify a transmitting founder. 4) Provide a quantitative assessment of the efficiency of flipping. For each Cre recombination experiment that was performed (Figures 5, 6, 8, 9), we used quantitative PCR on genomic DNA to measure the loss of the 5’ and 3’ junctions of the original allele. Data plots are included in the main figure or in a figure supplement. 5) Strengthen the validation of the null phenotypes described, and of the expression of targeted genes. For each conditional allele that was isolated we performed RT-qPCR on embryos from each genotypic class of a conditional allele incross, to determine the impact of the targeted allele on gene expression (Figures 4, 5). Quantification of mutant phenotypes and statistical analyses to determine significance have been performed for 1. The characterization of the conditional alleles 2. The assessment of conditional rescue or inactivation. Data plots with p values are included in all figures and figure legends. Full details of the requested revisions are given in the reviews below. Reviewer #1 (Recommendations for the authors): I have few major concerns that limit in my view the impact of the manuscript. The first is that the ability of following mutagenized cells that have undergone the cassette rearrangements from the Gene-ON to Gene -OFF orientation via fluorescent tagging of the endogenous gene is not presented here. This is in my opinion the main interesting feature of this approach and unfortunately is not shown here. Instead the putative mutagenized cells are revealed only by Cre expression that may be transient and doesn't allow to follow the inversion events. We fully agree with the reviewer and thank them for requesting this critical improvement to the UFlip approach. As described above, we added a 2A peptide to our UFlip cassette and isolated new “on” and “off” alleles. These alleles show mRFP expression in the active, gene “off” orientation. Secondly, the impact of inserting such a large cassette, containing multiple fluorescent reporter ORF and an extra promoter as a transgenesis marker, on the transcription of the gene targeted and the surrounding loci should be better assessed. Ideally this should be done via RNAseq strategies as this intronic insertion could potentially affect the transcriptional landscape of the targeted region. This analysis should also reveal the exact extent of WT transcript splicing events in the mutagenic configuration now generally estimated at less than 1%. We used both RT-qPCR and phenotypic assessment to determine the impact of the cassette integration on gene expression and gene activity. As suggested, we included RT-qPCR results for the wildtype exon-exon splicing that would be disrupted by the cassette integration in the intron. We also examined splicing between exons downstream of the integration. These results demonstrate that in the gene “off” orientation endogenous gene expression is 99% knocked down. Integration in the passive “on” orientation did reduce expression in homozygotes (rbbp4 Figure 4 J reduced by 40.7%; rb1 Figure 7 J 1 reduced by 17.1%). However, the reduction in expression did not lead to mutant phenotype in heterozygotes ,or in combination with loss of function alleles (Figure 4 K-N; Figure 7, K-P), indicating gene activity was not disrupted. This may be gene dependent. Finally the authors build their strategy on their previously published GeneWeld strategy, using short homology harms to aim at precise integration in the targeted locus. This, as they discuss, reduce the efficiency of their approach compared to previously published strategies including non homology based approaches. Giving that small INDELS in an intronic integration of a large cassette most likely have little or no consequences, it is not clear to me why the use of non homology directed integration should not be favored here. At the very least, this should be tested as they have all the tools in hands to do in their target loci by targeting the same construct without the short homology harms and comparing the efficiency they obtain. The rb1 allele used for the experiments in Figures 7 and 8 has a 5’ junction with a homology arm duplication and 115 bp insertion (Figure 2C). This did not impact the function of the allele or the ability of Cre to recombine the allele from “off” to “on”, leading to conditional rescue. I believe these three points would strengthen their conclusion and help scientists to choose the best strategy when designing their conditional KO strategy. Thank you again for your critical suggestions that have vastly improved the UFlip approach to generate conditional alleles, and our manuscript. Reviewer #2 (Recommendations for