| Literature DB >> 35677308 |
Wei Chen1,2,3,4, Qingteng Lai3, Yanke Zhang3, Zhengchun Liu3,4.
Abstract
The infection of Staphylococcus aureus (S.aureus) and the spread of drug-resistant bacteria pose a serious threat to global public health. Therefore, timely, rapid and accurate detection of S. aureus is of great significance for food safety, environmental monitoring, clinical diagnosis and treatment, and prevention of drug-resistant bacteria dissemination. Traditional S. aureus detection methods such as culture identification, ELISA, PCR, MALDI-TOF-MS and sequencing, etc., have good sensitivity and specificity, but they are complex to operate, requiring professionals and expensive and complex machines. Therefore, it is still challenging to develop a fast, simple, low-cost, specific and sensitive S. aureus detection method. Recent studies have demonstrated that fast, specific, low-cost, low sample volume, automated, and portable aptasensors have been widely used for S. aureus detection and have been proposed as the most attractive alternatives to their traditional detection methods. In this review, recent advances of aptasensors based on different transducer (optical and electrochemical) for S. aureus detection have been discussed in details. Furthermore, the applications of aptasensors in point-of-care testing (POCT) have also been discussed. More and more aptasensors are combined with nanomaterials as efficient transducers and amplifiers, which appears to be the development trend in aptasensors. Finally, some significant challenges for the development and application of aptasensors are outlined.Entities:
Keywords: POCT; Staphylococcus aureus; aptasensor; electrochemical biosensor; nanomaterials; optical biosensor
Year: 2022 PMID: 35677308 PMCID: PMC9169243 DOI: 10.3389/fbioe.2022.889431
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
FIGURE 1SELEX process.
Aptamers selected against S.aureus by SELEX technique.
| Aptamer name | Aptamer sequence (5–3′) | Kd (nM) | Ref |
|---|---|---|---|
| SA20 | GCGCCCTCTCACGTGGCATCAGAGTGCCGGAAGTTCTGCGTTAT | 70.86 ± 39.22 |
|
| SA23 | GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA | 61.50 ± 22.43 | |
| SA31 | TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA | 82.86 ± 33.20 | |
| SA34 | CACAGTCACTCAGACGGCCGCTATTGTTGCCAGATTGCCTTTGGC | 72.42 ± 35.23 | |
| SA43 | TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 210.70 ± 135.91 | |
| SA17 | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 35.0 |
|
| SA61 | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 129.0 | |
| A14 | CACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT | 3.49 ± 1.43 |
|
| RAB1 | CGGGTGGGCTCCAATATGAATCGCTTGCCCTGACGCTATCT | 56 ± 87 |
|
| RAB3 | CGTAGTCTAGTGTCGATTAGTTTCCTTGAGACCTTGTGCT | 37 ± 112 | |
| RAB5 | CGTAGTCTAGTGTCGATTAGTTTCCTTGCTATTGCAGACCTTGTGCT | 58 ± 14 | |
| RAB10 | TCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT | 46 ± 24 | |
| RAB20 | GCGTTACGTTAGTGGCCGCCTATGAGGACAGGCGGTTGTA | 128 ± 45 | |
| RAB28 | TGGACGTCGTGGCGGAGGTTTTATAAAACGGCGCCACTGT | 49 ± 39 | |
| RAB35 | GGGGGGTTGTGCCATTTAAGATGACCGGTTGCCGCGATTT | 34 ± 5 | |
| SA25 | GGGGAAGGTCGTCCGACGAACCCGGTCAGATAGGGTGGGG | 44.92 ± 1.36 |
|
| SA28 | GCGGCCACGGAGGGGGTGCCGGGCGTGGAATAAGATGTGG | 77 ± 1.22 | |
| SA35 | CACAGGTGTGGGGAGGTCCCCATGGAGGTGGTTCAATG | 58.77 ± 0.73 | |
| SA37 | AAAGACGGGGGGGGGGACCGGCGTATGAGTGAAGATGGGG | 16.5 ± 3.41 | |
| SA40 | CGACGTGAAGCAATCATGGGTGGGGTACGTCGGGTCATGG | 126.95 ± 0.51 | |
| SA81 | AACGAGGCGCAGGGGGAGGGGGTGGTACAGATAAGATGGGG | 14.47 ± 8.18 |
Available aptasensors for detect S.aureus.
