| Literature DB >> 35677560 |
Eric H Ignatz1, Tiago S Hori2, Surendra Kumar1, Tillmann J Benfey3, Laura M Braden4,5, C Dawn Runighan4, Jillian D Westcott6, Matthew L Rise1.
Abstract
This study examined the impact of rearing temperature (10.5, 13.5 or 16.5°C) on the hepatic transcriptome of AquAdvantage Salmon (growth hormone transgenic female triploid Atlantic salmon) at an average weight of 800 g. Six stranded PE libraries were Illumina-sequenced from each temperature group, resulting in an average of over 100 M raw reads per individual fish. RNA-sequencing (RNA-seq) results showed the greatest difference in the number of differentially expressed transcripts (1750 DETs), as revealed by both DESeq2 and edgeR (q < 0.05; fold-change > |1.5|), was between the 10.5 and 16.5°C temperature groups. In contrast, 172 and 52 DETs were found in the 10.5 vs. 13.5°C and the 13.5 vs. 16.5°C comparisons, respectively. Considering the DETs between the 10.5 and 16.5°C groups, 282 enriched gene ontology (GO) terms were identified (q < 0.05), including "response to stress", "immune system process", "lipid metabolic process", "oxidation-reduction process", and "cholesterol metabolic process", suggesting elevated temperature elicited broad effects on multiple biological systems. Pathway analysis using ClueGO showed additional impacts on amino acid and lipid metabolism. There was a significant positive correlation between RNA-seq and real-time quantitative polymerase chain reaction (RT-qPCR) results for 8 of 9 metabolic-related transcripts tested. RT-qPCR results also correlated to changes in fillet tissue composition previously reported in these salmon (e.g., methionine and lysine concentrations positively correlated with hsp90ab1 transcript expression), suggesting that rearing temperature played a significant role in mediating metabolic/biosynthetic pathways of AquAdvantage Salmon. Many transcripts related to lipid/fatty acid metabolism (e.g., elovl2, fabpi, hacd2, mgll, s27a2, thrsp) were downregulated at 16.5°C compared to both other temperature groups. Additionally, enrichment of stress-, apoptosis- and catabolism-relevant GO terms at 16.5°C suggests that this temperature may not be ideal for commercial production when using freshwater recirculating aquaculture systems (RAS). This study relates phenotypic responses to transcript-specific findings and therefore aids in the determination of an optimal rearing temperature for AquAdvantage Salmon. With approval to grow and sell AquAdvantage Salmon in the United States and Canada, the novel insights provided by this research can help industry expansion by promoting optimal physiological performance and health.Entities:
Keywords: Atlantic salmon; RNA-seq; metabolism; transcriptomics; transgenic; triploid
Year: 2022 PMID: 35677560 PMCID: PMC9168996 DOI: 10.3389/fgene.2022.852165
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
Trimming and alignment metrics of each biological replicate RNA-seq library.
| Library name | SRA | Raw reads # | Surviving reads # (%) | Aligned reads (%) | Alternative alignments (%) | % Coverage | % Exonic rate | |
|---|---|---|---|---|---|---|---|---|
| 16.5°C | S1_16.5 | SRR16105563 | 112,257,950 | 112,227,600 (99.97) | 108,739,280 (96.89) | 43,960,352 (40.43) | 30.40 | 86.26 |
| S2_16.5 | SRR16115861 | 114,484,598 | 114,440,190 (99.96) | 110,338,704 (96.42) | 35,997,993 (32.63) | 32.03 | 85.43 | |
| S3_16.5 | SRR16122595 | 101,880,276 | 101,848,592 (99.97) | 97,969,194 (96.19) | 30,641,463 (31.28) | 28.69 | 85.52 | |
| S4_16.5 | SRR16958631 | 107,258,770 | 107,234,866 (99.98) | 103,748,543 (96.75) | 29,735,650 (28.66) | 30.54 | 86.03 | |
