Literature DB >> 35658533

Integration of the Salmonella Typhimurium Methylome and Transcriptome Reveals That DNA Methylation and Transcriptional Regulation Are Largely Decoupled under Virulence-Related Conditions.

Jeffrey S Bourgeois1,2, Caroline E Anderson1, Liuyang Wang1, Jennifer L Modliszewski3, Wei Chen3, Benjamin H Schott1,2, Nicolas Devos3, Dennis C Ko1,2,4.   

Abstract

Despite being in a golden age of bacterial epigenomics, little work has systematically examined the plasticity and functional impacts of the bacterial DNA methylome. Here, we leveraged single-molecule, real-time sequencing (SMRT-seq) to examine the m6A DNA methylome of two Salmonella enterica serovar Typhimurium strains: 14028s and a ΔmetJ mutant with derepressed methionine metabolism, grown in Luria broth or medium that simulates the intracellular environment. We found that the methylome is remarkably static: >95% of adenosine bases retain their methylation status across conditions. Integration of methylation with transcriptomic data revealed limited correlation between changes in methylation and gene expression. Further, examination of the transcriptome in ΔyhdJ bacteria lacking the m6A methylase with the most dynamic methylation pattern in our data set revealed little evidence of YhdJ-mediated gene regulation. Curiously, despite G(m6A)TC motifs being particularly resistant to change across conditions, incorporating dam mutants into our analyses revealed two examples where changes in methylation and transcription may be linked across conditions. This includes the novel finding that the ΔmetJ motility defect may be partially driven by hypermethylation of the chemotaxis gene tsr. Together, these data redefine the S. Typhimurium epigenome as a highly stable system that has rare but important roles in transcriptional regulation. Incorporating these lessons into future studies will be critical as we progress through the epigenomic era. IMPORTANCE While recent breakthroughs have enabled intense study of bacterial DNA modifications, limitations in current work have potentiated a surprisingly untested narrative that DNA methylation is a common mechanism of the bacterial response to environmental conditions. Essentially, whether epigenetic regulation of bacterial transcription is a common, generalizable phenomenon is a critical unanswered question that we address here. We found that most DNA methylation is static in Salmonella enterica serovar Typhimurium, even when the bacteria are grown under dramatically different conditions that cause broad changes in the transcriptome. Further, even when the methylation of individual bases change, these changes generally do not correlate with changes in gene expression. Finally, we demonstrate methods by which data can be stratified in order to identify coupled changes in methylation and gene expression.

Entities:  

Keywords:  DNA methylation; Salmonella; gene regulation; m6A; methylome; transcription

Mesh:

Substances:

Year:  2022        PMID: 35658533      PMCID: PMC9239280          DOI: 10.1128/mbio.03464-21

Source DB:  PubMed          Journal:  mBio            Impact factor:   7.786


INTRODUCTION

Until recently, systematically understanding how the bacterial DNA methylome affects physiology has been an unachievable task. Unlike eukaryotes where mC DNA methylation is highly abundant and can be detected with bisulfate sequencing (1), bacterial genomes primarily house m6A methylation, which has historically been difficult to detect. Despite this technological hurdle, many studies over the last several decades have successfully uncovered roles for DNA methylation in contexts of restriction-modification systems (reviewed in reference 2), as well as for “orphan” methylases (particularly the Dam methylase) in DNA repair (3–9), DNA/bacterial replication and viability (10–19), agn43 phase variation (20), LPS modifications (21–25), phage defense (21, 26, 27), mating (28, 29), fimbria formation (30, 31), antibiotic resistance (32), hypoxia survival (33), motility (17, 23, 31, 34), and other virulence-related processes (8–10, 16–19, 23, 31, 34–39). While orphan methylases were originally thought to regulate bacterial physiology, whereas restriction-modification systems targeted foreign DNA, recent work on “phasevarions” has shown that restriction-modification systems can indeed have a dramatic impact on the genome (reviewed in reference 40). A more complete history of associations between methylases and phenotypes can be found in recent reviews (41–43). While early epigenome studies are valuable for the insights they provide, they depended on low-throughput and relatively blunt approaches (e.g., restriction enzyme digests paired with Southern blotting to infer methylation). These approaches could not be leveraged to address whether and how genome-wide changes in DNA methylation associate with changes to cellular processes. However, the discovery that sequencing data from Pac-Bio single-molecule, real-time sequencing (SMRT-seq) (44) and Oxford Nanopore sequencing (45, 46) systems can be repurposed to detect m6A has heralded a golden age of bacterial DNA methylomics. These technological breakthroughs were rapidly applied to cataloging bacterial methylomes, many of which have been deposited in publicly available databases such as REBASE (47). However, we have only recently seen the power of these third-generation sequencing technologies applied to connect DNA methylation to cellular phenotypes. For instance, a recent paper utilized SMRT-seq to identify specific changes in G(m6A)TC patterns within the opvAB promoter that are highly present in the population following phage insult (48), building on previous phenotypic observations (21). Other groups have leveraged comparative epigenomics to examine methylation patterns across isolates and identify potentially important trends in methylation (35, 49, 50). Thus, there is immense potential for SMRT-seq to identify how methylation correlates with impactful biology. Despite these advances, we note that few studies have leveraged SMRT-seq to understand how methylation itself changes under different environmental pressures. Instead, the studies listed above typically examine methylomes under a single condition (typically late stationary-phase growth) to infer where methylation can happen, with notable exception (11, 32, 51–53). While informative, these approaches may not represent the methylation status of bacteria at growth phases typically studied in bacteriology and thus may have limited ability to integrate into the broader microbiological literature and with transcriptomic data sets. A related shortcoming of many methylation studies is that methylation sites in promoters are often reported as evidence of methylation-mediated regulation, without determining whether methylation is dynamic under relevant environmental changes or testing whether disrupting methylation at those sites impacts transcription. Curiously, while a number of classical approaches have identified examples of methylation at specific sites regulating gene expression (e.g., pap [30, 54, 55], opvAB [21], agn43 [56, 57], gtr [22], the std operons [58], dnaA [12], traJ [29], and sci1 [36]), we are unaware of any methylation site originally identified using genome-wide approaches that has been confirmed to impact gene expression. This disconnect between the technological advances in methylomics and the relatively modest conceptual advances in the field make it clear that the use of third-generation sequencing technologies to interrogate the DNA methylome is still in its infancy and that the important question of the generalizability of epigenetic regulation of transcription in bacteria should be addressed. Here, we perform a series of SMRT-seq and transcriptome sequencing (RNA-seq) experiments to understand the role of DNA methylation in regulating Salmonella enterica serovar Typhimurium (S. Typhimurium) gene expression under environmental conditions critical for Salmonella virulence. Specifically, we studied conditions that activate the motility and Salmonella Pathogenicity Island-1 (SPI-1) pathways (growth in Luria broth [LB] until late log phase) and conditions that activate the Salmonella Pathogenicity Island-2 (SPI-2) pathways (growth in low phosphate and magnesium [LPM] medium [59] until late log phase). Since methionine metabolism is intimately connected to methylation, we also examined the changes in methylation associated with derepressed methionine metabolism using a ΔmetJ mutant. In general, we found that DNA methylation is mostly stable across conditions and is broadly decoupled from gene expression changes. This study redefines our understanding of the S. Typhimurium epigenome, provides multiple epigenomic data sets that can be incorporated into future work to identify rare instances where methylation changes are coupled with transcription, and presents a basic blueprint for carrying out future methylomic studies with high reproducibility.