| Detection methods | Strategy/Assay | Linear range (CFU/ml) | LOD (CFU/ml) | Time | References |
|---|---|---|---|---|---|
| Colorimetric | Gold nanoparticle-based colorimetric aptasensor using tyramine signal amplification (TSA) technology | 10∼106 | 9 | 1∼2 h |
|
| Colorimetric | Visual detection based on aptamer recognition coupled to tyramine signal amplification | 10∼107 | 8 | 1∼2 h |
|
| Colorimetric | A colorimetric based on Cu-MOF-catalyzed chromogenic reaction with aptamer recognition and magnetic separation | 50∼104 | 20 | ∼1 h |
|
| Colorimetric | A chemiluminescence biosensor based on nicking enzyme amplification reaction and rolling circle amplification | 5∼104 | 5 | ∼2 h |
|
| Colorimetric | A colorimetric biosensor based on specific aptamer and catalysis of dsDNA-SYBR Green I (SG I) complex | 102∼107 | 81 | 5∼6 h |
|
| Colorimetric | A novel colorimetric immunoassay based on a combination of immunomagnetic separation and signal amplification | 10∼106 | 10 | ∼1 h |
|
| Colorimetric | on-site colorimetric based on aptamer-immobilized gold nanoparticles (aiGNPs) | 1.5 × 107∼5.3 × 107 | 1.5 × 107 | ∼1 h |
|
| Colorimetric | One-step colorimetric based on target-induced shielding against the peroxidase mimicking activity of aptamer-functionalized gold-coated iron oxide nanocomposites | 10∼106 | 10 | 12 min |
|
| Colorimetric | A colorimetry and fluorescenc dual-signal strategy based on Upconversion Nanoprobes | 56∼5.6 × 106 | 20 | / |
|
| Colorimetric | A multicolorimetric assay based on oxidase mimicking activity of aptamer-functionalized manganese dioxide-coated ferriferrous oxide (apt-Fe3O4/MnO2) nanocomposites and oxTMB etching of gold nanorods (AuNRs) | 10∼106 | 10 (bare eye) and 1.2∼1.4(UV–visible spectrometry) | 40 min |
|
| Fluorescence | A sensitive luminescent bioassay based on dual-color upconversion nanoparticles (UCNPs) and aptamer-functionalized magnetic nanoparticles | 10∼105 | 8 | 40 min |
|
| Fluorescence | Aptasensor simultaneous detection of various pathogenic bacteria based on multicolor upconversion nanoparticles (UCNPs) | 50∼106 | 25 | 40 min |
|
| Fluorescent | A sensitive assay based on aptamer-functionalized silica magnetic nanoparticles and fluorophore loaded and nuclease resistant oligonucleotides-capped nanokeepers (mesoporous silica nanoparticles) | 800∼104 | 682 | 17 min |
|
| Fluorescence | A dual-excitation sensing method based on aptamer-functionalized quantum dots and upconverting nanoparticle | 50∼106 | 16 | 30 min |
|
| Fluorescence | A dual recognition strategy using aptamer-coated magnetic beads and antibiotic-capped gold nanoclusters | 32∼108 | 16 | 3∼4 h |
|
| Fluorescence | A transcription aptasensor by using a light-up RNA aptamer | 102∼106 | 77 | / |
|
| Fluorescent | A fluorescent detection based on a finely designed functional chimera sequence, a molecular beacon (MB), and strand displacement target recycling | 80∼8 × 106 | 39 | 2∼3 h |
|
| Fluorescence | A highly selective platform based on aptamer-gated nano-materials | 10∼103 | 2 in buffer and 5 in blood | 1 h |
|
