Literature DB >> 35709217

Genetic relationship and source species identification of 58 Qi-Nan germplasms of Aquilaria species in China that easily form agarwood.

Yong Kang1, Peiwei Liu1, Feifei Lv1, Yuxiu Zhang1, Yun Yang1, Jianhe Wei1,2.   

Abstract

Recently, Qi-Nan germplasm, the germplasm of Aquilaria species that easily forms agarwood, has been widely cultivated in Guangdong and Hainan Provinces in China. Since the morphological characteristics of Qi-Nan germplasm are similar to those of Aquilaria species and germplasm is bred by grafting, it is difficult to determine the source species of this germplasm by traditional taxonomic characteristics. In this study, we performed a DNA barcoding analysis of 58 major Qi-Nan germplasms as well as Aquilaria sinensis, A. yunnanensis, A. crassna, A. malaccensis and A. hirta with 5 primers (nuclear gene internal transcribed spacer 2 (ITS2) and the chloroplast genes matK, trnH-psbA, rbcL and trnL-trnF). This field survey in the Qi-Nan germplasm plantations in Guangdong and Hainan Provinces aimed to accurately identify the source species of Qi-Nan germplasm. According to the results, ITS2 and matK showed the most variability and the highest divergence at all genetic distances. This ITS2+matK combination, screened for with TaxonDNA analysis, showed the highest success rate in species identification of the Qi-Nan germplasm. Clustering in the phylogenetic trees constructed with Bayesian inference and maximum likelihood indicated that the Qi-Nan germplasm was most closely related to A. sinensis and more distantly related to A. yunnanensis, A. crassna, A. malaccensis and A. hirta. Therefore, this study determined that the source species of the Qi-Nan germplasm is A. sinensis.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35709217      PMCID: PMC9202955          DOI: 10.1371/journal.pone.0270167

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Agarwood is resinous wood produced when Aquilaria or Gyrinops species (of the Thymelaeaceae family) are injured [1]. This substance is a valuable natural perfume and is used in traditional Chinese medicine to relieve pain and warm the middle to reduce vomiting [2]. Worldwide, agarwood has widely featured in cultural, religious, and medicinal practices as well as other areas [3]. In the past, Aquilaria species were identified solely on the morphological characteristics of the flowers, seeds and fruits. However, this identification method can be subjective, so the classification of Aquilaria species remains unclear. Most studies have suggested that there are approximately 20 Aquilaria species in the tropical regions of Southeast Asia [4, 5], but in China, only A. sinensis and A. yunnanensis have been recorded [6]. Because of agarwood’s high economic, collection and medicinal value, it is increasingly sought worldwide, which has led to the damage and destruction of Aquilaria species. In addition, wild Aquilaria resources have increasingly been exhausted due to urbanization, especially in India, Myanmar, Malaysia, Vietnam, Indonesia and other Southeast Asian countries. Therefore, in order to minimize the harvesting and destruction of wild Aquilaria species, about 20 Aquilaria species have been listed in the International Union for the conservation of nature (IUCN) Red List of Threatened Species in 1998 [7], and have also been listed in Appendix II of the Convention on International Trade in Endangered Species (CITES) in 2005 [8]. Currently, one of the most effective ways to solve the shortage of agarwood is to cultivate Aquilaria species. China was one of the first countries to alleviate the loss of wild agarwood and protect wild agarwood resources by cultivating Aquilaria species, mainly through seed propagation, tissue culture, cutting and grafting propagation [9]. Since the 1980s, large-scale seed reproduction of Aquilaria species has taken place in Hainan, Guangdong, Guangxi, and Yunnan Provinces as well as other places in China [10]. However, most of the seeds used for seed propagation have originated from previously cultivated or wild mature plants. Seeds of Aquilaria species cannot be stored for long periods, and this, coupled with the lack of systematic breeding and germplasm confusion, has led to poor agarwood quality and yields [11]. In tissue culture of Aquilaria species, rooting is the main factor restricting reproduction [12]. Cutting propagation of these species is difficult to control, and plants have low survival rates according to Niu et al., the survival rate of lignified cuttings was 22% in summer but only 12% in winter [13]. Finally, the beneficial traits of the parent Aquilaria species can be preserved through grafting propagation [14]. Germplasm resources carry genetic information and have actual or potential utilization value, they mainly include material from plants, animals, and microorganisms. Plant germplasm resources mainly include those for crops, traditional Chinese medicine and forests [15]. Qi-Nan germplasm is a forest germplasm resource resulting from grafting propagation and retains the excellent agarwood-forming predisposition of its parents. Grafting propagation can also be used to obtain germplasm resources that are easy to collect and genetically stable, thereby protecting wild Aquilaria species. In recent years, farmers have relied on experience to find wild, highly fragrant Aquilaria species in Dianbai, Guangdong Province. They then transplant these species to their homes to serve as a Qi-Nan germplasm seed tree and use the branches of the seed tree as the scion for grafting propagation. However, the main propagation method of farmers is grafting the branches of Qi-Nan germplasm seed trees to cultivated Aquilaria species. Most of these seed trees come from Huizhou, Maoming, Shenzhen, Hong Kong, Hainan Province and other places in China. Thus, Qi-Nan germplasm easily forms agarwood, and the yield and extract content of its agarwood are higher than those of general agarwood. In recent years, Qi-Nan germplasm has been extensively cultivated in Guangdong, Guangxi, and Hainan Provinces as well as other places in China due to agarwood’s scarcity and value. Each grower claims that the agarwood produced by their Qi-Nan germplasm has a high oil content, strong fragrance, and is rapidly formed. However, the source species of many Qi-Nan germplasms remain unclear. The source species has variously been proposed to be a domestic Aquilaria species, an alien Aquilaria species, or even a new species. At present, many Qi-Nan germplasms are cultivated in China, with substantial variability in plant size, leaf shape, stem morphology and agarwood-forming performance. However, the source species and genetic relationship of these germplasms remain unknown, which limits their use and protection. According to this review, the source species of different Qi-Nan germplasms and their genetic relationships are the main factors restricting the application and promotion of this germplasm. DNA barcoding has been widely applied to identify Aquilaria species. Jiao et al. extracted DNA from A. sinensis wood tissue and reported that trnL-trnF and ITS1 could be used to construct a phylogenetic tree of A. sinensis [16]. Lee et al. found that the phylogenetic tree constructed by with trnL-trnF and ITS2 could be used to identify Aquilaria species [5]. Additionally, Li et al. analyzed A. sinensis, A. yunnanensis and A. crassna with three DNA barcodes and found two combinations (ITS+matK and ITS+trnL-trnF) that could identify these three species [17]. Eurlings et al. further suggested that the trnL-trnF fragment provides a new method of molecular identification for Aquilaria and Gyrinops species [18]. In a preliminary study of Aquilaria species from different countries, matK and combinations thereof facilitated the accurate identification of multiple Aquilaria species [19]. In summary, although DNA barcoding allows the identification of many Aquilaria species, the application of DNA barcoding fragments or combinations of materials differ substantially. In addition, few reports have utilized DNA barcoding to identify the main Qi-Nan germplasm. In this study, DNA barcode technology was used to determine the molecular identification of Qi-Nan germplasm and in subsequent analysis to explore differences in the applicable fragments or combinations. Thus, we used DNA barcode technology to identify the source species of Qi-Nan germplasm. In this study, we selected 58 different types of Qi-Nan germplasms from popular markets and included A. sinensis, A. yunnanensis, A. malaccensis, A. crassna, and A. hirta as the research objects. Five DNA barcode sequences (ITS2, matK, trnH-psbA, rbcL and trnL-trnF) were compared in sequence to screen for the barcode fragment or combination most suitable for identifying the source species of Qi-Nan germplasm. Then, the phylogenetic trees of the Qi-Nan germplasm and the five Aquilaria species were constructed with the best combination. Finally, the source species of the Qi-Nan germplasm was identified according to the clustering of the phylogenetic trees.