RESULTS

A genome-wide screen to understand how growth conditions and methionine metabolism impact m6A DNA methylation.

While previous work on bacterial DNA methylation has largely focused either on global DNA methylation patterns under a single condition or on how methylation of a single motif changes under different conditions, we sought to examine how the entire S. Typhimurium m6A DNA methylome changes under four biologically relevant conditions (Fig. 1A). We examined aerobic growth in LB to late exponential phase (optical density at 600 nm [OD600] ~ 1.5 to 2.0), which induces expression of flagellar genes and the genes in the Salmonella Pathogenicity Island-1 (SPI-1)—including the type III secretion system used during host cell invasion (60). The second condition cultured bacteria in a minimal media used to induce expression of genes in the Salmonella Pathogenicity Island-2 (SPI-2) (59)—which include the type III secretion system turned on in the host cell to promote Salmonella vacuolar survival (61, 62). The third and fourth conditions repeated growth in these media but used a methionine metabolism mutant S. Typhimurium strain (ΔmetJ). The MetJ protein represses expression of methionine metabolism genes (63). Thus, ΔmetJ bacteria have deregulated methionine metabolism and accumulation of methionine and related metabolites, including metabolites directly related to methylation processes such as the universal methyl-donor S-adenosylmethionine (SAM) (64), and the methyltransferase-inhibiting metabolites methylthioadenosine (65–67) and S-adenosylhomocysteine (68–72). Of note, we have not only previously confirmed increased abundances of both SAM and methylthioadenosine in the ΔmetJ mutant but also demonstrated that the ΔmetJ mutant has attenuated SPI-1 secretion, motility, and virulence (73), and we had previously hypothesized that these effects could be mediated through aberrant methylation.
FIG 1

Genome-wide analysis of m6A DNA methylation under various conditions. (A) Schematic of methylation experiment 1. Wild-type S. Typhimurium (strain 14028s) and an isogenic ΔmetJ strain were cultured in LB or SPI-2-inducing media, and DNA was collected for SMRT-seq. Bacteria grown under identical conditions were harvested for RNA-sequencing. (B and C) The total number of m6A bases observed across conditions does not dramatically change in wild-type and ΔmetJ bacteria (B) but does change dramatically in Δdam bacteria (C). (D) Analysis of motifs methylated reveals only the total number of ATGCA*T and “other” sites (sites that do not map to one of the six motifs) changes dramatically across conditions. The roughly 20 sites that could not be distinguished between CAGA*G or GA*GN6RTAYG methylation are listed as “CAGA*G or GA*GN6RTAYG.” (E) Δdam mutation results in ablation of GATC methylation. For panels B through E, bases were only included in the analysis if the base could confidently be called methylated or unmethylated across the eight conditions.

Genome-wide analysis of m6A DNA methylation under various conditions. (A) Schematic of methylation experiment 1. Wild-type S. Typhimurium (strain 14028s) and an isogenic ΔmetJ strain were cultured in LB or SPI-2-inducing media, and DNA was collected for SMRT-seq. Bacteria grown under identical conditions were harvested for RNA-sequencing. (B and C) The total number of m6A bases observed across conditions does not dramatically change in wild-type and ΔmetJ bacteria (B) but does change dramatically in Δdam bacteria (C). (D) Analysis of motifs methylated reveals only the total number of ATGCA*T and “other” sites (sites that do not map to one of the six motifs) changes dramatically across conditions. The roughly 20 sites that could not be distinguished between CAGA*G or GA*GN6RTAYG methylation are listed as “CAGA*G or GA*GN6RTAYG.” (E) Δdam mutation results in ablation of GATC methylation. For panels B through E, bases were only included in the analysis if the base could confidently be called methylated or unmethylated across the eight conditions. To analyze the DNA methylome, we performed a PacBio SMRT-seq experiment (here called “methylation experiment 1”) in a biological singlet (as has been common in the field and as we comment on below) to identify whether any changes in methylation could be observed. In this experiment, we also included Δdam and Δdam ΔmetJ mutants, which lack G(m6A)TC (henceforth an asterisk [*] will denote the adenosine that is m6A modified, e.g., “GA*TC”) methylation grown under SPI-1 and SPI-2 conditions. This allowed us to confirm that our pipeline could adequately detect changes in methylation. These eight conditions were split across two PacBio SMRT cells. Thus, these conditions enabled comparison of the S. Typhimurium DNA methylome under the two conditions most critical for Salmonella virulence (SPI-1 and SPI-2 induction), following perturbation of methionine metabolism, and with a control condition ablating the primary DNA methyltransferase. In total, this experiment defined the methylation status of 61,704 adenosine bases (GEO GSE185578); however, methylation status of some bases under certain conditions could not be determined since coverage was below 50×. Thus, we restricted our analysis to 51,177 bases in which the methylation status could be adequately determined for all conditions tested. These bases span both the S. Typhimurium genome and virulence plasmid. To compare methylation across conditions, we called methylation in two ways. First, we assigned each base a “percent methylated” value, which considered the percentage of reads for each base that were counted as methylated compared to the total number of reads (see Data Set S1). We also examined the data as a binary value in which we considered bases either methylated (if any methylation was detected) or unmethylated (see Data Set S2). Using this binary analysis, we observed that there were similar, but subtly different, amounts of m6A methylation across wild-type (WT) and ΔmetJ bacteria grown under LB and SPI-2 conditions (WT LB, 39,240 bases; WT SPI-2, 38,827 bases; ΔmetJ SPI-1, 39,352 bases; ΔmetJ SPI-2, 40,145 bases) (Fig. 1B), but that, as expected, the Δdam mutation reduced total methylation substantially (Fig. 1C). Quantitative methylation analysis. Download Data Set S1, XLSX file, 16.2 MB. Binary methylation analysis. Download Data Set S2, XLSX file, 16.5 MB.

ATGCAT motifs are frequently differentially methylated across conditions.

