Literature DB >> 35703356

UBE2T regulates FANCI monoubiquitination to promote NSCLC progression by activating EMT.

Jiguang Zhang1, Jingdong Wang1, Jincheng Wu1, Jianyuan Huang1, Zhaoxian Lin1, Xing Lin1.   

Abstract

Fanconi anemia complementation group I (FANCI) is a critical protein for maintaining DNA stability. However, the exact role of FANCI in tumors remains to be elucidated. The present study aimed to explore the role and potential mechanism of action of FANCI in non‑small cell lung cancer (NSCLC). To quantify the expression levels of FANCI and ubiquitin‑conjugating enzyme E2T (UBE2T) in NSCLC tissues, reverse‑transcription quantitative PCR and western blotting were employed. Cell Counting Kit‑8, wound healing and Transwell assays along with flow cytometry analysis and tumor xenograft were used to investigate the biological effects of FANCI in NSCLC in vitro and in vivo. The binding of FANCI with UBE2T was confirmed using a co‑immunoprecipitation assay. Epithelial‑to‑mesenchymal transition (EMT) protein markers were quantified via western blotting. The results showed that FANCI expression level was higher in NSCLC tumor tissues, compared with adjacent tissues. In A549 and H1299 cells, knockdown of FANCI inhibited cell proliferation, migration, invasion, cell cycle and EMT in vitro. Tumor growth was repressed in vitro, upon downregulation of FANCI expression. UBE2T was observed to directly bind to FANCI and regulate its monoubiquitination. Overexpression of UBE2T reversed the effects induced by FANCI knockdown in NSCLC cells. Furthermore, it was noted that FANCI interacted with WD repeat domain 48 (WDR48). Overexpression of WDR48 reversed the effects of FANCI on cell proliferation, migration and EMT. In conclusion, FANCI was identified to be a putative oncogene in NSCLC, wherein FANCI was monouniubiquitinated by UBE2T to regulate cell growth, migration and EMT through WDR48. The findings suggested that FANCI could be used as a prognostic biomarker and therapeutic target for NSCLC.

Entities:  

Keywords:  Fanconi anemia complementation group I; epithelial‑mesenchymal transition; monoubiquitination; non‑small cell lung cancer; ubiquitin‑conjugating enzyme E2T

Mesh:

Substances:

Year:  2022        PMID: 35703356      PMCID: PMC9245069          DOI: 10.3892/or.2022.8350

Source DB:  PubMed          Journal:  Oncol Rep        ISSN: 1021-335X            Impact factor:   4.136


Introduction

Lung cancer is responsible for one fifth of cancer-related deaths worldwide (1). Non-small cell lung cancer (NSCLC) is the commonest type of lung cancer (2,3). Some targeted therapies against epidermal growth factor receptor, anaplastic lymphoma kinase and c-ros oncogene 1 receptor tyrosine kinase have been confirmed to provide survival benefits to NSCLC patients. However, a considerable proportion of NSCLC remains incurable, mainly due to late diagnosis and drug resistance (4–6). Therefore, it is necessary to understand the pathogenesis of NSCLC for proper diagnosis and development of new treatment modalities. Fanconi anemia (FA) is a rare recessive disorder characterized by anemia and bone marrow failure. It is caused by mutations in the FA family proteins (7,8). The FA family consists of ~19 genes associated with cell cycle progression, regulation and DNA damage repair (9,10). FANCI is an FA family protein; its gene is located on the long arm of chromosome 15. FANCI forms a complex with its molecular chaperone FANCD2 to participate in DNA repair and ribosome biosynthesis. The complex also regulates the cell cycle in the S and G2 phases (11–13). The FA core complex, which is an E3 ubiquitin ligase, monoubiquitinates FANCD2 and FANCI when DNA is damaged and stabilizes both proteins (14,15). Recently, FANCI was reported to be involved in the occurrence and development of several tumors. For example, FANCI is associated with susceptibility to familial prostate cancer (16). It has also been used as a novel marker for hepatitis B virus-associated hepatocellular carcinoma (17). In lung adenocarcinoma (LUAD), it co-operates with inosine monophosphate dehydrogenase type II to promote tumor growth (18). However, the understanding of the role of FANCI in tumor development and progression and the corresponding mechanism involved is still very limited, especially in the case of NSCLC. Ubiquitin-conjugating enzyme E2T (UBE2T) is an E2 ubiquitin ligase involved in the FA pathway. It binds to FANCL and facilitates the monoubiquitination of FANCD2/FANCI to promote DNA interstrand cross-link (ICL) repair (19,20). Increasing evidence demonstrates that UBE2T is involved in multiple cancers. It is reported to decrease BRCA1 expression and promote breast cancer progression (21). It has been identified as a putative biomarker of bladder cancer (22). In addition, UBE2T-mediated monoubiquitination of H2AX induces hepatocellular carcinoma radioresistance by activating checkpoint kinase 1 (23). Based on the cancer genome atlas database, UBE2T was found to be associated with a poor prognosis in NSCLC (24). It also promotes epithelial-mesenchymal transition (EMT) and accelerates NSCLC cell proliferation, migration and invasion (25). In the EMT, epithelial cells gain migratory and invasive properties, owing to the loss of apico-basal polarity and cell-cell adhesion, to become mesenchymal stem cells. EMT is closely related to tumors, depending on the biological processes of wound healing, cell migration and proliferation (26–28). Although the aforementioned studies have found that UBE2T is associated with NSCLC, the role of UBE2T in the carcinogenesis of NSCLC is yet to be explored in depth. In the current study, FANCI was found to be overexpressed and to serve a critical role in NSCLC progression by promoting EMT. The pathogenesis mechanism involved the UBE2T-mediated stabilization and monoubiquitination of FANCI.