Materials and methods

Materials

A total of 65 test materials were used in this study (S1 Table). The Qi-Nan germplasm plantation in Guangdong and Hainan Provinces provided 58 mainstream Qi-Nan germplasm resources. Their Chinese folk names are as follows: Qianlixiang, Jinshaozi, Lvyouwang, Youyezi, Wuming2, Jinshaye, Jianyezi, Ziqi, Zhangshaozi, Genmaidaye, Dayepo, Lanbaoshi, Putaoteng, Honggujianye, Wuming1, Tianxiang2, Tieshao, Xiaoyezi, Jianyewang, Wushenyuanye, Toudinglv, Xiguaye, Kuaishu, Zhitianjiao, XiangFei, Jianyeliu, Tangjie, Youbawang, Xiangjian, Xiangyouwang, Tianxiang1, Heizhenzhu, Jinlv, Ruhuchangye, Ruhuyuanye, Youshao, Zidantou, Dashao, Xiangshi3, Xiangshi4, Xiangshi8, Xiangshi13, Zhouyezi, Ziluolan, Diwanggu, Shisansuo, Yuanyobolang, Bohelv, Liuyouwang, Yinggelv, Diaoyouwang, Xiaoyingtao, Baozhayou, Hutoumen, Huizhouchenxiang, Zhongshannizhong, Guanxiang1, and Guanxiang2. In addition, we also selected 5 Aquilaria species that were accurately identified in the previous stage for comparison: A. sinensis, A. yunnanensis, A. malaccensis, A. crassna and A. hirta. Fresh and intact leaves of the 65 samples were collected and dried with silica gel for preservation. The grafting and agarwood-forming process as well as the whole Qi-Nan germplasm plant are shown in Fig 1 and S1 Fig. The fruits of the Aquilaria species used in this study are shown in Fig 2.
Fig 1

Grafting and agarwood formation with Qi-Nan germplasm.

A and B: Grafting of Qi-Nan germplasm. C and D: Agarwood formation with Qi-Nan germplasm.

Fig 2

Fruits of Qi-Nan germplasm and five accurately identified Aquilaria species.

A: Qi-Nan germplasm. B: A. sinensis. C: A. yunnanensis. D: A. malaccensis. E: A. crassna. F: A. hirta.

Grafting and agarwood formation with Qi-Nan germplasm.

A and B: Grafting of Qi-Nan germplasm. C and D: Agarwood formation with Qi-Nan germplasm.

Fruits of Qi-Nan germplasm and five accurately identified Aquilaria species.

A: Qi-Nan germplasm. B: A. sinensis. C: A. yunnanensis. D: A. malaccensis. E: A. crassna. F: A. hirta.