the authors): In addition to the issues noted in the public review, the authors should also address a few additional points: Thank for your critical suggestions that have vastly improved the UFlip approach to generate conditional alleles, and our manuscript. Improved presentation of data. The readability of the text and "scannability" of the figures could be improved. There are a probably unnecessarily large number of somewhat confusingly designated and not always clearly labeled figures, making more work than should be required for the reader to navigate and digest the key features of this manuscript. While I do appreciate that the authors have provided a very large amount of supporting data allowing the reader to "delve into the details," the authors should consider reorganizing (if possible reducing the number of) the figures, relabeling them for greater clarity and to make it easier for the reader to extract essential information. Thank you for this suggestion. We simplified the allele designation and reorganized the manuscript substantially from the first revision. By focusing on just two genes, and repeating the same analyses for the “on” and “off” alleles for both genes, we hope this improves readability and overall “flow”. We also hope the overall presentation of the data will make it easier for the reader to grasp the major points of the manuscript. Genetic compensation. It would be useful for the authors to at least discuss or potentially address with data whether and to what extent compensation occurs in the context of their transgene "off" alleles, since transcriptional compensation of CRISPR mutants has been a substantial problem and if the authors methods demonstrably avoid this problem it would be another significant advantage of their method. The authors could potentially target a well characterized gene with CRISPR allele compensation and compare the effects of their targeted "off" insertion. This is an important topic that our approach could address. But it is well beyond the scope of our current study. Indeed, we intentionally chose essential genes with robust, well-defined loss of function phenotypes that we previously described using stable indel alleles. In our opinion, our demonstration of endogenous conditional gene inactivation, and rescue, is highly impactful and stands alone as an important step forward for the zebrafish community. Potential usefulness of imprecise insertions. Since imprecise insertions are more common than precise insertions, it would also be useful for the authors to at minimum discuss and if possible address with data using the different alleles they have generated whether or not imprecise insertions work as well as precise insertions for purposes of both disrupting (in "off" alleles) or allowing gene expression (in "on" alleles). Since these are intronic insertions and many of the imprecise insertions seem likely to leave the transgene largely intact, many of them may work just as well as precise insertions for their intended purposes. As described in the response to essential revision Point 3., we used both precise alleles and an imprecise allele (5’ homology arm duplication plus 155bp insertion). The rb1 allele used to establish an F3 generation has a 5’ junction with a homology arm duplication and 115 bp insertion (Figure 2C). This did not impact the function of the allele or the ability of Cre to recombine from “off” to “on”, leading to conditional rescue. The value of using HDR is an increase in the frequency of on target integration with both sides intact, therefore fewer adults need to be screened to identify a transmitting founder. In other words, we identified founders transmitting alleles at a rate of 9-30%. However, half or more of those alleles are missing either a 5’ or 3’ junction. So the rate of recovery of an on target integration with both a 5’ and 3’ junction, drops to 4-14%. Preselection of gene “off” injected embryos showing the gene trap reporter 2A-mRFP expression appeared to increase the efficiency of recovering an on target, precise allele (12.5 – 14% Table 1) vs. recovery of a gene “on” allele where there isn’t a marker to preselect for on target integration (rb1 4% (1/25 adults screened)). Also, The following line from page 4 last paragraph lines 123-124 "… gene off orientation knock down gene expression to>99% of wild type levels …" appears to say that it was knocked down less than 1% from WT levels as stated. It clearly is meant to say something closer to "gene expression was reduced BY >99% of wild type levels…" This turn of phrase was used more than once in the manuscript a careful combing of the manuscript for this error is warranted. Thank you for catching this. The manuscript text has been corrected.