We next examined how these bases were distributed across different methylation motifs. This analysis detected methylation at motifs that had been previously detected in S. Typhimurium (74), though we were able to detect an additional motif, CRTA*YN6CTC, which appears to be the reverse complement of GA*GN6RTAYG. Notably, two motifs (CAGA*G and GA*GN6RTAYG) cannot always be distinguished, and so we included bases (~20 bases per condition) that matched both motifs in a separate category: “CAGA*G or GA*GN6RYAYG.” Bases that did not map to any known motif were listed as “Other.” As with the total amount of m6A methylation, we found that our four main conditions had subtle differences in the total numbers of most motifs (Fig. 1D). The most notable change in motif abundance occurred at the ATGCA*T motif, which is methylated by the YhdJ methylase (75). We observed more ATGCA*T methylation in bacteria grown under SPI-2-inducing conditions (P < 0.00001, chi-square test) or in ΔmetJ bacteria (P < 0.00001, chi-square test), with the highest ATGCA*T methylation present in ΔmetJ bacteria grown under SPI-2-inducing conditions. We also observed variation in the number of bases that mapped to the “Other” category. In contrast, we observed very little change in the total amount of GA*TC methylation (methylated by Dam) across these physiologically relevant conditions, though the deletion of dam resulted in almost complete ablation of methylation at the GATC motif (Fig. 1E). To examine the methylation changes under LB versus SPI-2 inducing conditions with wild-type and ΔmetJ S. Typhimurium, we compared binary methylation at each individual base to identify differentially methylated bases (bases that were called methylated in one condition but not another). While each condition had a few hundred to over a thousand bases that were not methylated in their opposing group, the vast majority of bases in this study (>38,000) were shared across these comparisons (Fig. 2A to C; Venn diagrams). This demonstrates that while the methylome is slightly responsive to the environment and methionine metabolism, it remains largely static across strikingly different conditions.
FIG 2

Integration of binary and quantitative analyses to understand differential methylation in S. Typhimurium. (A to C) Quantification of shared and unique methylated sites between wild-type S. Typhimurium grown in LB and SPI-2-inducing media (A), WT and ΔmetJ bacteria grown in LB (B), and WT and ΔmetJ bacteria grown in SPI-2-inducing media (C). Venn diagrams are based on binary measures of differential methylation. Sites identified by the binary analysis were examined in our quantitative data set in order to identify changes in the percent methylation. In the graphs, “Total” refers to all sites present in the relevant part of the Venn diagram, which were then broken down by motif. For motifs where no differentially methylated sites were present, a single dot is listed at 0%. For shared sites, the absolute value of the difference between bases are shown, and thus the numbers are agnostic to whether methylation is higher in either condition. Bars mark the median. For all panels, only bases that could be confidently called methylated or unmethylated under the eight conditions in Fig. 1 were considered.

Integration of binary and quantitative analyses to understand differential methylation in S. Typhimurium. (A to C) Quantification of shared and unique methylated sites between wild-type S. Typhimurium grown in LB and SPI-2-inducing media (A), WT and ΔmetJ bacteria grown in LB (B), and WT and ΔmetJ bacteria grown in SPI-2-inducing media (C). Venn diagrams are based on binary measures of differential methylation. Sites identified by the binary analysis were examined in our quantitative data set in order to identify changes in the percent methylation. In the graphs, “Total” refers to all sites present in the relevant part of the Venn diagram, which were then broken down by motif. For motifs where no differentially methylated sites were present, a single dot is listed at 0%. For shared sites, the absolute value of the difference between bases are shown, and thus the numbers are agnostic to whether methylation is higher in either condition. Bars mark the median. For all panels, only bases that could be confidently called methylated or unmethylated under the eight conditions in Fig. 1 were considered. Having identified these differentially methylated bases by our binary analyses, we integrated our quantitative data. This is an important measurement as previous work has speculated that methylation impacts bistable gene expression (48, 76), and thus changes in the percentage of the population in which a given base is methylated could have implications on the percentage of the population expressing a given gene. For each differentially methylated base, we asked what the total change in methylation was across the two conditions (Fig. 2; see graphs in panels A to C). The total median shift in the percent methylation varied by condition, but fell between 43 and 53%, suggesting that most bases go from unmethylated in one condition, to about half the copies of the genome having methylation at that site in the other. Notably, most of the “shared” bases that demonstrated methylation under both conditions demonstrated no quantitative change (median = 0%). However, again the exception was ATGCA*T, where the median shift among shared bases remained relatively high (11 to 23%, depending on the condition). To test for enrichment of motifs among differentially methylated bases, we compared the frequency of each of the six motifs tested above in the differentially methylated sites against the frequency observed in the entire condition. This analysis revealed that among the uniquely SPI-2-induced methylated bases, we observed 37 times more differentially methylated ATGCA*T sites than expected. Similarly, sites methylated in ΔmetJ S. Typhimurium, but not wild-type bacteria, grown under both LB and SPI-2-inducing conditions are also dramatically enriched for YhdJ-mediated methylation (20- and 11-fold enrichment, accordingly) (see Fig. S1A in the supplemental material). Surprisingly, all other motifs were either present at similar or dramatically lower abundance among differentially methylated sites than expected by chance, though we did note significant enrichment of “other” motifs among differentially methylated bases (20- to 100-fold enrichment, depending on the condition). Supplemental analyses and follow-up data. (A) Identification of motifs enriched in methylation sites unique to each of the comparisons in Fig. 2. Motif enrichment was calculated by dividing the frequency of the motif among the uniquely methylated bases by the genome-wide frequency of that motif within that condition, e.g., for panel A, the frequency of ATGCA*T within unique WT SPI-2 sites = 242 ATGCA*T sites/423 unique SPI-2 sites (0.57); the frequency of ATGCA*T within all WT SPI-2 = 600 ATGCA*T sites/38,843 detected motifs (0.015); (enrichment = 0.57/0.015 = 37.04). For all panels, only bases that could be confidently called methylated or unmethylated in all eight conditions in methylation experiment 1 were considered. (B and C) ACCWGG is enriched in “other” differentially methylated sites. The 40-bp flanking sites that were differentially methylated between wild-type and ΔmetJ bacteria grown in LB in our combined dataset (B) or between wild-type bacteria grown in LB and SPI-2-inducing conditions in methylation experiment 1 (C) but did not map to one of our six motifs were plugged into the MEME software (77) in order to identify overrepresented motifs. ACCWGG, a common miscall for the m5C motif CCWGG, was identified in both comparisons. (D) PCA analysis comparing data from the ΔmetJ RNA-seq experiment (see Data Set S4, Exp 1) and the ΔyhdJ experiment (see Data Set S5, Exp 2) cluster with data from Kröger et al. (78). The LB condition used from Kröger et al. was early stationary phase, for which the OD600 (~2.0) most closely matches the OD600 used in this study (1.5 to 2.0). Both the SPI-2-inducing condition and the SPI-2+MgCl2 condition were included from Kröger et al. Media separate along PC1, which accounts for 53.5% of the variation. Each condition from this paper is completed in triplicate (with three dots represented on the plot), each Kröger condition in duplicate (two dots on the plot). (E and F) flhDC expression is reduced in ΔmetJ. (E) In contrast to our previous findings (73), flhD expression is reduced in ΔmetJ bacteria by qPCR. Bacteria in late-log-phase growth in LB were harvested, RNA was stabilized, and RNA was extracted and quantified as described in the methods. Fold change (ΔmetJ/wild type) is expressed as 2–ΔΔ, where the flhD transcript was normalized to the rrs gene. Each dot represents the average of two to three technical replicates. (F) Endogenous tagging of flhC confirms reduced flhDC expression in ΔmetJ bacteria. A C-terminal 3×FLAG tag was added to the flhC gene, and the abundance of the protein was measured by Western blotting. The specificity of the FLAG antibody to FlhC-3×FLAG was confirmed by comparison to a wild-type, untagged S. Typhimurium strain. FlhC-3×FLAG abundance was quantified after correcting for loading by normalizing to total protein, and data are presented relative to wild-type (WT) flhC-3×FLAG S. Typhimurium. Each dot represents an independent experiment, bars represent the mean, and error bars the standard error of the mean. For panels E and F, P values are from a one-sample t test performed on the log-transformed data comparing the log values to 0. (G to J) Differentially methylated sites from Sánchez-Romero et al. (76) do not correlate with reproducible changes in gene expression. (G and H) carA (G) and dgoR (H) do not show reproducible changes in gene expression between LB grown and SPI-2-induced bacteria. (H and I) Other genes have reproducible effects in the dataset, including (H) prgH and (I) ssaT. “Exp 1” refers to the ΔmetJ RNA-seq experiment (see Data Set S4), and “Exp 2” refers to the ΔyhdJ RNA-seq experiment (see Data Set S5). The P value was calculated from the FDR. (K) Methylation upstream of flhDC does not contribute to the ΔmetJ motility defect. The −278 GATC sequence is not required for the impacts of ΔmetJ on motility. Motility on soft agar was measured 6 h after inoculating the agar and after migration at 37°C, each dot represents the average of three to five technical replicates, data were normalized to the grand mean prior to plotting or performing statistics, and P values were generated by two-way ANOVA with Sidak’s multiple-comparison test. Download FIG S1, TIF file, 2.8 MB.