Methods

DNA extraction, PCR amplification and sequencing

Genomic DNA of the 65 samples was extracted using the Plant Genomic DNA Kit (Tiangen Biotech, Beijing, China), following the manufacturer’s instructions. Universal primers were used for PCR amplification of ITS2, matK, trnH-psbA, rbcL and trnL-trnF. Final volume of each PCR reaction was 25ul and contained 2ul DNA template, 1ul each of forward and reverse primers, 12.5ul PCR Master Mix (2X, Tiangen Biotech, Beijing, China) and 8.5ul deionized water. Optimization and adjustments were made according to the PCR conditions reported in Table 1 [20]. The PCR products were resolved by electrophoresis on 1.5% agarose gel. All amplified products were sequenced by Guangzhou IGE Biotechnology Co., Ltd. The DNA sequencing method used the Sanger method, and DNA sequencing was performed in ABI PRISM 3730xl Genetic Analyzer (Applied Biosystems, USA).
Table 1

Details on the PCR primers used in this study.

DNA barcodePrimerPrimer sequence (5’-3’)PCR conditions
ITS2 [21]ITS-S2F ATGCGATACTTGGTGTGAAT 94°C for 5 min; [94°C for 30 s, 56°C for 30 s, 72°C for 45 s] × 40 cycles; 72°C for 10 min.
ITS-S3R GACGCTTCTCCAGACTACAAT
matK (Kim, unpublished)3F_KIM CGTACAGTACTTTTGTGTTTACGAG 94°C for 1 min; [94°C for 30 s, 52°C for 20 s, 72°C for 50 s] × 35 cycles; 72°C for 5 min.
1R_KIM ACCCAGTCCATCTGGAAATCTTGGTTC
rbcL [22]a_F ATGTCACCACAAACAGAGACTAAAGC 95°C for 4 min; [94°C for 30 s, 55°C for 1 min, 72°C for 1 min] × 35 cycles; 72°C for 10 min.
a_R CTTCTGCTACAAATAAGAATCGATCTC
trnH-psbA [23, 24]trnHf_05 CGCGCATGGTGGATTCACAATCC 94°C for 5 min; [94°C for 1 min, 55°C for 1 min, 72°C for 90 s] × 30 cycles; 72°C for 7 min.
psbA3-f GTTATGCATGAACGTAATGCTC
trnL-trnF [25]e GGTTCAAGTCCCTCTATCCC 94°C for 5 min; [94°C for 45 s, 50°C for 45 s, 72°C for 90 s] × 30 cycles; 72°C for 10 min.
f ATTTGAACTGGTGACACGAG

Data analysis

Sequence editing, alignment and splicing, and computation of genetic distances were mostly completed in BioEdit [26] and Sequencematrix [27]. The PCR amplification success rate and sequencing success rate were determined following Kress [28]. Information on the length of amplification, variable sites, conserved sites, parsimony informative sites, singleton sites and genetic distances of each fragment was collected in MEGA X [29]. The species identification success rate was evaluated according to the “best match”, “best close match” and “all species barcodes” (BBA) method in TaxonDNA software [30] to identify the single fragment or combination with the highest success rate. Next, phylogenetic trees were generated using the Bayesian interference (BI) and maximum likelihood (ML) approaches in MrBayes 3.2.6 [31] and PAUP 4b (http://paup.phylosolutions.com), respectively. The clusters in the phylogenetic tree constructed by the best sequence combination were subsequently analyzed. Figtree 1.4.3 (http://tree.bio.ed.ac.uk/software/figtree/) were used generate visually appealing phylogenetic trees. Genetic distance and phylogenetic tree construction were mapped in R 4.0.0 (https://www.r-project.org). The GenBank accession numbers of all DNA fragments in this study are shown in S2 Table.

Results

PCR amplification and DNA sequencing

This test included 58 samples of Qi-Nan germplasm and 7 samples from Aquilaria species. The ITS2, matK, trnH-psbA, rbcL and trnL-trnF sequences of all samples were subjected to PCR amplification and sequencing. A total of 650 sequences were obtained by forward and reverse sequencing. The success of PCR amplification and sequencing, as well as the sequence length, variable sites, conserved sites, parsimony informative sites and singleton sites are shown in Table 2. PCR amplification of five DNA barcoding loci was successful in all samples. Except for the trnL-trnF sequence (which had a sequencing success rate of 0%), the other sequences achieved a sequencing success rate of 100%. Moreover, the sequencing quality of trnL-trnF was repetitive, which was not suitable for sequence alignment, assembly and analysis in this study. The number of variable sites for each sequence was as follows: ITS2 (11) > matK (9) > rbcL (1) = trnH-psbA (1). The number of conserved sites for each sequence was as follows: matK (672) > rbcL (539) > ITS2 (439) > trnH-psbA (356). The number of parsimony informative sites for each sequence was as follows: matK (6) = ITS2 (6) > rbcL (0) = trnH-psbA (0). Finally, the number of singleton sites for each sequence was as follows: ITS2 (5) > matK (3) > trnH-psbA (1) > rbcL (0). However, the fragment combinations with the largest number of variable sites were ITS2+matK (20), ITS2+matK+rbcL (21), ITS2+matK+trnH-psbA (21) and ITS2+matK+rbcL+trnH-psbA (22). It can also be inferred that ITS2 and matK play an important role in the genetic information sites of all primer fragments.
Table 2

Evaluation of the five DNA barcode loci.