Materials and methods

Sample collection

A total of 32 pairs of fresh NSCLC and adjacent (~5 cm) non-cancerous lung tissue samples were collected from patients (all >18 years old) who underwent surgery in Fujian Provincial Hospital between January 2015 and January 2018. The clinical information (shown in Table I) of all the patients was collected by the informed consent. This study was approved by the Medical Ethics Committee of Fujian Provincial Hospital (approval no. K2018-015-11) and was conducted in accordance with the Declaration of Helsinki. Written informed consent was obtained from all participants.
Table I.

Correlation of lncRNA FANCI expression with clinical variables in NSCLC patients.

FANCI expression

Clinicopathological featurenHighLowP-value
Sex
  Male2210120.7043
  Female1064
Age (years)
  <60191180.4725
  ≥601358
Tumor size (cm)
  <3175120.032
  ≥315114
Lymphatic metastasis
  N0184140.001
  N1-N314122
Distant metastasis
  M0175120.032
  M115114

NSCLC, non-small cell lung cancer; FANCI, Fanconi anemia complementation group I.

Cell culture and transfection

A total of five NSCLC cell lines (H1650, H1975, HCC827, A549 and H1299) and a human normal epithelial (HBE) cell line were purchased from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences. RPMI-1640 (cat. no. 11875093; Thermo Fisher Scientific, Inc.) medium containing 10% fetal bovine serum (cat. no. A3160901; Gibco; Thermo Fisher Scientific, Inc.) was used to culture cells at 37°C with 5% CO2 in a humidified chamber and were used for transfection when they reached 60–70% confluence. FANCI-targeting short hairpin (sh)RNA (ATGTAAGCTCGGAGCTAATAT) and scrambled negative control (NC1 (sh-FANCI); ACGUGACACGUUGGAGAAT), sh-UBE2T (TTGTCTGGATGTTCTCAAATT) and negative control (NC2 (sh-UBE2T); UUCUCCGAACGUGUCACGUTT), as well as the pEX-UBE2T and pEX-WDR48 overexpression and the empty vectors (pEX-1) were synthesized by Shanghai GenePharma Co., Ltd. and 1 µg/µl was used for transfection with Lipofectamine® 3000 (cat. no. L3000015; Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C for 24 h, according to the manufacturer's protocol. Subsequent experiments were performed 24 h after transfection.

Reverse transcription-quantitative (RT-q) PCR

Total RNA was isolated from NSCLC tissues and cultured cells (at 80% density) using TRIzol® reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.) Nanodrop 2000 ultramicro spectrophotometer was applied for RNA purity and quantification. The cDNA Synthesis SuperMix for qPCR (cat. no. 11141ES10; Shanghai Yeasen Biotechnology Co., Ltd.) was used to synthesize cDNA according to the manufacturer's instructions. For RT-qPCR, SYBR Premix Ex Taq II (cat. no. RR420A; Takara Biotechnology Co., Ltd.) was used. RT-qPCR was conducted using a Roche Light Cycler 480 system (Roche Diagnostics, GmbH), according to the manufacturer's protocol. The following thermocycling conditions were used for qPCR: initial denaturation at 95°C for 5 min; followed by 40 cycles at 95°C for 10 sec of denaturation, 60°C for 20 sec of annealing and elongation; and 72°C for 20 sec of final extension. The 2−ΔΔCq method was used to calculate the relative expression of FANCI and UBE2T (29). β-Actin served as an internal control. Primer sequences used in this study are listed in Table II.
Table II.

