| Literature DB >> 35711630 |
Yue Yang1, Zhuangzhuang Jin2, Jianghua Luo3, Delong Zhang1, Peng Shen1, Dianbin Zheng1, Donghao Liu1, Lunhao Bai1.
Abstract
Reconstruction surgery for acute proximal anterior cruciate ligament (ACL) tears remains controversial. Recently, ACL primary repair has received increasing attention in ACL treatment. This study aimed to explore the histological characteristics of ACL healing in primary repair and compare its therapeutic and prognostic results with the reconstruction of acute proximal ACL tears. Histological experiments using rabbits and a prospective clinical trial were conducted. We established a rabbit model of ACL primary repair, and histological changes were observed using haematoxylin and eosin (HE) and toluidine blue staining. We performed immunohistochemical analysis of CD34 and S-100 and measured the expression of collagen I and II using qRT-PCR, Western blotting, and immunohistochemistry. The prospective clinical trial involved performing ACL primary repair and reconstruction in patients with acute proximal ACL tears to detect proprioception and evaluate the function of joints. We discovered that primary repair promoted cell proliferation in the tendon-bone transition and ligament portions, reduced osteoarthritis-like pathological changes, and maintained blood vessels and proprioceptors within the ACL. In the clinical trial, primary repair achieved similar therapeutic outcomes, including recovery of knee function and proprioception, in the follow-up period as ACL reconstruction. However, the primary repair had a significantly shorter operative time and lower cost than reconstruction. Therefore, doctors should consider the benefit of primary repair in treating acute proximal ACL tears.Entities:
Keywords: acute proximal tears; anterior cruciate ligament; histological study; primary repair; prospective clinical trial; reconstruction surgery
Year: 2022 PMID: 35711630 PMCID: PMC9195517 DOI: 10.3389/fbioe.2022.913900
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
Primers used in the study.
| Primers | 5′ to 3′ | 3′ to 5′ |
|---|---|---|
| Collagen I | GCCATCAAGGTCTTCTGCG | GAACTGGAAGCCATCGGTC |
| Collagen II | ACACTGCCAACGTCCAGATG | GTGATGTTCTGGGAGCCCTC |
|
| GGGAAGCTGGTCATCAACGG | GTACTCGGCACCAGCATCAC |
FIGURE 1Flowchart of inclusion and exclusion criteria for patients in the ACL reconstruction and primary repair groups.
FIGURE 2(A) The gross specimen of the rabbit knee and HE staining of the ACL portion and tendon-bone transition area at postoperative week 12. (B) Cell Counts of ACL portion. #: p < 0.05 versus ACLC group; *: p < 0.05 versus ACLP group. n = 12 in each group. Data are expressed as mean ± SD.
FIGURE 3(A) HE and toluidine blue staining of articular cartilage in the rabbit knee. (B) Immunohistochemistry of collagen I and II in articular cartilage. (C) Mankin scores of each group. (D) Western blotting of collagen I and II in articular cartilage. (E) Relative mRNA expression of collagen I and II in articular cartilage. #: p < 0.05 versus ACLC group; *: p < 0.05 versus ACLP group. n = 12 in each group. Data are expressed as mean ± SD.
FIGURE 4(A) Immunohistochemistry of CD34. (B) MVD value of each group according to immunohistochemistry results of CD34. (C) Immunohistochemistry of S-100 protein. (D) Statistical analysis of S-100 protein. #: p < 0.05 versus ACLC group; *: p < 0.05 versus ACLP group. n = 12 in each group. Data are expressed as mean ± SD.
Baseline characteristics of patients.
| Baseline characteristics | Group P ( | Group R ( |
| |
|---|---|---|---|---|
| Gender | Male | 11 (68.75%) | 11 (57.89%) | 0.508 |
| Female | 5 (31.25%) | 8 (42.11%) | ||
| Mean age at injury (years) | 37.00 ± 9.66 | 39.53 ± 12.81 | 0.521 | |
| Laterality of injury | Left | 8 (50.00%) | 11 (57.89%) | 0.640 |
| Right | 8 (50.00%) | 8 (42.11%) | ||
| ASA grade | I | 11 | 13 | 0.983 |
| II | 5 | 6 | ||
| III | 0 | 0 | ||
| IV | 0 | 0 | ||
| Comorbidities | Cardiovascular system disease | 3 | 4 | 0.865 |
| Respiratory system disease | 1 | 1 | 0.900 | |
| Urological system disease | 1 | 0 | 0.269 | |
| Thrombogenesis | 1 | 1 | 0.900 | |
| Metabolic disorder | 1 | 1 | 0.900 |
ASA, american society of anaesthesiologists.
FIGURE 5Visual chart of baseline characteristics and surgical data of patients. (A) Violin plots of key data: age at injury; time from injury to surgery; operation time; postoperative time of hospital stay; postoperative time of total weight stand; and costs. *: p < 0.05 versus Group P. (B) Donut diagram of sex and affected side distribution.