DNA barcodePCR success (%)Sequencing success (%)Sequence lengthNo. of variable sitesNo. of conserved sitesNo. of parsimony informative sitesNo. of singleton sites
ITS21001004511143965
matK 100100682967263
rbcL 100100540153900
trnH-psbA 100100363135601
trnL-trnF 1000 (Repetitive sequence)-----
ITS2+matK--1133201111128
ITS2+rbcL--9911297865
ITS2+trnH-psbA--8141279566
matK+rbcL--122210121163
matK+trnH-psbA--104510102864
rbcL+trnH-psbA--903289501
ITS2+matK+rbcL--1673211650128
ITS2+matK+trnH-psbA--1496211467129
ITS2+rbcL+trnH-psbA--135413133466
matK+rbcL+trnH-psbA--158511156764
ITS2+matK+rbcL+trnH-psbA--2036222006129

Genetic distance

Of the four DNA barcodes, ITS2 and matK had large average genetic distances, while trnH-psbA had a smaller average genetic distance, the average genetic distance of rbcL was 0 (Fig 3). In the ITS2 region, the interspecific distance between the Qi-Nan germplasm and A. crassna was 0.0022±1.73E-18, the intraspecific distance among the Qi-Nan germplasms was 0, the interspecific distance between the Qi-Nan germplasm and A. hirta was 0.0203±2.08E-17, the interspecific distance between the Qi-Nan germplasm and A. malaccensis was 0.0157±0, the interspecific distance between the Qi-Nan germplasm and A. sinensis was 0, and the interspecific distance between the Qi-Nan germplasm and A. yunnanensis was 0.0090±1.04E-17. In the matK region, the interspecific distance between the Qi-Nan germplasm and A. crassna was 0.0091±5.20E-18, the intraspecific distance among the Qi-Nan germplasms was 0, the interspecific distance between the Qi-Nan germplasm and A. hirta was 0.0091±3.47E-18, the interspecific distance between the Qi-Nan germplasm and A. malaccensis was 0.0012±4.34E-19, the interspecific distance between the Qi-Nan germplasm and A. sinensis was 0, and the interspecific distance between the Qi-Nan germplasm and A. yunnanensis was 0.0039±3.90E-18. However, all genetic distances were 0 in the rbcL region. In the trnH-psbA region, the interspecific distance between the Qi-Nan germplasm and A. hirta was 0.0027±9.38E-07, the interspecific distance between the Qi-Nan germplasm and A. sinensis was 0.0027±9.47E-07, and the other genetic distances were 0. In addition, Wilcoxon signed-rank tests further confirmed that ITS2 and matK had the highest divergence in all genetic distances (Fig 3).
Fig 3

Genetic distances between 58 Qi-Nan germplasms and the Aquilaria species for a single region.

(GC: interspecific distance between the Qi-Nan germplasm and A. crassna. GG: intraspecific distance among the Qi-Nan germplasms. GH: interspecific distance between the Qi-Nan germplasm and A. hirta. GM: interspecific distance between the Qi-Nan germplasm and A. malaccensis. GS: interspecific distance between the Qi-Nan germplasm and A. sinensis. GY: interspecific distance between the Qi-Nan germplasm and A. yunnanensis. *: P<0.05, NS: not significant).

Genetic distances between 58 Qi-Nan germplasms and the Aquilaria species for a single region.

(GC: interspecific distance between the Qi-Nan germplasm and A. crassna. GG: intraspecific distance among the Qi-Nan germplasms. GH: interspecific distance between the Qi-Nan germplasm and A. hirta. GM: interspecific distance between the Qi-Nan germplasm and A. malaccensis. GS: interspecific distance between the Qi-Nan germplasm and A. sinensis. GY: interspecific distance between the Qi-Nan germplasm and A. yunnanensis. *: P<0.05, NS: not significant). In the multilocus combinations, ITS2+matK had the highest genetic distances compared with the other barcode combinations (Fig 4). In the ITS2+matK region, the interspecific distance between the Qi-Nan germplasm and A. crassna was 0.0066±5.20E-18, the intraspecific distance among the Qi-Nan germplasms was 0, the interspecific distance between the Qi-Nan germplasm and A. hirta was 0.0132±1.73E-17, the interspecific distance between the Qi-Nan germplasm and A. malaccensis was 0.0066±4.34E-18, the interspecific distance between the Qi-Nan germplasm and A. sinensis was 0, and the interspecific distance between the Qi-Nan germplasm and A. yunnanensis was 0.0058±1.73E-18.
Fig 4

Genetic distances between 58 Qi-Nan germplasms and the Aquilaria species for multilocus combinations.

(GC: interspecific distance between the Qi-Nan germplasm and A. crassna. GG: intraspecific distance among the Qi-Nan germplasms. GH: interspecific distance between the Qi-Nan germplasm and A. hirta. GM: interspecific distance between the Qi-Nan germplasm and A. malaccensis. GS: interspecific distance between the Qi-Nan germplasm and A. sinensis. GY: interspecific distance between the Qi-Nan germplasm and A. yunnanensis).

Genetic distances between 58 Qi-Nan germplasms and the Aquilaria species for multilocus combinations.

(GC: interspecific distance between the Qi-Nan germplasm and A. crassna. GG: intraspecific distance among the Qi-Nan germplasms. GH: interspecific distance between the Qi-Nan germplasm and A. hirta. GM: interspecific distance between the Qi-Nan germplasm and A. malaccensis. GS: interspecific distance between the Qi-Nan germplasm and A. sinensis. GY: interspecific distance between the Qi-Nan germplasm and A. yunnanensis).

