| Literature DB >> 35664294 |
Shun-Xia Ji1, Si-Yan Bi1, Xiao-Di Wang1, Qiang Wu1, Yan-Hong Tang1, Gui-Fen Zhang1, Fang-Hao Wan1,2, Zhi-Chuang Lü1, Wan-Xue Liu1.
Abstract
The tomato leaf miner Tuta absoluta (Meyrick) is one of the world's most destructive pests of tomato, and because of its severe economic impacts, as well as the development of pesticide resistance, the species has been intensively studied, especially in regard to the identification of targets for T. absoluta control. However, functional genomic studies of T. absoluta have been constrained by a lack of effective genetic tools. Therefore, the aim of the present study was to develop a CRISPR/Cas9 zygote microinjection protocol for generating heritable mutations in T. absoluta, using the ommochrome synthesis gene cinnabar as an easily evaluated target gene. The injection of fertilised eggs with Cas9 protein and four sgRNAs, which targeted cinnabar exon 3, resulted in a mutagenesis rate of 31.9% for eggs reaching adulthood, and cinnabar mutagenesis resulted in either red or mosaic eye colour phenotypes. As such, this study is the first to report a complete and detailed CRISPR/Cas9 workflow for the efficient genome editing of the globally important invasive pest T. absoluta. The application of this robust genome-editing tool to T. absoluta will greatly facilitate the discovery of suitable RNAi control targets and the subsequent development of novel control strategies.Entities:
Keywords: CRISPR/Cas9; Tuta absoluta; cinnabar; genome editing; lepidoptera
Year: 2022 PMID: 35664294 PMCID: PMC9160428 DOI: 10.3389/fgene.2022.865622
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
Summary of the cinnabar mutagenesis mediated by four sgRNAs in Tuta absoluta.
| sgRNAs + Cas9 Protein | RNase-free Water | |
|---|---|---|
| Number of eggs injected | 591 | 201 |
| Number of eggs hatched | 270 | 165 |
| Hatching rate | 45.7% | 82.1% |
| Number of surviving adults | 69 | 54 |
| Number of mutated adults | 22 | 0 |
| Phenotypic mutation efficiency | 31.9% | 0.0% |
Primer sequences used in this study.
| Primer | Primer Sequence (5´→3′) |
|---|---|
| Primers for Full-Length Gene Amplification | |
| F | CGGACTCGTGTTATTTA |
| R | GCACTTACCAATTAGAAA |
| Primers for screening mutant | |
| F | ATTGAGGAATCACCTACTA |
| R | ACATCTAAAACTGTTTACCA |
| Primers for synthesizing sgRNA | |
| sgRNA1-F | GAAATTAATACGACTCACTATAGGAGACAGACCCCTCTTGTCCGgttttagagctagaaatagc |
| SgRNA2-F | GAAATTAATACGACTCACTATAGGAATTTGGCGCTGTCTGTGCGgttttagagctagaaatagc |
| SgRNA3-F | GAAATTAATACGACTCACTATAGGTGCGAGGGAGAATGATACACgttttagagctagaaatagc |
| SgRNA4-F | GAAATTAATACGACTCACTATAGGATGACATACCTTACGACGCGgttttagagctagaaatagc |
| sgRNA-R | AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTgctatttctagctctaaaac |
FIGURE 1(A) Full-length cDNA sequence of Tuta absoluta cinnabar and its deduced amino acid sequence. Red boxes represented the three transmembrane domains. (B) Predicted conserved domains of the Tacinnabar protein. And three transmembrane domains were found in Tacinnabar. (C) Schematic of the exon/intron structures of the Tacinnabar gene. Solid blocks represented exons, and introns were indicated by full lines. The width of the solid blocks and the length of the black line were drawn in proportion to the actual length of the coding and non-coding regions, respectively.
FIGURE 2Phylogenetic tree based on the known amino acid sequences of cinnabar genes. The phylogenetic tree was constructed using the maximum likelihood method with 1,000 bootstrap replications in MEGA 7.0 Software. Values at the nodes are bootstrap values based on 1,000 replicates. Lepidoptera was depicted in red, Coleoptera in sky blue, Diptera in green, Hymenoptera in orchid, Hemiptera in orange, and Neuroptera in doderblue. Helicoverpa armigera (XP_021183543.1), Spodoptera frugiperda (XP_035436851.1), Spodoptera litura (XP_022820213.1), Maniola hyperantus (XP_034840116.1), Limenitis arthemis astyanax (QHN70696.1), Amyelois transitella (XP_013190001.1), Bicyclus anynana (XP_023953608.1), Galleria mellonella (XP_026757612.1), Plutella xylostella (XP_037974028.1), Bombyx mori (NP_001106135.1), Pieris rapae (XP_022118610.1), Chrysoperla carnea (XP_044742432.1), Anopheles stephensi (XP_035914333.1), Anopheles arabiensis (XP_040175243.1), Anopheles darling (ETN60831.1), Anopheles coluzzii (XP_040219701.1), Anopheles sinensis (KFB47145.1), Aedes aegypti (XP_001653516.2), Ceratitis capitata (XP_004522555.1), Drosophila willistoni (XP_015034226.1), Bactrocera dorsalis (XP_011207325.1), Neodiprion lecontei (XP_015524234.1), Athalia rosae (XP_025602652.1), Nasonia vitripennis (XP_001602258.1), Coccinella septempunctata (XP_044756441.1), Nilaparvata lugens (XP_039290505.1), Tribolium castaneum (NP_001034500.1).
FIGURE 3Sequencing assay on the PCR products in wild-type (A) and injected F0 (B,C). The sequences of F0 mutations showed multiple peaks, indicating the occurrence of the mutations. The fragments between the red arrows represent the mutated sites.
FIGURE 4CRISPR/Cas9 induced mutations at the cinnabar gene in Tuta absoluta F1 individuals. (A) Wild-type eye colour in control T. absoluta. (B) Cinnabar mutant adults showed red eyes, and (C) mutant adults showed mosaic eye colour.
FIGURE 5Mutant alleles and homology modelling of the 18 bp deletion in F1 generation. (A) The wild-type sequence was shown at the top with the target sites and the PAM (blue letters) was marked with black box. In mutant sequence, deletions were shown as red dashes and point mutation was shown as red letter. (B) Predicted 3D structure of the wild-type Tuta absoluta cinnabar protein (left) compared to the structure of the 18 bp deletion mutant (right). The deletion is predicted to cause the loop changes (red arrow).
FIGURE 6Part sequences of wild-type (A) and the garbled exon 3 of Tuta absoluta cinnabar in the F1 generation (B,C). The fragments between the red arrows represent the garbled bases.
FIGURE 7CRISPR/Cas9 workflow for the Tuta absoluta. Five stages: (1) adults laid eggs and collected all the eggs (within 3 h), (2) careful lined up the eggs on double-sided adhesive tape (with 30 min), (3) microinjection of embryos with a mixture of Cas9 protein and sgRNAs and placing back of injected embryos under rearing conditions (within 30 min), (4) careful transfer of newly hatched larvae on fresh tomato leaves (within 4–5 days) and (5) screening for the eye mutants after adult emergence (within 17–18 days).