Primer sequences (5′-3′) for reverse-transcription quantitative PCR.

GenePrimer sequences (5′-3′)
FANCI FCCACCTTTGGTCTATCAGCTTC
FANCI RCAACATCCAATAGCTCGTCACC
UBE2T FTTGATTCTGCTGGAAGGATTTG
UBE2T RCAGTTGCGATGTTGAGGGAT
β-actin FAGGGGCCGGACTCGTCATACT
β-actin RGGCGGCACCACCATGTACCCT

FANCI, Fanconi anemia complementation group I; UBE2T, ubiquitin-conjugating enzyme E2T; F, forward; R, reverse.

Western blotting (WB)

Precooled RIPA buffer (cat. no. P0013B; Beyotime Institute of Biotechnology) was used to extract total protein from cells and tissues. The BCA Protein Assay kit (cat. no. P0012S; Beyotime Institute of Biotechnology) was used to determine protein concentrations. Proteins (60 µg per lane) were separated on 10% SDS-PAGE. Subsequently, the proteins were transferred onto polyvinylidene fluoride membranes (cat. no. 32031602; MilliporeSigma). Then, the membranes were blocked with 5% fat-free milk at room temperature for 2 h. Following blocking, the membranes were incubated with primary antibodies (1:1,000, anti-FANCI, cat. no. ab74332; 1:1,000, anti-FANCD2, cat. no. ab108928; cat. no. Abcam) 1:1,000, anti-UBE2T, cat. no. ab179802; 1:1,000, anti-WDR48, cat. no. ab230645; 1:1,000, anti-E-cadherin, cat. no. ab40772; 1:1,000, anti-N-cadherin, cat. no. ab76011; and 1:1,000, anti-Vimentin, cat. no. ab92547) purchased from Abcam at 4°C overnight, followed by incubation with corresponding secondary antibodies for 1 h at room temperature. β-actin (1:2,000, cat. no. ab8226; Abcam) was used as an internal reference protein. The membranes were visualized using ECL solution (E411-04, Vazyme Biotech Co., Ltd.). Image Lab (version 3.0; Bio-Rad Laboratories, Inc.) was used for densitometry.

Cell proliferation

Cell proliferation was detected using a Cell counting kit-8 (CCK-8) assay (cat. no. CK04; Dojindo Laboratories, Inc.). Cells (~4×103) were seeded into each well of a 96-well plate and maintained for the indicated times. Next, 10 µl of CCK-8 reagent was added to each well for another 2 h of incubation. Finally, the absorbance was measured at 450 nm.

Cell migration

Cell migration was tested using Transwell and wound healing assays. For the Transwell assay, ~5×105 cells, mixed in 200 µl basal medium, were added to the upper and lower chambers of the Transwell. They were then supplemented with 500 µl medium. After incubation for 24 h at 37°C, cells were fixed using 4% paraformaldehyde for 30 min, stained with 0.1% crystal violet for 30 min at room temperature (cat. no. C0121; Beyotime Institute of Biotechnology) and then observed under a light microscope (Olympus Corporation). For the scratch assay (wound healing assay), cells were first seeded into a 6-well plate and incubated for 24 h at 37°C using RPMI-1640 (without FBS). Then, a scratch was created with a 10 µl pipette tip in a cell monolayer. The images were captured upon scratching and after 24 h of scratching.

Flow cytometry

Cell cycle and apoptosis were determined via flow cytometry using the Annexin V-FITC/PE cell apoptosis and cell cycle detection kit (cat. no. C1052; Beyotime Institute of Biotechnology) at room temperature for 30 min according to the manufacturer's protocols (30). The cell apoptosis percentage was calculated as Q2+Q4. A flow cytometer (BeamCyte; BEAMDIAG) was used for the flow cytometry. The flow cytometric data were then analyzed with CytoSYS 1.0 software (BEAMDIAG).