A replication experiment demonstrates that SMRT-seq is highly reproducible and confirms differential methylation is predominantly driven by YhdJ.

To confirm our findings that DNA methylation was largely stable among our conditions with the exception of ATGCA*T sites, we repeated our SMRT-seq experiment with wild-type and ΔmetJ bacteria grown in LB (Fig. 3A, replication methylation experiment). Further, to confirm that the significant enrichment in ATGCA*T methylation in ΔmetJ bacteria that we observed above was due to YhdJ, we also sequenced ΔyhdJ and ΔyhdJ ΔmetJ S. Typhimurium grown in LB. Of note, although we sequenced eight samples across two SMRT cells in methylation experiment 1, we sequenced these four samples on two SMRT cells, significantly increasing our sequencing depth. The resulting data set called the methylation status of 60,502 bases under at least one condition; strikingly, 60,501 of these bases were confidently called in all four conditions (GEO GSE185501).
FIG 3

A replication screen reveals methylation is highly reproducible across SMRT-seq experiments but highlights the value of performing biological replicates. (A) Schematic for the replication methylation experiment. Wild-type S. Typhimurium (strain 14028s) or isogenic mutants were grown in LB media, and DNA was harvested for SMRT-seq. (B) Approximately 97% of all bases were called identically (methylated or unmethylated) in methylation experiment 1 and the replicate methylation experiments. (C) ATGCA*T and other sites had lower rates of replication compared to other motifs. (D) Only ATGCA*T and “other” sites (bases that do not map to one of the six motifs) change dramatically across tested conditions in the replication methylation experiment. No ATGCA*T methylation was observed in ΔyhdJ mutants. (E) The observed percent methylation at each base was reproducible across experiments. The color of the hexagon represents the number of bases that fall at that point on the axes. R2 values and trendlines represent the correlation across experiments. (F) Quantitative analysis reveals numerous sites are differentially methylated between wild-type and ΔmetJ bacteria. Each dot represents the mean percent methylation in wild-type bacteria across the two experiments subtracted by the mean methylation in ΔmetJ bacteria for each adenosine confidently called in both experiments. Blue and green dots mark bases where the mean difference is ≥10%. (G) Quantification of unique methylation sites in the replication experiment. For panels D to G, bases were only included in the analysis if the base could confidently be called methylated or unmethylated across conditions. (H) Venn diagram is based on binary measures of differential methylation in the combined data set. Sites identified by the binary analysis were examined in our quantitative data set in order to identify changes in the percent methylation. In the graphs, “Total” refers to all differentially methylated sites under that condition, and differentially methylated sites are then broken down by motif. For motifs where no differentially methylated sites were present, a single dot is listed at 0%. For shared sites, the absolute value of the difference between bases are shown and thus the numbers are agnostic to whether methylation is higher in either condition. Bars mark the median.