Species discrimination

Preliminary evaluation of the DNA sequences showed that the trnL-trnF sequence was mostly repetitive and has a double peak. Therefore, only the 4 primers (ITS2, matK, trnH-psbA and rbcL) were selected for sequence screening and analysis. TaxonDNA analysis showed that the species identification success rate of each fragment or combination was different (Table 3). Of the single loci, ITS2 and matK were the best, the correct match rates of “best match”, “best close match” and “all species” for these two sequences were 93.84%. In contrast, rbcL had the lowest successful identification rate (0.00%). The multi fragment combinations ITS2+matK, ITS2+rbcL, matK+rbcL, matK+trnH-psbA, ITS2+matK+rbcL, ITS2+matK+trnH-psbA, matK+rbcL+trnH-psbA and ITS2+matK+trnH-psbA+rbcL had the highest success rate, the correct match rates of “best match”, “best close match” and “all species” for these combinations were 93.84%. However, only ITS2+matK and ITS2+matK+rbcL had the lowest ambiguity (1.53%) under the “all species” method. In addition, the success rate of these two fragment combinations was equivalent to that of three or four of the other fragments. Therefore, to facilitate analysis, we selected ITS2+matK to construct the phylogenetic tree.
Table 3

Species identification success rate based on TaxonDNA analysis.

C, A, I, and N represent correct, ambiguous, incorrect and no match, respectively.

RegionBest match (%)Best close match (%)All species (%)
CAICAINCAIN
ITS293.840.006.1593.840.006.150.0093.844.611.530.00
matK 93.840.006.1593.840.006.150.0093.843.073.070.00
rbcL 0.00100.000.000.00100.000.000.0090.769.220.000.00
trnH-psbA 1.5398.460.001.5398.460.000.003.0796.920.000.00
ITS2+matK93.840.006.1593.840.006.150.0093.841.534.610.00
ITS2+rbcL93.840.006.1593.840.006.150.0093.844.611.530.00
ITS2+trnH-psbA93.840.006.1593.840.006.150.004.6193.841.530.00
matK+rbcL93.840.006.1593.840.006.150.0093.843.073.070.00
matK+trnH-psbA93.840.006.1593.840.006.150.0093.844.611.530.00
rbcL+trnH-psbA1.5396.921.531.5396.921.530.003.0796.920.000.00
ITS2+matK+rbcL93.840.006.1593.840.006.150.0093.841.534.610.00
ITS2+matK+trnH-psbA93.840.006.1593.840.006.150.0093.843.073.070.00
ITS2+rbcL+trnH-psbA93.840.006.1593.840.006.150.004.6193.841.530.00
matK+rbcL+trnH-psbA93.840.006.1593.840.006.150.0093.844.611.530.00
ITS2+matK+rbcL+trnH-psbA93.840.006.1593.840.006.150.0093.843.073.070.00

Species identification success rate based on TaxonDNA analysis.

C, A, I, and N represent correct, ambiguous, incorrect and no match, respectively.

Phylogenetic trees

The phylogenetic tree constructed with Bayesian inference (BI) and ITS2+matK is presented in Fig 5. The results showed that all 58 samples of Qi-Nan germplasm were significantly clustered with A. sinensis_1, A. sinensis_2 and A. sinensis_3, but separate from A. crassna, A. hirta, A. malaccensis and A. yunnanensis. Additionally, the phylogenetic tree constructed with the maximal likelihood method and ITS2+matK is presented in Fig 6. The results of ML analyses were similar to those of BI analyses: all Qi-Nan germplasms were clustered with A. sinensis_1, A. sinensis_2 and A. sinensis_3. In conclusion, the phylogenetic tree clustering showed that the 58 Qi-Nan germplasms were genetic closest to A. sinensis but were less closely related to the other four Aquilaria species.
Fig 5

The phylogenetic tree of the 58 Qi-Nan germplasms and five Aquilaria species, constructed with Bayesian inference and the ITS2 + matK combination.

Fig 6

The phylogenetic tree of the 58 Qi-Nan germplasms and five Aquilaria species, constructed with maximum likelihood and the ITS2 + matK combination.

Discussion

DNA barcoding evaluation of the 58 Qi-Nan germplasms

According to the screening of the 5 DNA primers, single fragment ITS2 and matK had the most variation sites (Table 2). The phylogenetic tree clustering constructed by the ITS2+matK combination was the most significant. This finding was similar to the results of a preliminary analysis of Aquilaria species in different countries, which concluded that matK played an important role in identifying Aquilaria species [19]. Indeed, matK is one of the fastest-evolving genes in the protein-coding region of the chloroplast genome [32] and plays an important role in the molecular identification of many plants. For example, Steane et al. determined the evolution of Casuarina species with the matK sequence [33] and Asparagus racemosus is effectively identified with the matK sequence [34]. Furthermore, the matK+rbcL combination helped identify Acacia accurately [35]. In addition, Chen et al. determined that the ITS2 sequence served as a universal barcode for medicinal plants based on extensive experimental data [36], as it has shorter elements than ITS and a higher success rate in PCR amplification and sequencing [37]. In addition, compared with cpDNA or nuclear barcodes alone, a combination of the two better identified different species [38]. The genetic distances between the 58 Qi-Nan germplasms and five Aquilaria species showed genetic divergences mainly in ITS2 and matK, while trnH-psbA had few divergences (Fig 3). In addition, the genetic distances of ITS2 and matK were largest between the Qi-Nan germplasm and A. crassna, A. hirta, A. malaccensis, and A. yunnanensis, but there was no genetic distance between the Qi-Nan germplasm and A. sinensis. Moreover, the genetic distances of trnH-psbA were largest between the Qi-Nan germplasm and A. hirta and A. sinensis, but these values were lower than 0.003. The rbcL fragment did not show any genetic distances between the Qi-Nan germplasm and Aquilaria species. Thus, we inferred that ITS2 and matK were ideal barcodes in this study [39], that variation in the trnH-psbA is low [40], and that the coding sequence of rbcL is highly conserved [41]. According to the species identification rates of 4 high quality sequences analyzed by the BBA method in TaxonDNA, the multifragment combinations ITS2+matK, ITS2+rbcL, matK+rbcL, matK+trnH-psbA, ITS2+matK+rbcL, ITS2+matK+trnH-psbA, matK+rbcL+trnH-psbA and ITS2+matK+trnH-psbA+rbcL had the highest success rate (Table 3). Since a 2-fragment combination is more efficient and reduces the cost of sequencing, the ITS2+matK combination was selected to analyze the clustering of the phylogenetic trees. This differs from previous research on the DNA barcoding identification of Aquilaria species, as Lee et al. concluded that the phylogenetic tree constructed by ITS2+trnL-trnF was suitable for Aquilaria species [5], and Li et al. found that the phylogenetic tree constructed by the combination of ITS+matK and ITS+trnL-trnF was conducive to species identification in three Aquilaria species [17]. Other research indicated that the trnL-trnF sequence could provide molecular identification of Aquilaria species [18]. However, the trnL-trnF sequence was not applicable in this study. This difference could possibly be explained by differences in test materials or tree-building methods with the adopted DNA barcodes or combinations. In the current study, the trnL-trnF sequence was mostly repetitive, which was not conducive to conducting a cluster analysis of the phylogenetic tree. Thus, ITS2+matK was selected for cluster analysis of the phylogenetic tree of Qi-Nan germplasm and Aquilaria species.