| Fluorescence | A fluorescent aptasensor based on strand displacement amplification (SDA) technology and unique self-assembled DNA hexagonal structure | 7∼7 × 107 | 1.7 | ∼5 h |
|
| Fluorescent | A fluorescence biosensor based on a peptide-mediated immunomagnetic separation technique and an immunofluorescence quantum dot technique | 10∼107 | 5.407 in buffer, 19.9 in tap water and 10.7 in milk simulation | ∼4 h |
|
| Fluorescence | A colorimetry and fluorescenc dual-signal strategy based on Upconversion Nanoprobes | 56∼5.6 × 106 | 22 | / |
|
| Fluorescence | A novel aptasensor based on aptamer-functionalized DNA−silver nanocluster nanofim | 107∼1011 | / | >12 h |
|
| Fluorescent | A new fluorescence biosensor using aptamer- and vancomycin -copper nanoclusters as dual recognition strategy | 102∼108 | 80 | 45 min |
|
| FRET | A multiplexed FRET-based aptamer biosensor using multicolor dyes as donors and carbon nanoparticles (CNPs) as a sole acceptor | 102∼106 | 50 | >3 h |
|
| FRET | A dual-recognition FRET sensor based on fluorescent vancomycin−gold nanoclusters and aptamer−gold nanoparticles | 20∼108 | 10 | 30 min |
|
| FRET | A FRET aptasensor based on self-assembled Fe3O4 and multicolor fluorescent carbon dots (CDs) | 50∼107 | 8 | 30 min |
|
| FRET | A biosensing platform based on the binding protection effect of aptamer-cell complex | 102∼107 | 64 | 1∼2 h |
|
| FRET | A fluorescent turn-on aptasensor based on the FRET between green carbon quantum dot and gold nanoparticle | 10∼108 | 10 | ∼2 h |
|
| FRET | A simple one-step FRET sensor based on the aptamer modified quantum dots (Aptamer-QDs) and antibiotic molecule of Teicoplanin functionalized-gold nanoparticles (Teico-AuNPs) | / | 1/cell | ∼2 h |
|
| FRET | An efficient FRET sensor based on stimuli-responsive nanoprobe PDANSs-FAM-Apt | 0∼3.5 × 108 | 1 | ∼6 h |
|
| FRET | A simple one-step FRET sensor based on aptamer-modified quantum dots (aptamer-QDs) w and antibiotic of teicoplanin functionalized-gold nanoparticles (Teico-AuNPs) | 10∼5 × 108 | 2 in buffer and 100 in milk | 1 h |
|
| FRET | A FRET aptasensor based on Aptamer-functionalized gold nanoparticles (AuNPs-aptamers) and cDNA-modified upconversion nanoparticles (UCNPs-cDNA) | 47∼4.7 × 107 | 10.7 | 17 min |
|
| Ratiometric FRET | A dual-recognition ratiometric fluorescent nanosensor based on the blue fluorescence of novel π-rich CNPs and NIR fluorescent Apt-Van-QDs | 0∼106 | 1 | 30 min |
|
| NSET | A one-step fluorometric strategy based on nanometal surface energy transfer (NSET) between carbon dots (CDs) and gold nanoparticles (AuNPs) | 10∼106 | 10 | ∼1 h |
|
| Fluorescence imaging | A fluorescence microscopy imaging based on positive dielectro-phoresis (pDEP) driven on-line enrichment and aptamer-fluorescent silica nanoparticle (FNP) | 50∼106 | 93 in deionized water and 270 in spiked water | 1∼2 h |
|
| Fluorescence imaging | A quantitative fluorescence imaging platform on a smartphone based on aptamer-functionalized fluorescent magnetic nanoparticles | 50∼2000 | 10 | 10 min |
|