A replication screen reveals methylation is highly reproducible across SMRT-seq experiments but highlights the value of performing biological replicates. (A) Schematic for the replication methylation experiment. Wild-type S. Typhimurium (strain 14028s) or isogenic mutants were grown in LB media, and DNA was harvested for SMRT-seq. (B) Approximately 97% of all bases were called identically (methylated or unmethylated) in methylation experiment 1 and the replicate methylation experiments. (C) ATGCA*T and other sites had lower rates of replication compared to other motifs. (D) Only ATGCA*T and “other” sites (bases that do not map to one of the six motifs) change dramatically across tested conditions in the replication methylation experiment. No ATGCA*T methylation was observed in ΔyhdJ mutants. (E) The observed percent methylation at each base was reproducible across experiments. The color of the hexagon represents the number of bases that fall at that point on the axes. R2 values and trendlines represent the correlation across experiments. (F) Quantitative analysis reveals numerous sites are differentially methylated between wild-type and ΔmetJ bacteria. Each dot represents the mean percent methylation in wild-type bacteria across the two experiments subtracted by the mean methylation in ΔmetJ bacteria for each adenosine confidently called in both experiments. Blue and green dots mark bases where the mean difference is ≥10%. (G) Quantification of unique methylation sites in the replication experiment. For panels D to G, bases were only included in the analysis if the base could confidently be called methylated or unmethylated across conditions. (H) Venn diagram is based on binary measures of differential methylation in the combined data set. Sites identified by the binary analysis were examined in our quantitative data set in order to identify changes in the percent methylation. In the graphs, “Total” refers to all differentially methylated sites under that condition, and differentially methylated sites are then broken down by motif. For motifs where no differentially methylated sites were present, a single dot is listed at 0%. For shared sites, the absolute value of the difference between bases are shown and thus the numbers are agnostic to whether methylation is higher in either condition. Bars mark the median. Analysis of the two methylomic data sets using our binary assessment revealed that ~97.5% of bases replicated their methylation status across experiments, demonstrating that our results were highly reproducible (Fig. 3B; see Data Set S2). Of note, sites assigned to ATGCA*T or “other” motifs may include significantly more miscalled methyl bases, as only ~80% (79.3% of wild-type strains and 80.1% of ΔmetJ strains) “other” bases replicated their methylation status across experiments (Fig. 3C). Alternatively, as we see these bases are more dynamic across our conditions, these motifs may represent biologically meaningful sources of variation across experiments. Importantly, we again observed that ΔmetJ bacteria have increased ATGCA*T methylation and found 0 methylated ATGCA*T sites in ΔyhdJ and ΔyhdJ ΔmetJ mutants, confirming that YhdJ is the only ATGCA*T methylase active in both bacterial strains (Fig. 3D). Analysis of the two data sets using the quantitative measurement (see Data Set S3) revealed considerable replication across the data sets (wild type, R2 = 0.87; ΔmetJ, R2 = 0.86) (Fig. 3E). Considering these experiments as separate biological replicates and using an arbitrary cutoff of 10% average differential methylation, we identified 2,528 sites (of 50,962 total sites; 4.96%) that were differentially methylated between wild-type and ΔmetJ bacteria using this quantitative method (Fig. 3F). A total of 881 of these sites were more methylated in wild-type bacteria, and 1,647 were more methylated in ΔmetJ bacteria. Combined quantitative analysis. Download Data Set S3, XLSX file, 6.8 MB. Having assessed the reproducibility of SMRT-seq for both categorical and quantitative measures of methylation, we used our binary measurement to generate a combined data set containing bases which were (i) reliably detected in wild-type and ΔmetJ bacteria grown in LB in both experiments and (ii) were identically called methylated or unmethylated in both experiments. Using this data set (52,594 bases), we determined which differentially methylated bases repeated across the two studies. This number of bases is greater than the number of bases included in methylation experiment 1 analyses, since we no longer needed to exclude bases that did not reach sufficient coverage under either the SPI-2-inducing or Δdam conditions. While our data demonstrated that the vast majority of bases were called identically (~97.5%; Fig. 3B), we found that a disproportional number of bases that were called differentially methylated in the pilot study failed to replicate in the replication study, and vice versa. This is in line with our observation that there was reduced reproducibility in our more dynamic ATGCA*T and “other” motifs (Fig. 3C). In fact, while there were 1,382 bases called differentially methylated in the first experiment (Fig. 2B), and 2,544 bases called differentially methylated in the replicate study (Fig. 3G), only 308 differentially methylated bases were identified in the combined data set (Fig. 3H). Importantly, the overlap between these two replicates is much greater than expected by chance (3.7-fold enrichment; P < 0.0001, one-tailed binomial test), indicating that these biological replicates provide a high-confidence set of 308 differentially methylated sites, though some false positives likely remain. Our findings emphasize that while SMRT-seq calling of methylated bases is reliable, replication is especially important in examining bases that change between conditions. Of note, the combined data set once again revealed enrichment of differentially methylated “other” sites. To understand these sites, we examined the 40 bases surrounding the 143 instances of “other” differential methylation in the combined data set using “Multiple Em for Motif Elicitation” (MEME) software (77). This identified a single significant motif (E value = 6.1 × 10−16), ACCWGG (see Fig. S1B). The same motif was identified among the 969 differentially methylated “other” sites between LB and SPI-2 grown bacteria (methylation experiment 1; E value = 5.5 × 10−206; see Fig. S1C). The ACCTGG motif has been reported on multiple Salmonella serovar entry pages on REBASE (47); however, curators note that this is almost certainly a miscall for the m5C motif CCWGG—methylated by Dcm. Across the combined data set, we found 33 instances of this motif (23% of all differentially methylated “other” sites). This leads us to hypothesize that this dynamic “other” category may be predominantly driven by changes in the flexible m5C methylome, which warrants further investigation using sequencing technologies better equipped to detect cytosine methylation.

There is no association between the transcriptome and the genome-wide binary methylation analyses under the conditions tested here.

Canonically, changes in DNA methylation can lead to changes in transcription by enabling differential binding of transcription factors to genomic elements (reviewed in reference 41). However, studies that describe this in bacteria typically either (i) focus on single loci (see, for example, reference 48), or (ii) only speculate on direct mechanisms of transcriptional control based on methylase knockout experiments (see, for example, reference 35). No study has directly examined whether differential methylation across the S. Typhimurium genome correlates with differential expression under biologically relevant conditions. We attempted to fill this gap in knowledge by performing RNA-seq on wild-type and ΔmetJ bacteria grown in LB and SPI-2-inducing media (GEO GSE185072; see Data Set S4) and looking for correlations with our SMRT-seq data sets. ΔmetJ RNA-seq. Download Data Set S4, XLSX file, 2.6 MB. Prior to integrating our data sets, we confirmed our RNA-seq data matched previously observed trends. As expected, we identified many differentially expressed genes (DEGs; 2,639 DEGs at a false discovery rate [FDR] of <0.5) between wild-type bacteria grown in LB versus SPI-2-inducing conditions (Fig. 4A). These DEGs included a variety of expected genes, including higher expression of SPI-1 genes (e.g., sipB, 322-fold induction) and flagellar genes (e.g., fliD, 138-fold induction) in LB and higher expression of SPI-2 genes (e.g., ssaN and sscA; 182- and 579-fold induction, respectively) in SPI-2-inducing media. Further, these data cluster with previous transcriptomic analyses of gene expression in LB and SPI-2-inducing conditions (78) by principal component analysis (PCA; 53.5% of variation between the two studies explained by media; see Fig. S1D). Analysis of ΔmetJ DEGs revealed a number of expected trends, specifically that during growth in LB and SPI-2, ΔmetJ bacteria show upregulation of methionine metabolism genes resulting from direct derepression of the metabolic pathway (Fig. 4B and C) (63). Of note, we also observed reduced motility gene expression which we had previously reported (73) but were surprised that, in contrast to our prior work, we observed a small reduction in flhD expression in the ΔmetJ mutant. However, we confirmed this result by qPCR and Western blotting (see Fig. S1E and F) and speculate that improved DNase treatment in this study likely explains this difference.
FIG 4