Surgical data.
| Parameters | Group P ( | Group R ( |
| |
|---|---|---|---|---|
| Time from injury to operation (days) | 16.5 (9–35.75) | 15 (9–35) | 0.829 | |
| Method of anaesthesia | General anaesthesia | 6 | 6 | 0.713 |
| CSEA | 10 | 13 | ||
| Operation time (min) | 73.8 (68.9–78.6) | 85.2 (78.4–91.9) | 0.007 | |
| Median time to partial standing (days) | 2 (2–3) | 2 (2–3) | >0.999 | |
| Median time to total standing (days) | 34.94 ± 4.31 | 35.11 ± 5.28 | 0.920 | |
| Postoperative length of stay (days) | 5.63 ± 2.09 | 6.26 ± 3.11 | 0.490 | |
| Postoperative complications | 0 | 0 | ||
| Cost (thousand dollars) | 5.39 ± 0.33 | 7.14 ± 0.45 | <0.001 |
Follow-up and function measurements.
| Parameters | Group P ( | Group R ( |
| |
|---|---|---|---|---|
| Age at the latest follow-up (years) | 34.5 (32–44.25) | 40 (30–54) | 0.446 | |
| Lysholm score | Preoperatively | 44.87 ± 9.66 | 43.89 ± 8.05 | 0.745 |
| 3 months postoperatively | 75.38 ± 4.33 | 73.31 ± 3.71 | 0.139 | |
| 12 months postoperatively | 91.06 ± 2.91 | 90.89 ± 2.94 | 0.867 | |
| IKDC score | Preoperatively | 40.25 ± 9.90 | 39.47 ± 9.38 | 0.813 |
| 3 months postoperatively | 76.88 ± 5.24 | 75.05 ± 6.73 | 0.385 | |
| 12 months postoperatively | 90.95 ± 2.62 | 90.99 ± 2.21 | 0.963 | |
| Kneelax value (mm) | Preoperatively | 6.52 ± 1.09 | 7.00 ± 1.01 | 0.185 |
| 3 months postoperatively | 2.38 ± 0.49 | 2.45 ± 0.43 | 0.671 | |
| 12 months postoperatively | 2.39 ± 0.47 | 2.48 ± 0.42 | 0.548 | |
FIGURE 6Function measurements of affected knee joint in Group P and Group R. (A) Lysholm score. (B) IKDC score. (C) Kneelax value. Data are expressed as mean ± SD.
Distribution of proprioceptive parameters of the knee.
| Parameters | Group P ( | Group R ( |
| |
|---|---|---|---|---|
| TDPM value of affected side | Preoperatively | 2.79 ± 0.52 | 2.72 ± 0.46 | 0.701 |
| 3 months postoperatively | 2.01 ± 0.16 | 2.04 ± 0.51 | 0.769 | |
| 12 months postoperatively | 1.39 ± 0.21 | 1.36 ± 0.19 | 0.652 | |
| TDPM value of healthy side | Preoperatively | 1.34 ± 0.12 | 1.34 ± 0.11 | 0.920 |
| 3 months postoperatively | 1.31 ± 0.14 | 1.27 ± 0.09 | 0.330 | |
| 12 months postoperatively | 1.30 ± 0.08 | 1.32 ± 0.10 | 0.488 | |
| JPR value of affected side | Preoperatively | 5.18 ± 0.88 | 4.92 ± 0.74 | 0.359 |
| 3 months postoperatively | 3.67 ± 0.55 | 3.84 ± 0.81 | 0.467 | |
| 12 months postoperatively | 2.46 ± 0.39 | 2.64 ± 0.34 | 0.155 | |
| JPR value of healthy side | Preoperatively | 2.46 ± 0.22 | 2.42 ± 0.26 | 0.468 |
| 3 months postoperatively | 2.50 ± 0.21 | 2.47 ± 0.13 | 0.646 | |
| 12 months postoperatively | 2.46 ± 0.30 | 2.42 ± 0.16 | 0.606 | |
| Total time (ms) | Affected side | 707.56 ± 92.61 | 729.89 ± 75.48 | 0.437 |
| Healthy side | 741.06 ± 84.18 | 759.42 ± 72.59 | 0.493 | |
| ICP | Affected side | 36.56 ± 8.61 | 37.53 ± 7.95 | 0.733 |
| Healthy side | 38.19 ± 7.39 | 39.32 ± 7.89 | 0.667 | |
| FFCP | Affected side | 69.75 ± 23.32 | 73.84 ± 20.70 | 0.586 |
| Healthy side | 72.88 ± 20.46 | 76.53 ± 19.44 | 0.592 | |
| FFP | Affected side | 325.69 ± 76.85 | 343.42 ± 74.00 | 0.493 |
| Healthy side | 344.75 ± 70.32 | 360.63 ± 70.12 | 0.510 | |
| FFPOP | Affected side | 275.56 ± 45.02 | 275.58 ± 44.04 | 0.999 |
| Healthy side | 285.25 ± 42.18 | 282.95 ± 42.53 | 0.874 |
FIGURE 7Proprioception of the knee in Group P and Group R. (A) JPR value. (B) TDPM value. (C) Total time, ICP, FFCP, FFP, and FFPOP. *: p < 0.05 versus healthy side in each group. Data are expressed as mean ± SD.