Genetic relationship and source species of the 58 Qi-Nan germplasms

Through comparison of plant morphology, the fruit of the Qi-Nan germplasm was found to be the closest to the fruit of A. sinensis in shape and size (Fig 2). Previously, Aquilaria species were mainly classified by the characteristics of their flowers and fruits [5, 42, 43]. A. sinensis was chiefly identified by a moderate calyx that did not wrap the fruit, smooth seed coat without yellow pubescence, and long seed appendages. A. yunnanensis features oval fruit, a smaller and scattered calyx, and seeds densely coated by pubescence [6]. A. malaccensis has round fruit and a small calyx that degrades after the fruit ripens, and A. crassna features oval or relatively round fruit, a larger fruit and calyx, with the fruit usually wrapped in the calyx, and thick and leathery leaves [44]. Therefore, the source species of the Qi-Nan germplasm was inferred to be A. sinensis based on plant morphology. Whether in the single regions or multilocus combinations, the intraspecific distance among the 58 Qi-Nan germplasms (GG) was 0, and the interspecific distance between the Qi-Nan germplasm and A. sinensis (GS) was the smallest (Figs 3 and 4). This finding indicates that different types of Qi-Nan germplasm significantly differ in plant morphology and agarwood quality. However, the 58 Qi-Nan germplasms selected did not significantly differ in molecular identification, and all were most closely related to A. sinensis. Genetic distances can also reflect the relationship between different species and germplasms. For example, Zheng et al. found that ITS2 not only quickly and accurately identifies Fritillaria cirrhosa and its related species but also that the genetic relationship between different Fritillaria species is clearly explained by the genetic distance between F. cirrhosa and its related species [45]. When Zhang et al. analyzed the genetic distance and phylogenetic tree of Phellodendron amurense samples, they found that the genetic distance was important in the analysis and identification of the genetic relationship of Phellodendron species [46]. The BI and ML phylogenetic trees constructed by the ITS2+matK combination showed that all 58 Qi-Nan germplasms were closely related to A. sinensis but less closely related to A. yunnanensis A. crassna, A. malaccensis and A. hirta (Figs 5 and 6). Approximately 20 Aquilaria species are found in tropical parts of Southeast Asia [4, 5]. Huo et al. were one of the earliest to classify and describe the morphological characteristics of Aquilaria species, creating 12 categories of Aquilaria plants in the Thymelaeaceae family [44]. Recent research also indicated that Aquilaria plants in Asia could be divided into 13 species [47]. Of these, only A. sinensis and A. yunnanensis are found in China, the former is mostly distributed in Guangdong, Guangxi and Hainan Provinces, and the latter is only found in Xishuangbanna [6]. According to our preliminary visit to a plantation of Qi-Nan germplasm, the Qi-Nan germplasm currently cultivated in Guangdong was obtained by grafting (Fig 1). First, the branches of wild Aquilaria trees were grafted onto A. sinensis, after maturity the germplasm was propagated by grafting branches onto cultivated trees. The scion was mainly wild A. sinensis from Huizhou, Dianbai, Shenzhen, Hong Kong, and Hainan Province in China. According to the geographical distribution of Aquilaria species and the results of the phylogenetic tree, the source species of Qi-Nan germplasm cultivated in China is A. sinensis. However, DNA barcoding still has certain limitations and failed to resolve differences among Qi-Nan germplasm resources. Our group is currently attempting to carry out a thorough study using inter simple sequence repeats (ISSR) and random amplified polymorphic DNA (RAPD) molecular markers as well as other techniques. For example, ISSR and RAPD molecular marker techniques were used to analyze the genetic diversity of three widely planted Qi-Nan germplasms (A11, R21 and B31) in the market. It was found that they had high genetic diversity and high degree of genetic differentiation at the species level. And A11, R21 and B31 can be distinguished by genetic distance and cluster analysis [48, 49].