Differentially methylated genes by binary analysis are not enriched for transcriptomic changes (A to C) RNA-seq reveals transcriptomic changes between LB grown and SPI-2 media grown wild-type bacteria (A), wild-type and ΔmetJ bacteria grown in LB (B), and wild-type and ΔmetJ bacteria grown in SPI-2 media (C). Corrected P values generated by calculating the FDR. (D) Schematic of RNA-seq and SMRT-seq integration. Each gene was determined to be differentially methylated (differentially methylated gene [DMG]) in our binary analysis, differentially expressed (differentially expressed gene [DEG]; FDR < 0.05), differentially methylated and differentially expressed (DM and DE gene), or neither differentially methylated nor expressed. A Fisher exact test was then used to determine whether there was an association between methylation and gene expression. (E to G) Differential methylation is not associated with differential expression. Observed and expected numbers of differentially methylated and differentially expressed genes were not significantly different when comparing uniquely methylated genes in LB versus SPI-2 media (E), wild-type versus ΔmetJ in LB (F), or wild-type versus ΔmetJ bacteria in SPI-2 media (G). Uniquely methylated genes are plotted in the condition under which they are methylated (e.g., for panel E, a gene that contains a base that is methylated in LB but not SPI-2 media would be plotted as part of “LB”) but are agnostic to the direction of effect for the expression data. Expected values are calculated by multiplying the frequency of differential methylation by the frequency of differential expression by the total number of genes in the analysis for each condition. Numbers used for the Fisher exact test are shown on the right. Data for panels E and G used data from methylation experiment 1, panel F used the “combined data set.” For panels F and G, the gene metJ is removed from the analysis, as it is artificially called both differentially methylated and expressed due to its excision from the genome.

Differentially methylated genes by binary analysis are not enriched for transcriptomic changes (A to C) RNA-seq reveals transcriptomic changes between LB grown and SPI-2 media grown wild-type bacteria (A), wild-type and ΔmetJ bacteria grown in LB (B), and wild-type and ΔmetJ bacteria grown in SPI-2 media (C). Corrected P values generated by calculating the FDR. (D) Schematic of RNA-seq and SMRT-seq integration. Each gene was determined to be differentially methylated (differentially methylated gene [DMG]) in our binary analysis, differentially expressed (differentially expressed gene [DEG]; FDR < 0.05), differentially methylated and differentially expressed (DM and DE gene), or neither differentially methylated nor expressed. A Fisher exact test was then used to determine whether there was an association between methylation and gene expression. (E to G) Differential methylation is not associated with differential expression. Observed and expected numbers of differentially methylated and differentially expressed genes were not significantly different when comparing uniquely methylated genes in LB versus SPI-2 media (E), wild-type versus ΔmetJ in LB (F), or wild-type versus ΔmetJ bacteria in SPI-2 media (G). Uniquely methylated genes are plotted in the condition under which they are methylated (e.g., for panel E, a gene that contains a base that is methylated in LB but not SPI-2 media would be plotted as part of “LB”) but are agnostic to the direction of effect for the expression data. Expected values are calculated by multiplying the frequency of differential methylation by the frequency of differential expression by the total number of genes in the analysis for each condition. Numbers used for the Fisher exact test are shown on the right. Data for panels E and G used data from methylation experiment 1, panel F used the “combined data set.” For panels F and G, the gene metJ is removed from the analysis, as it is artificially called both differentially methylated and expressed due to its excision from the genome. To integrate our differential expression data with our methylomics data, we considered genes that either (i) contained or (ii) were the closest gene to one or more binary differentially methylated sites (i.e., present at any level in one condition, absent in the other) to be “differentially methylated genes” (DMGs) (Fig. 4D). For each comparison, the status “differentially methylated” applied to the condition in which the methyl mark was present (e.g., when comparing LB-grown versus SPI-2-grown bacteria, an LB-grown DMG contains a methyl mark that is absent in SPI-2-grown bacteria). Using these criteria, we examined whether differentially methylated genes were more likely to be differentially expressed than predicted by chance. Strikingly, we did not observe enrichment of DEGs among our DMGs. The number of DEGs that were also DMGs under all comparisons was remarkably similar to the overlap of these categories expected by chance (Fisher P value > 0.05 in all cases), suggesting the two phenomena are typically not associated at the genome-wide level across any of our comparisons with binary calling of DMGs (Fig. 4E to G). Most importantly, there was no evidence of enrichment comparing WT S. Typhimurium grown in LB (SPI-1 inducing) and SPI-2 conditions (Fig. 4E), indicating that cooccurrence of differential methylation and differential gene expression is not observed more frequently than is expected by chance in switching between these two critical growth conditions in Salmonella pathogenesis. Notably, we also did not observe correlations if we adjusted the statistical thresholds for differential expression (see Fig. S2A to D), or if we stratified our data by the differential expression direction of effect (see Fig. S2E and F), the genic location of the differential methylation (see Fig. S2G), or to specific motifs (see Fig. S2H and I). Stratification of integrated data does not reveal additional associations between differentially expressed genes and differentially methylated genes. (A to I) Stratified binary data do not reveal additional associations. (A to C) The Fisher exact test does not reveal an association between differential expression and methylation when the statistical cutoff for differential expression is changed to a log2FC of >1.5 and an FDR-corrected P value of <0.05 for any condition. For wild-type LB versus SPI-2 comparisons, there are also no statistical associations when (D) the statistical cutoff for differential expression is changed to log2FC > 2.0, or when the data are stratified by (E) the direction of gene expression change in LB, (F) the direction of gene expression change in SPI-2 media, (G) differentially methylated bases upstream of genes, (H) differentially ATGCA*T methylation, or (I) differential GA*TC methylation. Uniquely methylated genes are plotted in the condition under which they are methylated (e.g., for panel B, a gene that has a methylated upstream base in LB but not SPI-2 media would be plotted as part of “LB”), but are agnostic to the direction of effect for the expression change except in panels E and F. Data for panel B from the combined dataset, all other data from methylation experiment 1. (J to R) Stratified quantitative data do not reveal additional associations. (J to L) The Fisher exact test does not reveal an association between differential expression and methylation when the statistical cutoff for differential expression is changed to a log2FC of >1.5 and an FDR-corrected P value of <0.05 for any condition, except for wild-type bacteria with increased methylation relative to ΔmetJ bacteria in SPI-2 media where an association was also seen with the less stringent cutoff. (M to O) A Fisher exact test does not reveal an association between differential expression and methylation differentially methylated bases when only differential methylation upstream of genes is considered. (P-R) A Fisher exact test does not reveal an association between differential expression and methylation when the definition of “differential methylation” is shifted to sites where (i) the base is ≥99% methylated in one condition, and (ii) has a difference of ≥10% between the two conditions, except for wild-type bacteria with increased methylation relative to ΔmetJ bacteria in SPI-2 media where an association was also seen with the less stringent cutoff. Differentially methylated genes are plotted in the condition under which they are hypermethylated (e.g., for panel M, a gene that has an upstream base with increased methylation in LB but not SPI-2 media would be plotted as part of “LB”), but are agnostic to the direction of effect for the expression change. Data for panels B, N, and Q from the combined dataset, all other data from methylation experiment 1. Download FIG S2, TIF file, 2.0 MB.

