| Literature DB >> 35692822 |
Haniel C Oliveira1, Martijn F L Derks2,3, Marcos S Lopes2,4, Ole Madsen3, Barbara Harlizius2, Maren van Son5, Eli H Grindflek5, Marta Gòdia3, Arne B Gjuvsland5, Pamela Itajara Otto6, Martien A M Groenen3, Simone E F Guimaraes1.
Abstract
Backfat is an important trait in pork production, and it has been included in the breeding objectives of genetic companies for decades. Although adipose tissue is a good energy storage, excessive fat results in reduced efficiency and economical losses. A large QTL for backfat thickness on chromosome 5 is still segregating in different commercial pig breeds. We fine mapped this QTL region using a genome-wide association analysis (GWAS) with 133,358 genotyped animals from five commercial populations (Landrace, Pietrain, Large White, Synthetic, and Duroc) imputed to the porcine 660K SNP chip. The lead SNP was located at 5:66103958 (G/A) within the third intron of the CCND2 gene, with the G allele associated with more backfat, while the A allele is associated with less backfat. We further phased the QTL region to discover a core haplotype of five SNPs associated with low backfat across three breeds. Linkage disequilibrium analysis using whole-genome sequence data revealed three candidate causal variants within intronic regions and downstream of the CCND2 gene, including the lead SNP. We evaluated the association of the lead SNP with the expression of the genes in the QTL region (including CCND2) in a large cohort of 100 crossbred samples, sequenced in four different tissues (lung, spleen, liver, muscle). Results show that the A allele increases the expression of CCND2 in an additive way in three out of four tissues. Our findings indicate that the causal variant for this QTL region is a regulatory variant within the third intron of the CCND2 gene affecting the expression of CCND2.Entities:
Keywords: GWAS; animal breeding; backfat; finemapping; pig genomics
Year: 2022 PMID: 35692822 PMCID: PMC9180923 DOI: 10.3389/fgene.2022.871516
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
Summary statistics of the backfat (millimeters) per datasets and per evaluated population.
| Population | Dataset | Number | Mean | SD | Min | Max |
|---|---|---|---|---|---|---|
| Synthetic | PHENOTYPED | 125,319 | 9.98 | 2.28 | 3.5 | 29.4 |
| GENOTYPED | 31,183 | 9.48 | 1.97 | 3.5 | 23.5 | |
| Pietrain | PHENOTYPED | 97,358 | 7.72 | 1.58 | 3.5 | 28.8 |
| GENOTYPED | 16,189 | 7.32 | 1.38 | 3.5 | 19.9 | |
| Landrace | PHENOTYPED | 223,723 | 7.01 | 1.66 | 3.5 | 27.0 |
| GENOTYPED | 38,298 | 7.59 | 1.68 | 3.9 | 20.8 | |
| Large-White | PHENOTYPED | 175,757 | 12.62 | 2.74 | 3.5 | 29.9 |
| GENOTYPED | 36,414 | 12.52 | 2.6 | 4.0 | 29.5 | |
| Duroc | PHENOTYPED | 37,991 | 8.70 | 2.04 | 4.0 | 20.0 |
| GENOTYPED | 11,274 | 8.13 | 2.19 | 4.0 | 20.0 |
SD, standard deviation; Min, minimum value; Max, maximum value.
Phenotyped: consisted of all phenotyped animals and their contemporaries, used for pre-correction of the phenotypes.
Genotyped: subset that includes only genotyped and phenotyped animals, used in the genome-wide association analyses.
Number of genotyped and sequenced animals available with backfat measurements per population and per SNP chip.
| Population | Illumina 50K | Illumina 60K | Illumina 80K | Axiom™ 660K | Total genotyped | WGS |
|---|---|---|---|---|---|---|
| Synthetic | 25,193 | 739 | 5,251 | 319 | 31,502 | 187 |
| Pietrain | 10,396 | 1,414 | 4,379 | 228 | 16,417 | 40 |
| Landrace | 38,298 | - | - | 441 | 38,739 | 227 |
| Large-White | 36,414 | - | - | 401 | 36,815 | 205 |
| Duroc | 6,139 | 1,174 | 3,961 | 140 | 11,414 | - |
| Total | 116,440 | 3,327 | 13,591 | 1,529 | 134,887 |
Summary of the genetic parameters for backfat evaluated in five pig populations.
| Population |
|
|
| h2 |
|---|---|---|---|---|
| Synthetic | 1.19 ± 0.04 | 1.01 ± 0.01 | 2.21 ± 0.04 | 0.54 ± 0.01 |
| Pietrain | 0.56 ± 0.02 | 0.57 ± 0.01 | 1.13 ± 0.02 | 0.50 ± 0.01 |
| Landrace | 0.55 ± 0.02 | 0.77 ± 0.01 | 1.32 ± 0.02 | 0.42 ± 0.01 |
| Large-White | 1.68 ± 0.05 | 1.56 ± 0.01 | 3.24 ± 0.05 | 0.52 ± 0.01 |
| Duroc | 0.78 ± 0.04 | 1.03 ± 0.02 | 1.82 ± 0.04 | 0.43 ± 0.01 |
, Variance additive; , Variance environment; , Variance phenotypic; h2, Heritability.