| SERS | A magnetically assisted SERS biosensor based on Ag-coated magnetic nanoparticles, AgMNPs as SERS substrate and AuNR−DTNB@Ag−DTNB core−shell plasmonic NPs or DTNB-labeled inside-and-outside plasmonic NPs, DioPNPs as SERS tag | 10∼105 | 10 | 50 min |
|
| SERS | A SERS biosensor based on sandwich structure by using gold nanoparticles and MGNPs immmoblized with aptamers | 102∼107 | 35 | 2-3 h |
|
| SERS | A microfluidic optical device based on SERS-encoded nanoparticles functionalized with aptamer | / | <15 | 10 min |
|
| SERS | A label-free SERS detection based on aptamer dependent | 10∼107 | 1.5 | 25 min |
|
| SERS | Dual-recognition SERS biosensor based on vancomycin- -Au@MBA as SERS tags and aptamer-Fe3O4@Au as specific magnetic concentration and dual-SERS substrat | 10∼107 | 3 | 45 min |
|
| SERS | Fluorescence and SERS dual-mode biosensor based on gold nanoparticle-modified polystyrene microspheres (Au/PS) | 16∼1.6 × 105 | 3 | 1∼2 h |
|
| SERS | A SERS aptasensor based on AuNPs functionalized polydimethylsiloxane (PDMS)film | 43∼4.3×107 | 13 | >2 h |
|
| SERS | A SERS aptasensor based on artificial peroxidase enzyme regulated multiple signal amplified system | 10∼106 | 1.95 | >3 h |
|
| SERS | A simple and novel biosensor based on target-induced release of signal molecules from aptamer-gated aminated mesoporous silica nanoparticles (MSNs) coupled with surface-enhanced Raman scattering (SERS) technology | 47∼4.7 × 108 | 17 | 13 min |
|
| SERS | A SERS biosensor based on aptamer-facilitated gold/silver nanodimers and magnetic separation enrichment | 3.2 × 102∼3.2 × 107 | 96 | 30 min |
|
| SERS | A SERS biosensor based on the sandwich recognition of aptamer-functionalized magnetic beads and polyphenolic SERS nanotags | 102∼108 | 102 | 1∼2 h |
|
| SPR | The SPR aptasensors via a polyadenine-mediated immobilization method | 105∼108 | 106 | / |
|
| LSPR | A LSPR sensors based on aptamer at nanostructured plasmonic elements | / | 103 | 2 min |
|
| ECL | An electrochemiluminesce aptasensor based on the quenching effect of MoS2-PtNPs-vancomycin to S2O8 2−/O2 system | 1.5 × 102∼1.5 × 108 | 28 | 2∼3 h |
|
| CRET | An enhanced chemiluminescence resonance energy transfer aptasensor based on rolling circle amplification and WS2 nanosheet | 50∼1.5×105 | 15 | 1 h |
|
| Potentiometric | Label-free potentiometric biosensors based on carbon nanotubes and aptamers | 2.4 × 103∼2.0 × 104 | 8 × 102 | 30 min |
|
| Potentiometric | A potentiometric biosensor based on chemically modified graphene (transducer layer of the aptasensor) and aptamers (sensing layer) | / | 1 | 1-2 min |
|
| DPV | An electrochemical immunosensor based on dual-aptamer-based sandwich by using streptavidin coated magnetic beads (MB) and silver nanoparticles immmoblized with aptamers | 10∼106 | 1 | 30 min |
|
| DPV | A versatile signal-on electrochemical biosensor based on triple-helix molecular switch | 30∼3 × 108 | 8 | >3 h |
|
| DPV | An electrochemical biosensor based on the electrodeposition of Cu metal−organic framework (Cu-MOF) thin film | 7∼7 × 106 | 1.9 | 30 min |
|
| DPV | A dual signal amplification electrochemical biosensor based on a DNA walker and DNA nanoflower | 60∼6 × 107 | 9 | 140 min |