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Danio rerio) ascl1b ensembleENSDARG00000009702
Gene (Danio rerio) neurod1 ensembleENSDARG00000019566
Gene (Danio rerio) rb1 ensembleENSDARG00000006782
Gene (Danio rerio) rbbp4 ensembleENSDARG00000029058
Strain, strain background (Danio rerio)WIKZebrafish International Resource CenterZIRC:ZL84Wildtype strain of zebrafish
Genetic reagent (Danio rerio)Tg(ascl1b-2A-Cre)McGrail labTg(ascl1b-2A-Cre; gcry1:EGFP)is75Maintained in the lab of M. McGrail (Almeida et al., 2021)
Genetic reagent (Danio rerio)Tg(neurod1-2A-Cre)McGrail labTg(neurod1-2A-Cre; gcry1:EGFP)is77Maintained in the lab of M. McGrail (Almeida et al., 2021)
Genetic reagent (Danio rerio) rb1Δ7 McGrail lab rb1Δ7is54 Maintained in the lab of M. McGrail (Solin et al., 2015)
Genetic reagent (Danio rerio) rbbp4Δ4 McGrail lab rbbp4Δ4is60 Maintained in the lab of M. McGrail (Schultz et al., 2018)
Genetic reagent (Danio rerio) Tg(rb1-UFlip-on) This paper Tg(rb1-i6-UFlip-rox-lox2272-loxP-inverted<RFP;gcry1:BFP >lox2272-loxP-rox-on)is57 Available from M. McGrail lab
Genetic reagent (Danio rerio) Tg(rb1-UFlip-off) This paper Tg(rb1-i6-UFlip-rox-loxP-lox2272<RFP;gcry1:BFP >loxP-lox2272 -rox-off)is58 Available from M. McGrail lab
Genetic reagent (Danio rerio) Tg(rb1-UFlip-off) This paper Tg(rb1-i6-UFlip-rox-loxP-lox2272<2A-RFP;gcry1:BFP >loxP-lox2272 -rox-off)is63 Available from M. McGrail lab
Genetic reagent (Danio rerio) Tg(rbbp4-UFlip-off) This paper Tg(rbbp4-i4-UFlip-rox-lox2272-loxP-<2A-RFP;gcry1:BFP >lox2272-loxP-rox-off)is61 Available from M. McGrail lab
Genetic reagent (Danio rerio) Tg(rbbp4-UFlip-on) This paper Tg(rbbp4-i4-UFlip-rox-lox2272-loxP-<2A-RFP;gcry1:BFP >lox2272-loxP-rox-on)is62 Available from M. McGrail lab
Genetic reagent (Danio rerio) Tg(rb1-stop-PRISM) This paper Tg(rb1-3XSTOP; myl7:GFP)is59 Available from M. McGrail lab
Recombinant DNA reagentpT3TS-nCas9nWenbiao ChenAddgene:46,757Plasmid for in vitro synthesis of Cas9 mRNA
Recombinant DNA reagentpT3TS-CreKarl ClarkPlasmid for in vitro synthesis of Cre mRNA, available from K. Clark lab (Clark et al., 2011)
Recombinant DNA reagentpT3TS-DreKarl ClarkDre cDNA (Anastassiadis et al., 2009) expression vector for in vitro mRNA synthesis, available from K. Clark lab
Recombinant DNA reagentp-CS2-KalTA4Martin DistelAvailable from M. Distel lab (Distel et al., 2009)
Recombinant DNA reagentpUFlip-floxed-mRFP, gcry1:BFPThis paper pUFlip(UgRNA-rox-loxP-lox2272<RFP; gcry1:BFP >loxP-lox2272-rox-UgRNA) decommissioned
Recombinant DNA reagentpUFlip-floxed-mRFP, myl7:BFPThis paper pUFlip(UgRNA-rox-loxP-lox2272<RFP; myl7:BFP >loxP-lox2272-rox-UgRNA) decommissioned
Recombinant DNA reagentpUFlip-floxed-2A-mRFP, gcry1:BFPThis paper pUFlip(UgRNA-rox-loxP-lox2272<2A-RFP; gcry1:BFP >loxP-lox2272-rox-UgRNA) available from M. McGrail lab; Deposited at Addgene
Recombinant DNA reagentpUFlip-floxed-2A-KalTA4, gcry1:BFPThis paper pUFlip(UgRNA-rox-loxP-lox2272<2A-KalTA4; gcry1:BFP >loxP-lox2272-rox-UgRNA) available from M. McGrail lab; Deposited at Addgene
Recombinant DNA reagentpSTOP-PRISM-3Xstop-myl7:GFPThis paper pPRISM(UgRNA-3XSTOP; myl7:GFP-UgRNA) available from J. Essner lab; Deposited at Addgene
Sequence-based reagentThis paperPCR primers and oligosSee Table 1
Commercial assay or kitNEBuilder HiFi DNA Assembly Cloning kitNew England BiolabsCatalog # E5520S
Commercial assay or kitPureYield Plasmid Miniprep SystemPromegaCatalog # A1223
Commercial assay or kitmMessage mMACHINE T3 Transcription KitAmbionCatalog # AM1348
Commercial assay or kitRNA Clean and Concentrator Kit (RCC)ZymoCatalog # R1013
Commercial assay or kitpCR4 TOPO TA Cloning KitThermoFisher/ InvitrogenThermoFisher:K457502
Commercial assay or kitSuperscript IIIInvitrogenCatalog # 18080093
Commercial reagentSYBR GreenBioRadCatalog # 1725271
Commercial reagentTissue-Tek O.C.T. CompoundFisherCatalog # 4,583
Software, algorithmICESynthegoInference of CRISPR Edits (ICE) https://www.synthego.com/products/bioinformatics/crispr-analysisIndel analysis of Sanger sequenced DNA
SoftwareGraphpad PRISMStatistical analyses
AntibodyRabbit polyclonal anti -Caspase-3aBD PharmingenCatalog # 559,565(1:500)
AntibodyMouse monoclonal anti-Cre RecombinaseChemiconCatalog # MAB3120(1:500)
AntibodyMouse monoclonal anti-HuC/DInvitrogenCatalog # A21271(1:500)
AntibodyMouse monoclonal anti-phospho-Histone H3 (Ser10)MilliporeCatalog # 05–806(1:500)
AntibodyRabbit polyclonal anti-phospho-Histone H3MilliporeCatalog # 06–570?(1:1000)
AntibodyRabbit polyclonal anti-Rbbp4Bethyl LaboratoriesCatalog # A301-206A(1:200)
Chemical compound, drugDAPIInvitrogenCatalog # D1306(0.5 ug/ml)
  40 in total

