| Literature DB >> 35692830 |
Xuehui Yu1,2, Lamei Yuan1,2,3,4, Sheng Deng5, Hong Xia6, Xiaolong Tu6, Xiong Deng2, Xiangjun Huang7, Xiao Cao2, Hao Deng1,2,3,4.
Abstract
The formation of left-right asymmetry of the visceral organs is a conserved feature of the human body, and the asymmetry specification of structure and function is precisely orchestrated by multiple regulatory mechanisms. The abnormal results of organ positioning situs arise from defective cilia structure or function during embryogenesis in humans. In this study, we recruited two unrelated Han-Chinese families with left-right asymmetry disorders. The combination of whole-exome sequencing and Sanger sequencing identified two compound heterozygous variants: c.4109C>T and c.9776C>T, and c.612C>G and c.8764C>T in the dynein axonemal heavy chain 17 gene (DNAH17) in two probands with left-right asymmetry disorders. We report for the first time a possible association between DNAH17 gene variants and left-right asymmetry disorders, which is known as a causal gene for asthenozoospermia. Altogether, the findings of our study may enlarge the DNAH17 gene variant spectrum in human left-right asymmetry disorders, pave a way to illustrate the potential pathogenesis of ciliary/flagellar disorders, and provide supplementary explanation for genetic counseling.Entities:
Keywords: DNAH17; ciliary/flagellar disorders; gene variants; left–right asymmetry disorders; whole-exome sequencing
Year: 2022 PMID: 35692830 PMCID: PMC9186109 DOI: 10.3389/fgene.2022.862292
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
Detecting primers for the dynein axonemal heavy chain 17 gene variants.
| Variant | Forward sequence (5′–3′) | Reverse sequence (5′–3′) | Product size (bp) |
|---|---|---|---|
| c.612C>G | GATCCCCTCTTCACTGGACA | GATGCACTTGAGGTTCAGCA | 184 |
| c.4109C>T | CTCGACAACACCGTGAAAAA | CACATTGGCTTTACCAGCAT | 228 |
| c.8764C>T | TTATGGAGGACGAGGTGGAG | TCACATCCCATGAAGGATCA | 239 |
| c.9776C>T | GAGTTCATCCGCTCCAAGTC | GGCACTTACGGCAATCTTGT | 186 |
FIGURE 1Chest X-ray images of the normal individual and patients with left-right asymmetry disorders. (A) Chest X-ray of the normal individual presented normal organ placement. (B) Chest X-ray of the proband in family 1 revealed dextrocardia. (C) Chest X-ray of the proband in family 2 revealed dextrocardia.
In silico analysis of the dynein axonemal heavy chain 17 gene variants.
| Nucleotide change | Amino acid change | dbSNP154 | Variant type | Bioinformatics analysis | Allele frequencies | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| PROVEAN | SIFT | PolyPhen-2 | MutationTaster | 1000G | ExAC | gnomAD | ||||
| c.612C>G | p.Ile204Met | rs577131115 | Missense | Neutral | Tolerated | Possibly damaging | Polymorphism | 2.00×10-4 | 1.17×10-4 | 5.91×10-5 |
| c.4109C>T | p.Thr1370Ile | rs548985742 | Missense | Deleterious | Tolerated | Possibly damaging | Disease causing | 3.99×10-4 | 1.97×10-4 | 1.38×10-4 |
| c.8764C>T | p.Arg2922Cys | rs367844100 | Missense | Deleterious | Damaging | Probably damaging | Disease causing | 2.00×10-4 | - | - |
| c.9776C>T | p.Ala3259Val | rs151161879 | Missense | Neutral | Damaging | Benign | Polymorphism | 4.59×10-3 | 1.38×10-3 | 6.44×10-4 |
dbSNP154, Single Nucleotide Polymorphism database (version 154); rs, Reference SNP; PROVEAN, Protein Variation Effect Analyzer; SIFT, Sorting Intolerant from Tolerant; PolyPhen-2, Polymorphism Phenotyping version 2; 1000G, 1000 Genomes Project; ExAC, Exome Aggregation Consortium; gnomAD, Genome Aggregation Database.
FIGURE 2Pedigrees and sequence analysis of the two unrelated Han-Chinese patients with left-right asymmetry disorders. (A) and (B) Pedigrees with left-right asymmetry disorders and Sanger sequencing results. The proband, shown as a solid symbol, is indicated by an arrow, and the deceased family member is shown with a slash in the pedigree tree. (C) Sequence alignment of the dynein axonemal heavy chain 17 among different species, with the affected amino acids indicated by the arrows. DNAH17, the dynein axonemal heavy chain 17 gene.