There is limited association between the transcriptome and the genome-wide quantitative methylation analyses under the conditions tested here.

In addition to these binary definitions to differential methylation, we examined whether there was enrichment of DEGs among DMGs defined by a difference in ≥10% methylation across conditions (Fig. 5A). Most of our binary observations replicated in this analysis (Fig. 5B and C), but we noted an association between DEGs and DMGs in wild-type bacteria grown in SPI-2-inducing media compared to ΔmetJ bacteria grown under the same conditions (Fig. 5D and Table 1). It is unclear why this condition is the exception to the general lack of association we observe, but it may suggest that methylases (particularly the dam methylase) and deregulated transcriptional machinery uniquely compete for access to these sites exclusively in minimal media. We also examined whether adjusting our thresholds for differential expression or limiting our search for differential to bases upstream of differentially expressed genes could reveal further correlations between expression and methylation, but no additional associations were found (see Fig. S2J to O). The association with sites in wild-type bacteria in SPI-2 media compared to ΔmetJ bacteria was still present with the more stringent DEG cutoff (see Fig. S2L) but was no longer present when analysis was restricted to upstream bases (see Fig. S2O). Finally, we leveraged the quantitative data set to examine the relationship between DMGs and DEGs in which DMGs are defined by bases completely methylated in one condition (≥99%) and hypomethylated in the other (≤89%) (see Fig. S2P to R). This revealed no additional associations, but the association with wild-type bacteria in SPI-2 media replicated once again. We conclude that for the crucial switch between SPI-1 and SPI-2 virulence gene programs, there is no association between m6A DNA methylation and transcriptional regulation but that specific mutants may show an association.
FIG 5

Quantitative analysis revealed an association between differential methylation and expression between wild-type and ΔmetJ bacteria. (A) Schematic of RNA-seq and SMRT-seq integration. Each gene in our quantitative analysis was determined to be differentially methylated (differentially methylated gene [DMG]: difference ≥10% methylation across conditions), differentially expressed (differentially expressed gene [DEG]: FDR corrected P value ≤0.05), differentially methylated and differentially expressed (DM and DE Gene), or neither differentially methylated nor expressed. A Fisher exact test was then used to determine whether there was an association between methylation and gene expression. (B to D) Differential methylation is typically not associated with differential expression. Observed and expected numbers of differentially methylated and differentially expressed genes were not significantly different when comparing uniquely methylated genes in LB versus SPI-2 media (B) or wild-type versus ΔmetJ bacteria in LB (C); however, a significant enrichment of DEGs was observed in hypermethylated sites in wild-type bacteria grown in SPI-2 media relative to ΔmetJ (D). Hypermethylated genes are plotted in a condition under which they have increased methylation (e.g., for panel B, a gene that contains a base that is more methylated in LB would be plotted as part of “LB”) but are agnostic to the direction of effect for the expression data. Expected values are calculated by multiplying the frequency of differential methylation by the frequency of differential expression by the total number of genes in the analysis for each condition. Numbers used for the Fisher exact test are shown on the right. Data for panels B and D used data from methylation experiment 1; data for panel C used the “combined data set.” For panels C and D, the gene metJ was removed from the analysis, as it is excised from the genome.

TABLE 1

Correlation of differential methylation and differential expression in wild-type S. Typhimurium grown in SPI-2 inducing media compared to ΔmetJ bacteria

Genomic location% methylated (SPI-2)
Δ% methylationaSTM14 IDCommon nameRelative locationMotifbLog2 FCc
WTΔmetJ
NC_016856.1__1217998811STM14_0002 thrA GenicGATCA*G–1.35
NC_016856.1__277289998811STM14_0276 ldcC GenicGA*TC0.89
NC_016856.1__288405988711STM14_0289 metN GenicGA*TC4.27
NC_016856.1__572813937419STM14_0601 sfbB GenicCAGA*G3.25
NC_016856.1__5732311009010STM14_0601 sfbB GenicGA*TC3.25
NC_016856.1__5732651008119STM14_0601 sfbB GenicGA*TC3.25
NC_016856.1__5733021008812STM14_0601 sfbB GenicGA*TC3.25
NC_016856.1__5738031009010STM14_0602NAdGenicGA*TC3.62
NC_016856.1__8611131008713STM14_0920 bioB GenicGA*TC–1.22
NC_016856.1__8614131008812STM14_0920 bioB GenicGA*TC–1.22
NC_016856.1__1048140988810STM14_1130 ompF GenicGA*TC1.32
NC_016856.1__14233541008911STM14_1619 thrS GenicGA*TC–0.59
NC_016856.1__1733156764036STM14_1975NAUpstreamOther1.46
NC_016856.1__1829331998613STM14_2086NAGenicGA*TC3.63
NC_016856.1__18312861007129STM14_2087 trpD GenicGA*TC3.71
NC_016856.1__18341221008416STM14_2089 trpB GenicCAGA*G2.13
NC_016856.1__2340851988117STM14_2702NAGenicGA*TC2.79
NC_016856.1__27463931008812STM14_3133NAGenicGATCA*G1.80
NC_016856.1__32709171008812STM14_3733 metK GenicGA*TC3.21
NC_016856.1__32727191008812STM14_3735NAGenicGA*TC–0.82
NC_016856.1__37224121009010STM14_4260 asd GenicCAGA*G2.03
NC_016856.1__43343541008713STM14_4936 katG GenicGA*TC5.10
NC_016856.1__44175341009010STM14_5030 aceA GenicGA*TC2.42
NC_016856.1__44176701007822STM14_5030 aceA GenicGA*TC2.42
NC_016856.1__44231751008911STM14_5035 metH GenicGA*TC3.09
NC_016856.1__44243721008911STM14_5035 metH GenicGA*TC3.09

That is, WT – ΔmetJ.

*, The metJ gene was excluded from these analyses due to artificial excision from the genome.

That is, ΔmetJ_SPI-2/WT_SPI-2. FC, fold change.

NA, not applicable.