| S5_16.5 | SRR16958615 | 117,304,540 | 117,277,318 (99.98) | 113,299,533 (96.61) | 39,245,504 (34.64) | 32.36 | 86.36 | |
| S6_16.5 | SRR16975862 | 98,692,524 | 98,668,078 (99.98) | 95,693,153 (96.99) | 31,917,863 (33.35) | 27.78 | 86.34 | |
| 13.5°C | S1_13.5 | SRR16988317 | 105,027,464 | 105,000,658 (99.97) | 101,581,042 (96.74) | 33,599,049 (33.08) | 28.46 | 86.15 |
| S2_13.5 | SRR17038623 | 74,841,184 | 74,821,020 (99.97) | 72,261,894 (96.58) | 20,308,874 (28.11) | 20.51 | 85.17 | |
| S3_13.5 | SRR17481977 | 109,834,502 | 109,803,350 (99.97) | 106,465,002 (96.96) | 32,170,009 (30.22) | 30.64 | 86.62 | |
| S4_13.5 | SRR17503995 | 90,177,906 | 90,155,004 (99.98) | 87,224,875 (96.75) | 29,904,438 (34.28) | 24.55 | 86.53 | |
| S5_13.5 | SRR17481976 | 115,909,552 | 115,859,460 (99.96) | 111,534,501 (96.27) | 35,826,986 (32.12) | 30.88 | 86.18 | |
| S6_13.5 | SRR17500070 | 105,921,688 | 105,894,066 (99.97) | 102,319,865 (96.63) | 32,417,461 (31.68) | 28.55 | 85.75 | |
| 10.5°C | S1_10.5 | SRR16097286 | 99,113,996 | 99,077,664 (99.96) | 95,533,239 (96.42) | 24,867,589 (26.03) | 28.39 | 86.84 |
| S2_10.5 | SRR17446820 | 92,641,680 | 92,565,332 (99.92) | 88,928,239 (96.07) | 25,834,830 (29.05) | 26.18 | 85.41 | |
| S3_10.5 | SRR17500116 | 94,647,236 | 94,620,554 (99.97) | 91,837,075 (97.06) | 24,089,272 (26.23) | 26.81 | 87.02 | |
| S4_10.5 | SRR17469864 | 100,106,994 | 100,071,212 (99.96) | 96,974,288 (96.91) | 26,257,994 (27.08) | 28.24 | 86.65 | |
| S5_10.5 | SRR17504015 | 93,838,306 | 93,807,530 (99.97) | 90,983,847 (96.99) | 26,985,379 (29.66) | 26.65 | 86.46 | |
| S6_10.5 | SRR17500112 | 106,725,990 | 106,685,144 (99.96) | 102,643,077 (96.21) | 28,060,332 (27.34) | 30.58 | 87.37 |
Sequence read archive.
RT-qPCR primers.
| Gene name (Symbol) (GenBank accession number) | Nucleotide sequence (5′-3′) | Efficiency |
| Amplicon size (bp) | Source |
|---|---|---|---|---|---|
| Elongation of very long chain fatty acids protein 2 ( | F: CGGGTACAAAATGTGCTGGT | 100.9 | 0.983 | 145 |
|
| R: TCTGTTTGCCGATAGCCATT | |||||
| Fatty acid-binding protein, intestinal-like ( | F: CCTGGGCGTACAGTTTGACT | 100.9 | 0.998 | 164 | This study |
| R: TATAGCTCTGTACTAGCTCTCCTCC | |||||
| Glutathione S-transferase kappa 1 ( | F: GGAGTGGACATCAGCATCAGT | 92.8 | 0.960 | 197 | This study |
| R: ACACCTTATGATGCCAGAGGAA | |||||
| 3-hydroxyacyl-CoA dehydratase 2 ( | F: CAGACCGGAGCTCTTCTGG | 104.1 | 0.975 | 145 | This study |
| R: TGTCTTCATTCTGGACCTCTCG | |||||
| Hepatocyte growth factor a ( | F: CAGACGGGGACAAGATGCC | 110.2 | 0.999 | 104 | This study |
| R: CCGCGAAGAAGATAAACGCA | |||||
| Heat shock protein 90 alpha family class B member 1 ( | F: AGCCTCACGTTTTTCCAATCG | 92.4 | 0.978 | 150 | This study |
| R: TGCGTTGCCCACCATTAACT | |||||
| Monoglyceride lipase ( | F: CTTGTCAGTAATCTTTGGACCCCTA | 107.7 | 0.997 | 192 | This study |
| R: ATGCCTCTGTGAATTGCGCT | |||||
| Very long-chain acyl-CoA synthetase ( | F: TTCACCCAGAAGCATAGGAGC | 100.3 | 0.999 | 75 | This study |
| R: GGCCAAACTGGCAAAAAGGA | |||||
| Thyroid hormone responsive ( | F: CTACCGGGAACAGCCAGAAA | 106.9 | 0.995 | 74 | This study |
| R: GCATAGTGTTGGACTCGGCA | |||||
| Elongation factor 1 alpha ( | F: GTGGAGACTGGAACCCTGAA | 97.4 | 0.997 | 155 |
|
| R: CTTGACGGACACGTTCTTGA | |||||
| Polyadenylate-binding protein 1 ( | F: TGACCGTCTCGGGTTTTTAG | 99.2 | 0.999 | 108 |
|
| R: CCAAGGTGGATGAAGCTGTT | |||||
| 60S ribosomal protein 32 ( | F: AGGCGGTTTAAGGGTCAGAT | 99.6 | 0.995 | 119 |
|
| R: TCGAGCTCCTTGATGTTGTG |
Amplification efficiencies were calculated using a 6-point 1:5 dilution series starting with an equal mixture of cDNA from every sample.