Immunoprecipitation (IP)

IP was performed using the Crosslink Magnetic IP/Co-IP kit (cat. no. 88804; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Briefly, after cell lysis, 10–20 µl of lysis solution was collected as an input for further detection. The rest of the cell lysate was treated with an anti-UBE2T antibody (cat. no. ab179802; 1:1,000; Abcam) at 4°C for 12–16 h, Then, protein A/G magnetic beads (cat. no. HY-K0202; MedChemExpress) were added to the lysate. After incubation of ~4 h, they were collected and washed thrice to obtain the co-precipitated proteins. Subsequently, WB was conducted with anti-FANCI (1:200; cat. no. ab74332; cat. no. Abcam) and anti-FANCD2 (1:200; cat. no. ab108928; Abcam) antibodies, as aforementioned.

Mouse tumor xenografts

BALB/c nude mice (n=12; age, 6 weeks; female) were purchased from GemPharmatech Co. Ltd. A549/sh-NC cells or A549/sh-FANCI cells (~5×106) were injected into the mice in the right flanks subcutaneously (n=6 per group). Tumor volume was recorded every week. The mice were sacrificed by using pentobarbital sodium (200 mg/kg) via injection into the caudal vein. Mortality was confirmed by the stopping of the heart and breathing rate (5 min), as well as the disappearance of the foot withdrawal reflex. The tumor tissues were collected for subsequent experiments. The xenograft mice in the present study survived until to sacrifice (five weeks later). Appropriate humane end points were set, including the tumor burden should be <10% of body weight; tumors should be ≥20 mm; tumor rapid growth causing ulceration, necrosis or infection, interference with eating or ability to walk. The Animal Care and Use Committee of the Fujian Provincial Hospital (approval no. A2018-016-12) approved the in vivo experiments.

Immunohistochemistry (IHC)

IHC staining was performed on paraffin-embedded mouse tissue sections. The sections were treated with primary anti-FANCI (1:1,000; cat. no. ab74332; Abcam), anti-Ki67 (1:1,000; cat. no. ab16667; Abcam) and anti-cleaved-Caspase-3 (1:1,000; cat. no. 9661; CST) antibodies overnight at 4°C. After washing with PBS, samples were incubated with corresponding secondary antibodies for 30 min at 37°C and DAPI for 10 min at room temperature. By comparing the entire tissue area at ×10 magnification, the positive staining score was defined as 0, 1, 2, 3 and 4 for 0, 1–25, 26–50, 51–75 and 76–100% staining, respectively. If the staining score was ≥ 3, the protein was considered to be highly expressed.

Statistical analysis

The data were analyzed using GraphPad Prism 6.01 software (GraphPad, USA). The differences between NSCLC tumor tissues and paired adjacent tissues were assessed using paired Student's t-test. The differences between other two groups were assessed using unpaired Student's t-test and differences between more than two groups were assessed using one-way ANOVA with a Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

FANCI is highly expressed in NSCLC tissues and cell lines

Compared with the expression of FANCI in paired adjacent tissues, all 32 NSCLC tumor tissues showed higher expression of FANCI, as per results of RT-qPCR (Fig. 1A). As shown in Table I, significant correlations were found between high levels of FANCI expression and tumor size (P=0.032), lymphatic metastasis (P=0.001) and distant metastasis (P=0.032). WB revealed the upregulation of FANCI in the tumors (Fig. 1B), as well as in the NSCLC cell lines (H1650, H1975, HCC827, A549 and H1299), compared with its expression in HBE cells. Among all NSCLC cell lines, A549 and H1299 cells had the highest expression of FANCI (Fig. 1C). Therefore, H1299 and A549 cells were chosen for subsequent experiments.
Figure 1.

FANCI expression in NSCLC tissues and cell lines. (A and B) At mRNA and protein levels, FANCI expression was higher in NSCLC tumor tissues than in adjacent tissues. (C) FANCI was remarkably overexpressed in NSCLC cell lines, compared with its expression in HBE cells. *P<0.05, **P<0.01, ***P<0.001. FANCI, Fanconi anemia complementation group I; NSCLC, non-small cell lung cancer; HBE, human bronchial epithelial.

Downregulation of FANCI inhibits NSCLC cell proliferation

FANCI was knocked down in A549 and H1299 cells to evaluate its role in NSCLC. RT-qPCR showed that sh-FANCI effectively decreased FANCI expression (Fig. 2A). The results of the CCK-8 assay indicated that FANCI knockdown decreased proliferation of cancer cells, compared with the control group (Fig. 2B). Flow cytometry analysis revealed an elevated rate of apoptosis upon FANCI knockdown (Fig. 2C). The level of pro-apoptotic protein Bax increased, while that of anti-apoptotic protein Bcl-2 decreased (Fig. 2D). Furthermore, the cell cycle was blocked upon gene silencing (Fig. 2E). The above data showed that knockdown of FANCI abated cell proliferation by promoting apoptosis and cell cycle arrest in NSCLC cells.
Figure 2.