1.  Guidelines for ethical conduct in the care and use of animals.

Authors: 
Journal:  J Exp Anal Behav       Date:  1986-03       Impact factor: 2.468

2.  Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system.

Authors:  Li-En Jao; Susan R Wente; Wenbiao Chen
Journal:  Proc Natl Acad Sci U S A       Date:  2013-08-05       Impact factor: 11.205

Review 3.  The Ultimate qPCR Experiment: Producing Publication Quality, Reproducible Data the First Time.

Authors:  Sean C Taylor; Katia Nadeau; Meysam Abbasi; Claude Lachance; Marie Nguyen; Joshua Fenrich
Journal:  Trends Biotechnol       Date:  2019-01-14       Impact factor: 19.536

4.  Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1.

Authors:  B Sauer; N Henderson
Journal:  Proc Natl Acad Sci U S A       Date:  1988-07       Impact factor: 11.205

5.  In vivo protein trapping produces a functional expression codex of the vertebrate proteome.

Authors:  Karl J Clark; Darius Balciunas; Hans-Martin Pogoda; Yonghe Ding; Stephanie E Westcot; Victoria M Bedell; Tammy M Greenwood; Mark D Urban; Kimberly J Skuster; Andrew M Petzold; Jun Ni; Aubrey L Nielsen; Ashok Patowary; Vinod Scaria; Sridhar Sivasubbu; Xiaolei Xu; Matthias Hammerschmidt; Stephen C Ekker
Journal:  Nat Methods       Date:  2011-05-08       Impact factor: 28.547

6.  Conditional mutagenesis by oligonucleotide-mediated integration of loxP sites in zebrafish.

Authors:  Leonard Burg; Nicholas Palmer; Khrievono Kikhi; Evgeniya S Miroshnik; Helen Rueckert; Eleanor Gaddy; Carlee MacPherson Cunningham; Kenny Mattonet; Shih-Lei Lai; Rubén Marín-Juez; Richard B Waring; Didier Y R Stainier; Darius Balciunas
Journal:  PLoS Genet       Date:  2018-11-14       Impact factor: 5.917

7.  Endogenous zebrafish proneural Cre drivers generated by CRISPR/Cas9 short homology directed targeted integration.

Authors:  Maira P Almeida; Jordan M Welker; Sahiba Siddiqui; Jon Luiken; Stephen C Ekker; Karl J Clark; Jeffrey J Essner; Maura McGrail
Journal:  Sci Rep       Date:  2021-01-18       Impact factor: 4.379

8.  In vivo genome editing using a high-efficiency TALEN system.

Authors:  Victoria M Bedell; Ying Wang; Jarryd M Campbell; Tanya L Poshusta; Colby G Starker; Randall G Krug; Wenfang Tan; Sumedha G Penheiter; Alvin C Ma; Anskar Y H Leung; Scott C Fahrenkrug; Daniel F Carlson; Daniel F Voytas; Karl J Clark; Jeffrey J Essner; Stephen C Ekker
Journal:  Nature       Date:  2012-09-23       Impact factor: 49.962

9.  Rapid tumor induction in zebrafish by TALEN-mediated somatic inactivation of the retinoblastoma1 tumor suppressor rb1.

Authors:  Staci L Solin; Heather R Shive; Kevin D Woolard; Jeffrey J Essner; Maura McGrail
Journal:  Sci Rep       Date:  2015-09-08       Impact factor: 4.379

10.  Dissection of zebrafish shha function using site-specific targeting with a Cre-dependent genetic switch.

Authors:  Kotaro Sugimoto; Subhra P Hui; Delicia Z Sheng; Kazu Kikuchi
Journal:  Elife       Date:  2017-05-17       Impact factor: 8.140

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.