The relationship between “Qi-Nan” agarwood and Qi-Nan germplasm

“Qi-Nan” agarwood has different names in different countries and regions, including Chinese names (e.g., Qinan, Jianan, and Jialuo) and English names (e.g., Qi-Nan, Kanankoh, Kyara and Chi-Nan) [50]. Historical records reported “Qi-Nan” agarwood as an Aquilaria species in the traditional sense, referring to top-grade agarwood formed under extremely demanding conditions that was rich in resin, elegant in fragrance and dark in color. These harsh conditions mainly mean that the incense tree is damaged by lightning and thunder, hurricane blowing, insect bites or artificial felling, and the formation of agarwood takes decades or even hundreds of years [51]. It was named for its mysterious scent that could be achieved without burning the wood and was distinguished from other types of agarwood as the most expensive and top-quality due to its unique smell and appearance [52]. “Qi-Nan” agarwood is further divided according to appearance and color into green Qi-Nan, purple Qi-Nan, black Qi-Nan, yellow Qi-Nan, etc. [51, 53]. At present, the market price of “Qi-Nan” agarwood has far exceeded that of general agarwood.

Conclusion

We showed in this study that a combination barcode of ITS2+matK is useful for source species identification of 58 Qi-Nan germplasms. This paper is the first to use DNA barcoding to identify Qi-Nan germplasm cultivated in China and report that it originated from A. sinensis. These findings may inform the future promotion and application of agarwood produced from Qi-Nan germplasm. First of all, this will help us to master the growth habit and morphological characteristics of different varieties of Qi-Nan germplasm, as well as the selection and breeding of new varieties of Aquilaria species in the future by carrying out the investigation of Qi-Nan germplasm. Secondly, the use of DNA barcoding to identify the source species of different varieties of Qi-Nan germplasm can build a molecular identification system of Qi-Nan germplasm, which is helpful to analysis the relationship of Qi-Nan germplasm with domestic and foreign Aquilaria species. Finally, we can formulate classification standards for the use of this germplasm, and provide identification information of different varieties of Qi-Nan germplasm in the resource market, scientific research and authenticity identification of agarwood in the future.

Whole plants of selected Qi-Nan germplasms.

A: CN-TJ-DA. B: CN-QLX-DB. C: CN-JSY-DB. D: CN-DYP-DB. E: CN-LBS-DB. F: CN-LYW-DB. G: CN-ZTJ-DB. H: CN-ZSZ-DB. I: CN-XS3HCQ-XL. (TIF) Click here for additional data file.

List of the samples of 58 Qi-Nan germplasms and five Aquilaria species used in this study.

Includes the name, sample numbers, origins, locations and notes of each sample. (XLSX) Click here for additional data file.

GenBank accession numbers of the Qi-Nan germplasm and Aquilaria species generated in this study.

(XLSX) Click here for additional data file. 7 Apr 2022
PONE-D-22-07044
Genetic relationship and source species identification of 58 Qi-Nan germplasms of Aquilaria species in China that easily form agarwood
PLOS ONE Dear Dr. KANG, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by May 22 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Pankaj Bhardwaj, Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf. 2. Please remove your figures from within your manuscript file, leaving only the individual TIFF/EPS image files, uploaded separately.  These will be automatically included in the reviewers’ PDF. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The authors have attempted to identify germplasm resources of Aquilaria species using DNA barcoding analysis with the help of one nuclear and chloroplast genes or their combination. The manuscript is well written and the results are clearly presented. However, to get a better resolution of genetic differences, it is highly recommended to use molecular markers like SSR or ISSR or a combination of DNA barcoding and these molecular markers. Reviewer #2: “Qi-Nan” is an important agarwood species valued for its fragrance and medicinal importance. Authors have made efforts to identify its source species using DNA barcoding analysis and inferred A. sinensis. to be the source species of “Qi-Nan”. The overall quality of manuscript the way it is written needs to be improved. My major concerns are as below: 1. Please mark Figure 1 properly 2. In line 136, please provide the full detail of the DNA isolation kit used. 3. It will be appropriate the address the primer pairs used in this study as universal primers rather than common primers (LINE 136) 4. Please rewrite methods sections, some of the information is duplicated while some sections need elaboration e.q.1) Data analysis section contain the duplicated information 2) the name of sequencing platform and the methodology of sequencing is not provided 5. Reference 2 is not complete 6. In general, few references are misleading in the manuscript. Authors are requested to recheck the citation used in the manuscript 7. It would have been appropriate to dedicate the last section of discussions to conclusion and future aspects but the last section appears more of the introductory part of the manuscript ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: PONE-D-22-07044_reviewer (1).pdf Click here for additional data file. 12 May 2022 Dear Dr. Pankaj Bhardwaj, Academic Editor, PLOS ONE We would like to thank you and the two reviewers for your careful and thoughtful consideration of our manuscript. In particular, we were pleased that the Editor and reviewers were interested in the identification of Qi-Nan germplasms. We have taken care to integrate the suggestions brought up during review and feel that the paper is greatly improved by the process. We are confident that we have addressed the concerns brought up during review. Sincerely, Yong Kang Comment is from Reviewer 1 Comment: The authors have attempted to identify germplasm resources of Aquilaria species using DNA barcoding analysis with the help of one nuclear and chloroplast genes or their combination. The manuscript is well written and the results are clearly presented. However, to get a better resolution of genetic differences, it is highly recommended to use molecular markers like SSR or ISSR or a combination of DNA barcoding and these molecular markers. Response: Thank you very much for your advice. DNA barcoding technology has been widely used in species identification, especially in the identification of closely related species and germplasm resources. It has the advantages of strong objectivity, high accuracy and rapid identification. The combinations ITS2+matK had the highest success rate, the correct match rates of “best match”, “best close match” and “all species” for these combinations were 93.84% in this study. The results can support the accuracy of identification of the source species of Qi-Nan germplasms. However, I will focus on the combination of SSR or ISSR with DNA barcoding to get a better resolution of genetic differences in the future research. Comments are from Reviewer 2 “Qi-Nan” is an important agarwood species valued for its fragrance and medicinal importance. Authors have made efforts to identify its source species using DNA barcoding analysis and inferred A. sinensis. to be the source species of “Qi-Nan”. The overall quality of manuscript the way it is written needs to be improved. The major concerns of reviewers are as below: Comment 1: Please mark Figure 1 properly. Response: Thanks for your suggestion. Figure 1 has been marked. Comment 2: In line 136, please provide the full detail of the DNA isolation kit used. Response: Thank you for your comments. Full details of the DNA isolation kit used have been supplemented. Comment 3: It will be appropriate the address the primer pairs used in this study as universal primers rather than common primers (LINE 136). Response: Thanks very much. I have finished the modification according to your comments. Comment 4: Please rewrite methods sections, some of the information is duplicated while some sections need elaboration e.q.1) Data analysis section contain the duplicated information. 2) the name of sequencing platform and the methodology of sequencing is not provided. Response: Thank you very much for your review. I have rewritten the method section. On the one hand, the content of duplicate information in data analysis has been modified. And on the other hand, DNA sequencing methods and platforms have been supplemented. Comment 5: Reference 2 is not complete. Response: Thanks for your suggestion. I have replaced reference 2. Comment 6: In general, few references are misleading in the manuscript. Authors are requested to recheck the citation used in the manuscript. Response: Thank you for your valuable comments. I have rechecked and revised the citations used in the manuscript. Comment 7: It would have been appropriate to dedicate the last section of discussions to conclusion and future aspects but the last section appears more of the introductory part of the manuscript. Response: Thank you very much for your advice. I have revised in the discussion and conclusion according to your comments. Submitted filename: Response letter.docx Click here for additional data file. 6 Jun 2022 Genetic relationship and source species identification of 58 Qi-Nan germplasms of Aquilaria species in China that easily form agarwood PONE-D-22-07044R1 Dear Dr. KANG, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Pankaj Bhardwaj, Ph.D. Academic Editor PLOS ONE Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: (No Response) Reviewer #2: Authors have made attempts to identify Qi-Nan germplasm using DNA barcoding. The combination of barcodes identified in the present study will facilitate the breeding programs and agarwood production in future. Authors have incorporated the suggestions. I have made few correction in the annotated manuscript. Authors are requested to carefully check the manuscript for minor typographical errors. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No ********** 9 Jun 2022 PONE-D-22-07044R1 Genetic relationship and source species identification of 58 Qi-Nan germplasms of Aquilaria species in China that easily form agarwood Dear Dr. Kang: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Pankaj Bhardwaj Academic Editor PLOS ONE
  22 in total