Effects of FANCI knockdown on NSCLC cell viability. (A) sh-FANCI silenced the expression of FANCI. FANCI silencing (B) inhibited A549 and H1299 cell proliferation, (C) promoted cell apoptosis (as revealed by flow cytometry), (D) upregulated Bax expression and downregulated Bcl-2 expression and (E) blocked the cell cycle in A549 and H1299 cells. *P<0.05, ***P<0.001. FANCI, Fanconi anemia complementation group I; NSCLC, non-small cell lung cancer; sh, short hairpin; NC, negative control.

FANCI regulates migration and EMT in NSCLC cells

Cell migration and invasion were attenuated, compared with those of the scrambled NC group, when FANCI expression was downregulated (Fig. 3A and B). Furthermore, to determine the effect of FANCI on EMT, the EMT markers including cadherin (E-cadherin and N-cadherin) and vimentin were evaluated in A549 and H1299 cells. As the WB results showed, when FANCI was knocked down, the E-cadherin expression level was raised, but that of N-cadherin and vimentin was decreased (Fig. 3C), indicating FANCI could regulate the expression of cadherin. The above findings demonstrated that FANCI affects EMT in NSCLC by regulating the expression of cadherin and vimentin.
Figure 3.

Effects of FANCI knockdown on EMT in NSCLC cells. (A and B) Wound-healing (magnification, ×10) and Transwell assays (magnification, ×20) showed that downregulation of FANCI expression significantly inhibited cell migration and invasion in A549 and H1299 cells. (C) Knockdown of FANCI increased the level of EMT marker E-cadherin but reduced those of N-cadherin and vimentin. *P<0.05, **P<0.01, ***P<0.001. FANCI, Fanconi anemia complementation group I; EMT, epithelial-mesenchymal transition; NSCLC, non-small cell lung cancer; NS, not significant; NC, negative control.

UBE2T contributes to monoubiquitination of FANCI in NSCLC

UBE2T induced monoubiquitination of FANCI to activate a downstream pathway. IP revealed that UBE2T bound to FANCI in A549 and H1299 cells (Fig. 4A). In NSCLC, the mRNA and protein expression of UBE2T in tumor tissues was higher compared with that in adjacent tissues (Fig. 4B and C). sh-UBE2T-mediated knockdown of UBE2Twas confirmed via RT-qPCR (Fig. 4D). Upon downregulation ofUBE2Texpression, FANCI mRNA level did not change significantly (Fig. 4E), but its protein level decreased (Fig. 4F), suggesting that UBE2T might regulate the stability of FANCI by binding to it. To explore the monoubiquitination of FANCI by UBE2T, co-IP was conducted and ubiquitin content was examined. The results showed that the ubiquitin content in A549/sh-UBE2T and H1299/sh-UBE2T cells was downregulated, compared with ubiquitin content in A549/NC and H1299/NC cells (Fig. 4G). By contrast, the ubiquitin content was higher inA549 and H1299/UBE2Tcells than in A549 and H1299/Vector cells (Fig. 4G), indicating that UBE2T mediated monoubiquitination of FANCI in NSCLC. As FANCI is a paralog of FANCD2, the monoubiquitination of FANCD2 by UBE2T was also detected. It was found that the knockdown of UBE2T decreased the monoubiquitination of FANCD2, while the overexpression of UBE2T increased it (Fig. S1). However, the knockdown of FANCD2 did not have any effect on cell growth (Fig. S2).
Figure 4.

Detection of UBE2T-mediated ubiquitination of FANCI. (A) IP assay showed that UBE2T could bind to FANCI in A549 and H1299 cells. UBE2T exhibited higher (B) mRNA and (C) protein levels in NSCLC tumor tissues, compared with its levels in adjacent non-cancerous tissues. (D) Transfection efficiency of sh-UBE2T in NSCLC cells. (E) FANCI mRNA level did not change significantly upon UBE2T silencing. (F) Downregulation of UBE2T expression reduced FANCI levels. (G) The total FANCI protein from A549 and H1299 cells was obtained using the IP method. Compared with the ubiquitin content of the control group, the enrichment of ubiquitin increased after UBE2T downregulation. **P<0.01, ***P<0.001. UBE2T, ubiquitin-conjugating enzyme E2T; FANCI, Fanconi anemia complementation group I; IP, immunoprecipitation; sh, short hairpin; NS, not significant; NC, negative control.