FIGURE 1Schematic representation of the GWAS results. (A) Four pig populations that presented the significant overlapping GWAS peaks on chromosome 5: Synthetic (Large-White based), Pietrain, Landrace and Large-White. (B) GWAS results for backfat in four populations. (C) Manhattan plot showing the most significant SNP (lead SNP - rs80985094) in the Pietrain population. (D) CCND2 gene model. The location of the lead SNP in the third intron is indicated with a red star. The blue arrow indicates the coding strand, blue boxes depict exons, the open bars the untranslated regions.
Description of the lead SNP (rs80985094) for backfat for each population.
| Population | F(G) | -log10 (p-value) | β | SE |
|
|
|---|---|---|---|---|---|---|
| Synthetic | 0.27 | 57.67 | 0.36 | 0.02 | 0.04 | 0.02 |
| Pietrain | 0.35 | 43.29 | 0.27 | 0.02 | 0.06 | 0.03 |
| Landrace | 0.32 | 67.61 | 0.24 | 0.01 | 0.05 | 0.02 |
| Large-White | 0.79 | 37.91 | 0.33 | 0.03 | 0.02 | 0.01 |
F(G), frequency of the reference allele G; b, beta coefficient size of the effect; SE, standard error; Exp, genetic variance explained; Exp, phenotypic variance explained.
Most frequent haplotypes decreasing backfat.
| Haplotype | N. of haplotypes | Frequency (%) | Population |
|---|---|---|---|
| CCATTAGTTACAGAGTGAGCAAGCTATCGGGAGTCGTGTGT | 35,869 | 57.70 | Synthetic |
| CCATTAGTTACAGAGTGAGCAAGGCTATCGGGAGTCGTGTG | 11,591 | 35.87 | Pietrain |
| TCAAGCTTGACTCAGAAGGCAAGACCTATCGGTCGTGTACC | 17,326 | 22,67 | Landrace |
| GCCATTATTACAGAGTGAGCAAGGACCTATCGGGAGTCGTG | 12,252 | 16.85 | LargeWhite |
In red, lead SNP [alternative allele (A)]. In orange, the core region shared by all populations. In green, the neighboring SNPs included to determine the boundaries of the region of interest to 45.7 kb.
Most frequent haplotypes increasing backfat.
| Haplotypes | N. of haplotypes | Frequency (%) | Population |
|---|---|---|---|
| CCATTAGTTACAGAGTGAGTGGGCTATAGGGAGTCACACGC | 2,948 | 4.74 | Synthetic |
| TAGTCGGGGGCGTCACAGACGGGATCGCCATCGTCCATGTA | 3,599 | 11.14 | Pietrain |
| TGGGGCTGAGTTCAGAAGACGGTACCTATAGGTCACACACC | 12,692 | 16,60 | Landrace |
| GCCATTATTACAGAGTGAGTGGGGACCTATAGGGAGTCACA | 17,801 | 24.48 | Large-White |
In red, lead SNP [reference allele (G)]. In green, the same region covering the core haplotype as in Table 5.
Linkage disequilibrium (r2) between the lead SNP and the 660K variants present in the core haplotype.
| Variant’s position | rs80985094 | |||
|---|---|---|---|---|
| Synthetic | Pietrain | Landrace | Large-white | |
| SSC5:66094630 | 0.35 | 0.81 | - | 0.03 |
| SSC5:66097126 | 0.33 | 0.81 | - | 0.02 |
| SSC5:66100317 | 0.27 | 0.17 | 0.14 | 0.48 |
| SSC5:66107719 | 0.51 | 0.91 | 0.95 | 0.23 |
| SSC5:66126122 | 0.29 | 0.81 | - | 0.02 |
| SSC5:66140348 | 0.38 | 0.81 | 0.14 | 0.04 |
rs80985094, lead SNP; SSC5, sus scrofa chromosome 5.
FIGURE 2Boxplot showing the additive effect of the rs80985094 G/A allele on backfat among the different populations. Phenotype is backfat thickness in mm.
Most significant SNP (lead SNP—rs80985094) identified in the within-breed association analysis and Haplotype-based association using number of copies of the core haplotype.
| Population | Model | -log10 (p-value) | b | SE |
|
|
|---|---|---|---|---|---|---|
| Synthetic | SNP | 57.67 | -0.36 | 0.02 | 0.04 | 0.02 |
| Haplotype | 45.92 | -0.29 | 0.02 | 0.03 | 0.02 | |
| Pietrain | SNP | 43.29 | -0.27 | 0.02 | 0.06 | 0.03 |
| Haplotype | 40.08 | -0.26 | 0.02 | 0.05 | 0.03 | |
| Landrace | SNP | 67.61 | -0.24 | 0.01 | 0.05 | 0.02 |
| Haplotype | 40.68 | -0.17 | 0.01 | 0.02 | 0.01 | |
| Large-White | SNP | 37.91 | -0.33 | 0.03 | 0.02 | 0.01 |
| Haplotype | 32.27 | -0.30 | 0.03 | 0.02 | 0.01 |
b, beta coefficient; SE, standard error; Exp, genetic variance explained; Exp, phenotypic variance explained.
rs80985094, lead SNP.