Atlantic salmon Gene Index identification.
Normalizer genes chosen for this study.
Normalizer genes tested, but ultimately not chosen for this study.
FIGURE 1Differential transcript expression in response to rearing temperature. Venn diagrams depict the number of shared and separate differentially expressed (both up- and down-regulated; FDR-adjusted p < 0.05) transcripts identified by either DESeq2 (left), edgeR (right), or those in common (middle). Temperature comparisons are presented as (A) 10.5°C vs. 16.5°C, (B) 10.5°C vs. 13.5°C, (C) 13.5°C vs. 16.5°C, and (D) differentially expressed transcripts shared between both DESeq2 and edgeR for each pairwise comparison.
FIGURE 2Heatmap and hierarchical clustering of differentially expressed transcripts (1759 DETs) found in comparison of all three rearing temperature treatments. RNA samples used in sequencing are labeled on the base of the figure, with standardized fragments per kilobase of transcript per million mapped reads (FPKM) values for each DET clustered along the vertical axis.
FIGURE 3Selected significantly enriched (FDR-adjusted p < 0.05) gene ontology (GO) terms associated with significantly differentially expressed transcripts (DETs; both up- and down-regulated) between the 10.5°C and 16.5°C groups. The height of the bars represents the percentage of DETs found in the current study compared to total number of transcripts assigned to that specific GO term. A full list of enriched GO terms identified between the 10.5°C and 16.5°C groups can be found in Supplementary Table S4.
FIGURE 4Gene ontology (GO) term enrichment and pathway network analysis of significantly differentially expressed transcripts (DETs) between the 10.5°C and 16.5°C groups. (A) Downregulated DETs at 10.5°C (659 DETs). (B) Upregulated DETs at 10.5°C (718 DETs). Only significant (p < 0.05) network terms were included in the visualization. The diameter of each node indicates the level of significance for that specific term, with a larger node corresponding to a lower p-value. Node colour signifies related processes that share similar DETs. The shape of the node reflects the database where the term originated (circle, GO Biological Process; triangle, GO Molecular Function; square, GO Cellular Component; hexagon, Reactome). Dotted borders and labels were used to group related clusters and highlight general themes.
FIGURE 5Heatmap and hierarchical clustering of non-redundant differentially expressed transcripts (41 DETs) found in comparison of the 10.5°C and 16.5°C groups associated with GO: 0006631—Fatty Acid Metabolic Process. RNA samples used in sequencing are labeled on the base of the figure, with standardized fragments per kilobase of transcript per million mapped reads (FPKM) values for each DET clustered along the vertical axis.
FIGURE 6qPCR results of targeted transcripts involved in fatty acid/lipid metabolism (A–F), protein metabolism (G,H) and oxidoreductase activity (I). Normalized relative quantities (NRQs) are provided log2 transformed. Letters represent significant differences (p < 0.05) between rearing temperatures as determined by one-way ANOVA and subsequent Tukey’s post-hoc tests. Average fold-change values calculated from qPCR results and RNA-seq data (average between DESeq2 and edgeR) are provided in comparison of the 10.5°C and 16.5°C treatments.
FIGURE 7Regression plot of transcript expression fold-changes between the 10.5°C and 16.5°C treatments calculated from the RNA-seq dataset (average between DESeq2 and edgeR) and normalized relative quantity (NRQ) values from the qPCR-validation.
FIGURE 8(A) Correlogram of expression profiles for all transcripts used for RT-qPCR validation alongside fillet fatty acid (ω3, total omega-3; DHA, docosahexaenoic acid; EPA, eicosapentaenoic acid), amino acid (Lys, lysine; Met, methionine; His, histidine), and mineral (P, phosphorus; Ca, calcium) compositional results and phenotypic (HSI, hepatosomatic index; VSI, viscerosomatic index; K, condition factor) measurement data amongst all fish. The coloured scale shows degree of correlation ranging from r = −1.0 (red) to r = 1.0 (blue). The size of the coloured circle indicates its significance level and circles containing asterisks are significant at p < 0.05. (B) Principal component analysis (PCA) of the same multivariate dataset with distinction between rearing temperature treatments based on their phenotypic characteristics and transcript expression. Variable eigenvectors are coloured based on their contribution to Dimension (Dim) 1 and 2 of the PCA plot.