UBE2T mitigates the inhibitory effects of FANCI downregulation

To explore whether UBE2T could alleviate the effects of FANCI knockdown in NSCLC cells, UBE2T was overexpressed in FANCI-knockdown cells. It was found that overexpression of UBE2T promoted the proliferation of, and repressed apoptosis in, A549 and H1299 cells when FANCI was knocked down (Fig. 5A-C). Furthermore, cell migration and invasion were also enhanced upon upregulation of UBE2T expression (Fig. 6A and B). The levels of EMT markers cadherin and vimentin were quantified using WB. Although FANCI silencing increased E-cadherin expression level and decreased N-cadherin and vimentin expression levels, the overexpression of UBE2T partly reversed this effect (Fig. 6C). The above results revealed that the functions of FANCI in NSCLC are regulated by UBE2T.
Figure 5.

UBE2T-mediated alleviation of the effects of FANCI knockdown on NSCLC cells. (A) Overexpression of UBE2T reversed the inhibitory effect of FANCI knockdown on cell proliferation. (B and C) Flow cytometry and WB showed that upregulation of UBE2T expression protected cells from the apoptosis induced by FANCI knockdown *P<0.05, **P<0.01, ***P<0.001. UBE2T, ubiquitin-conjugating enzyme E2T; FANCI, Fanconi anemia complementation group I; NSCLC, non-small cell lung cancer; sh, short hairpin; NC, negative control; NS, not significant.

Figure 6.

UBE2T-mediated alleviation of the effects of FANCI knockdown on EMT. (A) Wound-healing and (B) Transwell assays showed that overexpression of UBE2T reversed the FANCI knockdown-induced inhibition of cell invasion and migration. (C) Upregulation of E-cadherin expression and downregulation of N-cadherin and vimentin expression, caused by FANCI knockdown, were reversed when UBE2T was overexpressed. *P<0.05, **P<0.01, ***P<0.001. UBE2T, ubiquitin-conjugating enzyme E2T; FANCI, Fanconi anemia complementation group I; EMT, epithelial-mesenchymal transition; NC, negative control.

FANCI functions via binding to WDR48

Through in silico analysis (String: http://cn.string-db.org/), it was found that WDR48, which is related to EMT and cell growth (31), might be a downstream factor of FANCI. IP assay confirmed that FANCI could bind to WDR48 in A549 and H1299 cells (Fig. 7A). The upregulation of WDR48 reversed the inhibitory effects of FANCI silencing on cell proliferation and migration (Fig. 7B and C) and EMT. It downregulated E-cadherin expression and upregulated that of N-cadherin and vimentin (Fig. 7D). The above findings suggest that FANCI might function by binding to WDR48.
Figure 7.

Binding of FANCI to WDR48. (A) IP assay confirmed the binding of FANCI to WDR48 in A549 and H1299 cells. Upregulation of WDR48 expression relieved the inhibitory effect of FANCI silencing on (B) cell proliferation and (C) migration. (D) Overexpression of WDR48 reversed the upregulation of E-cadherin expression and downregulation of N-cadherin and vimentin expression, which were caused by the silencing of FANCI expression. *P<0.05, ***P<0.001. FANCI, Fanconi anemia complementation group I; WDR48, WD repeat domain 48; IP, immunoprecipitation; NC, negative control; sh, short hairpin.

Knockdown of FANCI inhibits tumor growth in vivo

A549/sh-NC and A549/sh-FANCI cells were injected subcutaneously into nude mice to establish tumor xenografts. The tumor size and weight significantly reduced in the sh-FANCI group, compared with the sh-NC group. The tumor volume showed a similar pattern (Fig. 8A-C). WB and IHC revealed low FANCI expression in the sh-FANCI group (Fig. 8D and E). In addition, the expression of proliferation marker Ki67 was lower, whereas that of cleaved-caspase 3 was higher, in the sh-FANCI group (Fig. 8F and G). These data suggested that knockdown of FANCI significantly inhibited tumor growth in vivo.
Figure 8.

Effect of FANCI knockdown on tumor growth in vivo. (A and B) Tumor weights and (C) volumes significantly decreased in the sh-FANCI group compared with those in the sh-NC group. (D) WB and (E) IHC results in tumor tissues showed that FANCI expression was significantly reduced in the sh-FANCI group. IHC revealed (F) decreased expression of Ki-67 and (G) increased expression of cleaved-caspase-3 in the sh-FANCI group. *P<0.05. FANCI, Fanconi anemia complementation group I; sh, short haisrpin; WB, western blotting; IHC, immunohistochemistry; NC, negative control.