FIGURE 3Cartoon model of the dynein axonemal heavy chain 17 protein structure visualized by PyMOL based on the SWISS-MODEL. The isoleucine (I) and mutated methionine (M) at position 204; threonine (T) and mutated isoleucine (I) at position 1370; arginine (R) and mutated cysteine (C) at position 2922; and alanine (A) and mutated valine (V) at position 3259 are indicated with ball-and-stick models.
Clinical data of the DNAH17 variant carriers in different families.
| Ped | Case | Sex | Age | GT | Nucleotide change | Amino acid change | Variant type | Infertility | Situs | CHD | References |
|---|---|---|---|---|---|---|---|---|---|---|---|
| P1 | II:1 | M | 5 years | CH | c.612C>G, c.8764C>T | p.I204M, p.R2922C | Missense, missense | NA | Dextro | Y | This study |
| P2 | II:1 | M | 36 years | CH | c.1293_1294del, c.7994_8012del | p.Y431*, p.G2665Efs*4 | Nonsense, frameshift | Y | SS | N |
|
| P3 | II:1 | F | 50 years | CH | c.4109C>T, c.9776C>T | p.T1370I, p.A3259V | Missense, missense | N | SIT | N | This study |
| P4 | II:3 | M | 34 years | CH | c.4445C>T, c.6857C>T | p.A1482V, p.S2286L | Missense, missense | Y | NA | N |
|
| P5 | II:1 | M | 32 years | Hom | c.4810C>T | p.R1604C | Missense | Y | SS | N |
|
| P6 | IV:1 | M | 43 years | Hom | c.5408G>A | p.C1803Y | Missense | Y | NA | N |
|
| IV:2 | M | 41 years | Hom | c.5408G>A | p.C1803Y | Missense | Y | NA | N | ||
| IV:3 | M | 29 years | Hom | c.5408G>A | p.C1803Y | Missense | Y | NA | N | ||
| IV:5 | F | 42 years | Hom | c.5408G>A | p.C1803Y | Missense | N | NA | N | ||
| P7 | II:3 | M | 37 years | Hom | c.5486G>A | p.C1829Y | Missense | Y | SS | N |
|
| II:4 | M | 35 years | Hom | c.5486G>A | p.C1829Y | Missense | Y | SS | N | ||
| P8 | IV:1 | M | 39 years | Hom | c.5707C>T | p.R1903C | Missense | Y | NA | N |
|
| P9 | III:2 | F | NA | Hom | c.6308C>T, c.11803C>T | p.A2103V, p.Q3935* | Missense, nonsense | N | NA | N | |
| IV:1 | M | 32 years | Hom | c.6308C>T, c.11803C>T | p.A2103V, p.Q3935* | Missense, nonsense | Y | NA | N | ||
| IV:2 | M | 42 years | Hom | c.6308C>T, c.11803C>T | p.A2103V, p.Q3935* | Missense, nonsense | Y | NA | N | ||
| IV:4 | M | 34 years | Hom | c.6308C>T, c.11803C>T | p.A2103V, p.Q3935* | Missense, nonsense | Y | NA | N | ||
| P10 | II:1 | M | 34 years | CH | c.8512–2A>G, c.13294C>T | NA, p.R4432C | Splicing, missense | Y | NA | NA |
|
| P11 | II:4 | M | 27 years | Hom | c.10496C>T, c.10784T>C | p.P3499L, p.L3595P | Missense, missense | Y | SS | N |
|
| P12 | II:1 | M | 30 years | Het | c.10486_10497dup | p.V3496_P3499dup | Duplication | Y | SS | N |
|
| P13 | II:1 | M | 32 years | CH | c.12915+1G>A, c.13202C>T | NA, p.P4401L | Splicing, missense | Y | NA | NA |
|
A variant in the second DNAH17 allele was hypothesized.
DNAH17, dynein axonemal heavy chain 17 gene; Ped, pedigree number; M, male; F, female; GT, genotype; CH, compound heterozygote; Hom, homozygote; Het, heterozygote; N, no; Y, yes; NA, not available; Dextro, dextrocardia; SS, situs solitus; SIT, situs inversus totalis; CHD, congenital heart disease.