|
| EIS | Impedimetric aptasensor based on nanocomposite prepared from reduced graphene oxide and gold nanoparticles | 10∼106 | 10 | 60 min |
|
| EIS | Impedimetric biosensor based on aptamer as biological recognition element | 10∼109 | 10 | 10 min |
|
| EIS | An electrochemical aptasensor based on gold nanoparticles/carbon nanoparticles/cellulose nanofibers nano-composite (AuNPs/CNPs/CNFs) at the surface of glassy carbon electrode | 12∼1.2 × 108 | 1 | 30 min |
|
| Capacitance | A capacitance sensors array functionalized with aptamers | / | 10 | 1 h |
|
| Conductometric | Conductometric sensor based on magnetic analyte separation via aptamer | 4.1×103∼4.1×108 | 4.0 × 103 | 60 min |
|
| Volumetric bar-chart chip | A bacteria-detection V-Chip based on the extraordinary catalytic activity of platinum nanozyme and the aptamer-modified magnetic beads | 1∼108 | 1 | 1.5 h |
|
| Flow cytometry | A dual-color flow cytometry assay based on aptamer recognition and fluorescent silica nanoparticles (FSiNPs) | / | 150 in buffer and 760 in spiked milk | / |
|
| Resonancelight-scattering | A biosensor combines aptamer-conjugated gold Nanoparticles and a resonance light-scattering-detection system | / | 1 | 1.5 h |
|
| Nanophotonic interferometric | A nanophotonic interferometric biosensor based on a bimodal waveguide interferometer (BiMW) | 800∼1.6 × 105 | 29 | 12 min |
|
| Magnetoelastic | A magnetoelastic sensors based on an aptamer-modified magnetoelastic alloy | 10∼1011 | 5 | 5∼6 min |
|
| Piezoelectric | A novel aptamer/graphene interdigitated gold electrode piezoelectric sensor by employing aptamer as a biological recognition element | 41∼4.1 × 105 | 41 | ∼1 h |
|
| Lateral flow test strip | A lateral flow test strip based on the sandwich-type format using primary aptamer conjugated with gold nanoparticles (AuNPs) as the signal probe and a secondary aptamer-coated membrane as a capture probe | / | 104 | 10 min |
|
| Engineered aptasensor | A novel pathogen aptasensor swab based on functionalized nanobeads | 102∼105 | <100 (visual) and 2 (theoretically) | 5 min |
|
| Microfluidic biochip | Microfluidic device based on a polydimethylsiloxane (PDMS)/paper/glass hybrid and aptamer-functionalized graphene oxide (GO) | 104∼106 | 800 | 10 min |
|
| Microfluidic chips | Paper-based microfluidic chips based on dual-aptamer-based sandwich | / | 105 | 35 min |
|
| Pressure-based biosensor | POC testing protocol based on vancomycin (Van)-functionalized platinum nano-particles (PtNPs@Van) and aptamer-coated magnetic CuFe2O4 nanoprobes dual-recognition units and the catalyzed gas-generation reaction | 5∼104 | 1 | 30 min |
|
| PGM-based biosensor | Magnetic-aptamer biosensor based on the PGM platform and hybridization chain reaction strategy | 3∼3 × 103 | 2 | >5 h |
|
“/”: Not mentioned.
FIGURE 2Schematic illustration of the principle for detection of S. aureus with aptamer-high throughput colorimetric biosensor based on photocatalytic activity of dsDNA-SG I complex. Reproduced with permission (Yu et al., 2020).