Discussion

Despite remarkable efforts to treat NSCLC, such as surgery, chemotherapy, radiotherapy and targeted therapy, the 5-year overall survival rate remains unsatisfactory (32,33). Elucidating the underlying mechanisms of NSCLC tumorigenesis requires intensive and consistent exploration. An ICL refers to the covalent bond between complementary bases of double-stranded DNA, which is one of the most toxic types of DNA damage (34). The FA pathway is responsible for repairing ICLs in the S phase and maintaining genomic stability (35). FANCL, an E3 ubiquitin ligase, serves an irreplaceable role in FA pathway activation and ICL repair. When ICLs occur on DNA, the FA core complex is recruited to the stagnated replication fork. FANCL, the E3 ubiquitin ligase subunit in the FA-core complex, interacts specifically with UBE2T and then, FANCL and UBE2T promote the monoubiquitination of the FANCI-FANCD2 heterodimer. The ubiquitinated FANCI-FANCD2 complex recruits downstream endonucleases to cut DNA. Then, the downstream proteins undergo cross-injury synthesis and homologous recombination repair to finally complete the repair of ICLs (36). FANCI was also revealed as a biomarker for the poor prognosis of LUAD (18); however, a previous study found a tumor suppressive role of FANCI, wherein it acted as a negative factor for the Akt pathway by regulating PHLPP phosphatases (37). Therefore, the role of FANCI in tumors remains unclear and further studies are needed to explore it properly. The present study discovered that FANCI is overexpressed in NSCLC tumor tissues. Knockdown of FANCI inhibited EMT, proliferation, migration, invasion and tumor growth in NSCLC cells. Although FANCI is a paralog of FANCD2 and UBE2T regulates the monoubiquitination of FANCD2 in NSCLC cells, we found that downregulation of FANCD2 did not influence cell growth. Based on these results, we propose that FANCI, but not FANCD2, functions as an oncogene in NSCLC. Thus, FANCI is a novel potential therapeutic target for NSCLC. UBE2T is an E2 enzyme that is widely dysregulated in numerous cancers and functions as an oncoprotein (38,39). Recently, UBE2T was reported to promote β-catenin nuclear translocation in HCC through the MAPK/ERK axis (40). In addition, UBE2T promotes the progression of LUAD by regulating autophagy through the p53/AMPK/mTOR signaling pathway (41). As a member of the E2 family, UBE2T enhances DNA crosslinking-induced damage repair by monoubiquitinating the FANCI-FANCD2 complex (42). Some studies have indicated that FANCD2 is a preferred substrate for ubiquitination in the FANCI-FANCD2 complex (15,43), but it becomes a poor substrate for ubiquitination when FANCI is absent (44). Compared with FANCD2, free FANCI is more efficiently ubiquitinated by the FA-core complex (44,45). It has also been reported that the abundance of FANCI in U2OS cells is nearly 10 times more than that of FANCD2, indicating that FANCI may also be ubiquitinated alone in cells to a certain degree (46). The present study found that UBE2T expression was upregulated in NSCLC tumor tissues. Therefore, in terms of mechanism, it was hypothesized that FANCI might be regulated by UBE2T during the development and progression of NSCLC. According to the co-IP and WB assays, UBE2T interacted with FANCI and stabilized the FANCI level. Ubiquitin-like protein 5 (UBL5) has also been reported to bind FANCI and promote its stability (47). The present study discovered that overexpression of UBE2T increased the monoubiquitination level of FANCI in NSCLC cells. The foregoing results suggested that the function of FANCI in NSCLC was probably modulated by UBE2T-mediated monoubiquitination. However, it is still not well known how the FA-core complex and UBE2T specifically regulate FANCI monoubiquitination and this requires further research. In addition, the rescue experiments showed that overexpression of UBE2T partly reversed the FANCI knockdown-induced inhibition of EMT, cell growth, migration and invasion, indicating that UBE2T regulates the function of FANCI in NSCLC. WDR48 is critical for EMT. The inhibition of endogenous WDR48 expression is reported to significantly decrease TGF-β-induced EMT, migration and invasion in tumor cells (47). The present study predicted the binding of FANCI and WDR48 using in silico analysis and confirmed it via IP assay. Furthermore, rescue experiments showed that the upregulation of WDR48 also reversed the FANCI knockdown-induced inhibition of EMT and cell growth. These findings indicate the probable role of WDR48 in FANCI function in NSCLC. In conclusion, the present study revealed the oncogenic role of FANCI in promoting cell growth and EMT in NSCLC. This function of FANCI is mediated by WDR48 and regulated by UBE2T-induced monoubiquitination of FANCI. In the present study, FANCI emerged as a potential target for NSCLC therapy that may also serve as a biomarker for predicting its poor prognosis.
  47 in total