1.  MRBAYES: Bayesian inference of phylogenetic trees.

Authors:  J P Huelsenbeck; F Ronquist
Journal:  Bioinformatics       Date:  2001-08       Impact factor: 6.937

2.  Universal primers for amplification of three non-coding regions of chloroplast DNA.

Authors:  P Taberlet; L Gielly; G Pautou; J Bouvet
Journal:  Plant Mol Biol       Date:  1991-11       Impact factor: 4.076

3.  A DNA barcode for land plants.

Authors: 
Journal:  Proc Natl Acad Sci U S A       Date:  2009-07-30       Impact factor: 11.205

4.  Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in Panama.

Authors:  W John Kress; David L Erickson; F Andrew Jones; Nathan G Swenson; Rolando Perez; Oris Sanjur; Eldredge Bermingham
Journal:  Proc Natl Acad Sci U S A       Date:  2009-10-19       Impact factor: 11.205

Review 5.  Aquilaria spp. (agarwood) as source of health beneficial compounds: A review of traditional use, phytochemistry and pharmacology.

Authors:  Yumi Zuhanis Has-Yun Hashim; Philip G Kerr; Phirdaous Abbas; Hamzah Mohd Salleh
Journal:  J Ethnopharmacol       Date:  2016-06-22       Impact factor: 4.360

6.  Molecular Identification of Three Aquilaria (Thymelaeaceae) Species through DNA Barcoding.

Authors:  Qiwei Li; Hanjing Yan; Dan Lin; Yesheng Wang; Mengling He; Weimin Zhang; Xiaoxia Gao; Shuang Zhu
Journal:  Biol Pharm Bull       Date:  2018       Impact factor: 2.233

7.  Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species.

Authors:  Shilin Chen; Hui Yao; Jianping Han; Chang Liu; Jingyuan Song; Linchun Shi; Yingjie Zhu; Xinye Ma; Ting Gao; Xiaohui Pang; Kun Luo; Ying Li; Xiwen Li; Xiaocheng Jia; Yulin Lin; Christine Leon
Journal:  PLoS One       Date:  2010-01-07       Impact factor: 3.240

8.  DNA Barcoding of the Endangered Aquilaria (Thymelaeaceae) and Its Application in Species Authentication of Agarwood Products Traded in the Market.

Authors:  Shiou Yih Lee; Wei Lun Ng; Mohd Noor Mahat; Mohd Nazre; Rozi Mohamed
Journal:  PLoS One       Date:  2016-04-29       Impact factor: 3.240

9.  DNA barcoding analysis and phylogenetic relationships of tree species in tropical cloud forests.

Authors:  Yong Kang; Zhiyan Deng; Runguo Zang; Wenxing Long
Journal:  Sci Rep       Date:  2017-10-02       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.