FIGURE 3(A) Schematic representation of the fluorescent detection of S. aureus based on a finely designed functional chimera sequence, a molecular beacon (MB), and strand displacement target recycling. Reproduced with permission (Cai et al., 2019). (B) General design of the vancomycin and aptamer dual-recognition moieties-based ratiometric fluorescent nanoprobe with a remarkably large Stokes shift for ultrafast and accurate management of S. aureus at the single-cell level. Reproduced with permission (Shen et al., 2020). (C) Schematic illustration of the multiplexed luminescence bioassay based on aptamers-modified UCNPs for the simultaneous detection of various pathogenic bacteria. Reproduced with permission (Wu et al., 2014). (D) Schematic illustration of the fluorometric aptasensor for high-sensitivity S. aureus detection based on FRET of the self-assembled dimer, B-CD/Fe3O4. Reproduced with permission (Cui et al., 2019).
FIGURE 4General design of the smart nanoprobe PDANSs-FAM-Apt for accurate fluorescence detection and imaging-guided precise photothermal antibacteria. (A) Illustration of the assembly procedure of the nanoprobe PDANSs-FAM-Apt. (B) Diagram of the FRET-based assay procedure for PDANSs-FAM-Apt responsive to living S. aureus and imaging-guided photothermal killing of S. aureus. (C) Schematic of imaging-guided photothermal antifouling of the nanoprobe PDANSs-FAM-Apt for the destruction of S. aureus biofilms. Reproduced with permission (Ye et al., 2020).
FIGURE 5(A) Schematic illustration of the developed SERS biosensor based on aptamer functionalized PDMS film for the detection of S. aureus. Reproduced with permission (Zhu et al., 2021a). (B) Schematic illustration of S. aureus detection based on the target-responsive release of 4-ATP molecules from aptamer-gated MSNs. Reproduced with permission (Zhu et al., 2021b). (C) Schematic illustration of the CRET biosensor for the detection of S. aureus based on Co2+/ABEI-AuNFs and WS2 nanosheet. Reproduced with permission (Hao et al., 2017). (D) Schematic illustration of the enzyme-free ECL aptasensor for S. aureus detection based on AuNPs/hemin as the regenerable enhancers of S2O8 2−/O2 and the quenching effect of MoS2-PtNPs on S2O8 2−/O2. Reproduced with permission (Han et al., 2019).
FIGURE 6(A) (I) Fabrication of the DNA/AuNPs/MOFs-based sensing platform; (II) Schematic diagrams of the electrochemical biosensor for the detection of S. aureus via supernatants; and (III) pathogen cells. Reproduced with permission (Sun et al., 2021). (B) Schematic representation of the biosensor for S. aureus detection based on a DNA walker and DNA nanoflower. Reproduced with permission (Cai et al., 2021b). (C) Schematic representation of the versatile signal-on electrochemical biosensor for S. aureus detection based on triple-helix molecular switch. Reproduced with permission (Cai et al., 2021a). (D) Schematic of aptamer-functionalized capacitance sensor array for real-time monitoring of bacterial growth and antibiotic susceptibility. Reproduced with permission (Jo et al., 2018). (E) Schematic representation of the multichannel conductometric sensor for S. aureus detection based on magnetic analyte separation via aptamer. (I)the preparation of aptamer-functionalized magnetic beads, (II) selective capture and (III) separation of bacterial cells, and (IV) determination of viable bacteria by the conductometric sensor. Reproduced with permission (Zhang et al., 2020).
FIGURE 7(A) Working principle for detection of bacteria using BV-Chip. Reproduced with permission (Huang et al., 2019). (B) Schematic illustration of gas pressure-based POC testing protocol for highly sensitive and specific detection of S. aureus. Reproduced with permission (Li J. et al., 2019a). (C) Schematic illustration of the principle for portable detection of S. aureus using PGM based on HCR strategy. Reproduced with permission (Yang et al., 2021b). (D) The experimental procedure for multi-bacterial detection via bacteria-specific aptamers immobilized on a nitrocellulose (NC) membrane. 2nd (secondary) aptamer-biotin conjugated with biotin. Reproduced with permission (Wang et al., 2019a).