1.  UBE2T is the E2 in the Fanconi anemia pathway and undergoes negative autoregulation.

Authors:  Yuichi J Machida; Yuka Machida; Yuefeng Chen; Allan M Gurtan; Gary M Kupfer; Alan D D'Andrea; Anindya Dutta
Journal:  Mol Cell       Date:  2006-08       Impact factor: 17.970

2.  Bone Marrow Failure in Fanconi Anemia: Clinical and Genetic Spectrum in a Cohort of 20 Pediatric Patients.

Authors:  Charikleia Kelaidi; Alexandros Makis; Loizos Petrikkos; Kondilia Antoniadi; Nikoletta Selenti; Vasiliki Tzotzola; Eleni-Dikaia Ioannidou; Konstantinos Tsitsikas; Vassiliki Kitra; Ariadni Kalpini-Mavrou; Helen Fryssira; Sophia Polychronopoulou
Journal:  J Pediatr Hematol Oncol       Date:  2019-11       Impact factor: 1.289

Review 3.  The Fanconi anaemia pathway: new players and new functions.

Authors:  Raphael Ceccaldi; Prabha Sarangi; Alan D D'Andrea
Journal:  Nat Rev Mol Cell Biol       Date:  2016-05-05       Impact factor: 94.444

4.  Cancer statistics in China, 2015.

Authors:  Wanqing Chen; Rongshou Zheng; Peter D Baade; Siwei Zhang; Hongmei Zeng; Freddie Bray; Ahmedin Jemal; Xue Qin Yu; Jie He
Journal:  CA Cancer J Clin       Date:  2016-01-25       Impact factor: 508.702

5.  UBE2T promotes radiation resistance in non-small cell lung cancer via inducing epithelial-mesenchymal transition and the ubiquitination-mediated FOXO1 degradation.

Authors:  Hang Yin; Xiaoyuan Wang; Xue Zhang; Yangyang Zeng; Qingyong Xu; Wenbo Wang; Fuxiang Zhou; Yunfeng Zhou
Journal:  Cancer Lett       Date:  2020-06-23       Impact factor: 8.679

6.  USP1-WDR48 deubiquitinase complex enhances TGF-β induced epithelial-mesenchymal transition of TNBC cells via stabilizing TAK1.

Authors:  Dianwen Han; Lijuan Wang; Bing Chen; Wenjing Zhao; Yiran Liang; Yaming Li; Hanwen Zhang; Ying Liu; Xiaolong Wang; Tong Chen; Chen Li; Xiaojin Song; Dan Luo; Zheng Li; Qifeng Yang
Journal:  Cell Cycle       Date:  2021-01-18       Impact factor: 4.534

7.  DNA robustly stimulates FANCD2 monoubiquitylation in the complex with FANCI.

Authors:  Koichi Sato; Kazue Toda; Masamichi Ishiai; Minoru Takata; Hitoshi Kurumizaka
Journal:  Nucleic Acids Res       Date:  2012-01-28       Impact factor: 16.971

8.  Fatal Myelotoxicity Following Palliative Chemotherapy With Cisplatin and Gemcitabine in a Patient With Stage IV Cholangiocarcinoma Linked to Post Mortem Diagnosis of Fanconi Anemia.

Authors:  Nils W Engel; Simon Schliffke; Ulrich Schüller; Christian Frenzel; Carsten Bokemeyer; Christian Kubisch; Davor Lessel
Journal:  Front Oncol       Date:  2019-05-22       Impact factor: 6.244

9.  FANCI Cooperates with IMPDH2 to Promote Lung Adenocarcinoma Tumor Growth via a MEK/ERK/MMPs Pathway.

Authors:  Pengchao Zheng; Lei Li
Journal:  Onco Targets Ther       Date:  2020-01-15       Impact factor: 4.147

10.  UBE2T promotes autophagy via the p53/AMPK/mTOR signaling pathway in lung adenocarcinoma.

Authors:  Jinhong Zhu; Haijiao Ao; Mingdong Liu; Kui Cao; Jianqun Ma
Journal:  J Transl Med       Date:  2021-08-30       Impact factor: 5.531

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.