GCAAG, core haplotype.
LD (r2) between the lead SNP SSC5:66103958 and the other variants SSC5:66190273 and SSC5:66097445.
| Variants | SSC5:66103958 | |||
|---|---|---|---|---|
| Synthetic | Pietrain | Landrace | Large-white | |
| SSC5:66190273 | 0.759 | 0.820 | 0.882 | 0.951 |
| SSC5:66097445 | 0.632 | 0.781 | 0.472 | 0.894 |
SSC5:66103958: lead SNP; SSC5, sus scrofa chromosome 5
Expression and eQTL results in the SSC5 backfat locus (5:65-67 Mb).
| Gene stable ID | Gene name | Gene start (bp) | Gene end (bp) | Liver p-value | Spleen p-value | Lung p-value | Muscle p-value |
|---|---|---|---|---|---|---|---|
| ENSSSCG00000033544 |
| 65052517 | 65123788 | NotExpr | 0.15 | NotExpr | 0.36 |
| ENSSSCG00000000720 |
| 65656289 | 65842142 | 3.0e-04 | 1.2e-07 | 3.9e-09 | 6.2e-06 |
| ENSSSCG00000000719 |
| 65759160 | 65788646 | 0.61 | 0.20 | 0.08 | 0.09 |
| ENSSSCG00000000722 |
| 65872281 | 65897215 | 0.85 | 0.15 | 0.79 | 0.31 |
| ENSSSCG00000000723 |
| 65897541 | 65944185 | 2.00e-03 | 0.64 | 0.70 | 0.02 |
| ENSSSCG00000032662 |
| 65975838 | 65990035 | NotExpr | NotExpr | NotExpr | 0.04 |
| ENSSSCG00000024219 |
| 66044686 | 66067377 | 0.37 | 0.58 | 0.47 | 0.52 |
| ENSSSCG00000038694 |
| 66087379 | 66114571 | 3.0e-03 | 1.6e-05 | 0.02 | 0.14 |
| ENSSSCG00000000732 |
| 66443491 | 66661654 | NotExpr | 0.25 | 0.51 | NotExpr |
| ENSSSCG00000000734 |
| 66852873 | 66911573 | 1.00 | 0.12 | 0.77 | 0.92 |
| ENSSSCG00000000735 |
| 66913769 | 67106233 | 0.69 | 0.12 | 0.95 | 0.08 |
Table shows the p-value for the eQTL analysis with the lead SNP (5:66103958). Genes not expressed in any of the four tissues (CPM <1) are not shown.
Bp, base pairs; CPM, counts per million; NotExpr, CPM value < 1.
FIGURE 3Association of CCND2 expression with the lead SNP in four 87 crossbred individuals (4 tissues). Figure shows CCND2 expression in different genotype classes. G allele is associated with more fat, while the A allele is associated with faster growth. Figure shows that the A allele is significantly associated with increased expression of the CCND2 gene in liver (p-value: 3.0 × 10−3), spleen (p-value: 1.6 × 10−5) and lung (p-value: 0.02).
FIGURE 4ATAC-Seq and ChIP-Seq (H3K27ac, H3K4me1 and H3K4me3) marks in the CCND2 backfat locus. Broad Peaks in the core haplotype region were called using MACS2.
Frequency of core haplotype and ancient wild-type core haplotype per line and effects on backfat.
| Line | Haplotype | A1 | Freq | b | SE | Logpval |
|
|
|---|---|---|---|---|---|---|---|---|
| Synthetic | GCAAG | A | 0.7085 | -0.29 | 0.02 | 45.92 | 0.029 | 0.016 |
| GCGAG | G | 0.0636 | 0.30 | 0.03 | 19.12 | 0.009 | 0.005 | |
| Pietrain | GCAAG | A | 0.6437 | -0.26 | 0.02 | 40.08 | 0.054 | 0.027 |
| GCGAG | G | 0.0841 | 0.20 | 0.03 | 8.71 | 0.011 | 0.006 | |
| Landrace | GCAAG | A | 0.6298 | -0.17 | 0.01 | 42.76 | 0.025 | 0.010 |
| GCGAG | G | 0.0001 | 0.36 | 0.35 | 0.52 | 0.000 | 0.000 | |
| Large White | GCAAG | A | 0.2002 | -0.30 | 0.03 | 32.27 | 0.017 | 0.009 |
| GCGAG | G | 0.0181 | 0.20 | 0.07 | 2.59 | 0.001 | 0.000 |