Quantitative analysis revealed an association between differential methylation and expression between wild-type and ΔmetJ bacteria. (A) Schematic of RNA-seq and SMRT-seq integration. Each gene in our quantitative analysis was determined to be differentially methylated (differentially methylated gene [DMG]: difference ≥10% methylation across conditions), differentially expressed (differentially expressed gene [DEG]: FDR corrected P value ≤0.05), differentially methylated and differentially expressed (DM and DE Gene), or neither differentially methylated nor expressed. A Fisher exact test was then used to determine whether there was an association between methylation and gene expression. (B to D) Differential methylation is typically not associated with differential expression. Observed and expected numbers of differentially methylated and differentially expressed genes were not significantly different when comparing uniquely methylated genes in LB versus SPI-2 media (B) or wild-type versus ΔmetJ bacteria in LB (C); however, a significant enrichment of DEGs was observed in hypermethylated sites in wild-type bacteria grown in SPI-2 media relative to ΔmetJ (D). Hypermethylated genes are plotted in a condition under which they have increased methylation (e.g., for panel B, a gene that contains a base that is more methylated in LB would be plotted as part of “LB”) but are agnostic to the direction of effect for the expression data. Expected values are calculated by multiplying the frequency of differential methylation by the frequency of differential expression by the total number of genes in the analysis for each condition. Numbers used for the Fisher exact test are shown on the right. Data for panels B and D used data from methylation experiment 1; data for panel C used the “combined data set.” For panels C and D, the gene metJ was removed from the analysis, as it is excised from the genome. Correlation of differential methylation and differential expression in wild-type S. Typhimurium grown in SPI-2 inducing media compared to ΔmetJ bacteria That is, WT – ΔmetJ. *, The metJ gene was excluded from these analyses due to artificial excision from the genome. That is, ΔmetJ_SPI-2/WT_SPI-2. FC, fold change. NA, not applicable.

YhdJ plays little role in Salmonella physiology under standard conditions important for virulence.

While our data do not support a broad, global correlation between differential methylation and differential expression under most of our tested conditions, particularly comparing wild-type bacteria grown in LB and SPI-2-inducing conditions, this does not rule out that there are discrete examples where methylation and gene expression are causally linked in our data sets. We hypothesized that such instances could be identified by combining our data on methylation and transcriptional patterns under biologically relevant conditions with data from methylase knockout mutants to reduce our search space to putative sites of regulation. We tested this hypothesis with the YhdJ (the most dynamic methylase in our data set) and Dam (the most well-studied DNA methylase in Salmonella) mutants. RNA-seq on wild-type and ΔyhdJ bacteria grown in LB or SPI-2-inducing conditions (GEO GSE185073; see Data Set S5) revealed that knocking out yhdJ had almost no impact on the transcriptome. Apart from yhdJ itself, only 12 genes were differentially expressed in LB (Fig. 6A and Table 2) despite the loss of methylation at all 513 ATGCA*T sites (see Fig. 3D), and no genes were differentially expressed under SPI-2-inducing conditions (Fig. 6B). Curiously, GO-analysis (79, 80) demonstrated the differentially expressed genes are enriched for de novo UMP biosynthetic processes (FDR = 6.3 × 10−4) and de novo pyrimidine nucleobase biosynthetic processes (FDR = 8.31 × 10−4). However, examining these genes further revealed that only two differentially expressed genes contained or were near an ATGCAT sequence (dppA and pyrB), and only dppA was detected to house a methylated ATGCA*T motif in our replication methylation data set (Table 2), making the mechanism of this differential expression unclear. In agreement with these findings, yhdJ deletion had little impact on cellular or virulence phenotypes. The ΔyhdJ mutation had no effect on growth in LB or SPI-2-inducing media (Fig. 6C and D), a subtle increase on the amount of observed THP-1 cell infection (Fig. 6E), no effect on replication in THP-1 cells (Fig. 6F), no effect on motility (Fig. 6G), and almost no effect on fitness in intraperitoneal (i.p.) or enteric fever models of mouse infection—though a small increase in the number of ΔyhdJ CFU recovered from the spleen relative to the wild type following oral gavage was observed (Table 3). Across all phenotypes, no genetic interaction between yhdJ and metJ was detected. Thus, YhdJ has very little impact on transcription or virulence associated phenotypes, and if anything, modestly impairs Salmonella virulence.
FIG 6

YhdJ has limited impacts on S. Typhimurium biology under standard laboratory conditions. (A and B). YhdJ has limited impacts on the S. Typhimurium transcriptome in LB (A) and SPI-2-inducing media (B). Corrected P values generated by calculating the FDR. (C and D) YhdJ is not required for S. Typhimurium growth in LB (C) or SPI-2-inducing media (D). Data from three independent experiments with time points taken every 30 min. Error bars represent the standard errors of the mean. (E and F) YhdJ is not required for S. Typhimurium uptake (E) or replication (F) in THP-1 monocytes. Cells were infected for 60 min with S. Typhimurium harboring an inducible-GFP plasmid before treatment with gentamicin. GFP was induced for 75 min before analysis by flow cytometry. The percent GFP+ and the median of the GFP+ cells were measured 3 and 24 h postinfection. Panel E shows the amount of invasion that occurred by reporting the percentage of infected cells at 3 h postinfection, and panel F shows the replication that occurred after infection by dividing the median of the GFP+ cells at 24 h postinfection by the median of the GFP+ cells at 3 h postinfection. Data are from two to three independent experiments; each dot represents an independent replicate, bars mark the mean, and error bars are the standard errors of the mean. For Panel E, data were normalized to the grand mean before plotting or performing statistics, and for panel F statistics were performed on the log transformed values. P values were generated by two-way analysis of variance (ANOVA) with Sidak’s multiple-comparison test. (G) YhdJ does not impact S. Typhimurium motility. Motility on soft agar was measured 6 h after inoculating the agar and after migration at 37°C. The data are from three independent experiments; each dot is the average of four to five technical replicates, bars mark the mean, and error bars mark the standard error of the mean. Data were normalized to the grand mean prior to plotting or performing statistics. P values were generated by one-way ANOVA with Sidak’s multiple-comparison test. (H) YhdJ is conserved across several Salmonella serovars. Salmonella genomes (1,000 Typhimurium, 1,000 Typhi, 1,000 Paratyphi A, 1,000 Paratyphi B, 999 Newport, 1,000 Dublin, 1,000 Enteritidis, 1,000 Agona, 1,000 Heidelberg, and 79 Derby genomes) were obtained from EnteroBase (94, 95). Genomes were combined into a single FASTA file per serovar and blasted against the S. Typhimurium strain 14028s YhdJ protein sequence using BLAST+ (96). The BLAST score from the top “n” hits were plotted, where “n” is the number of genomes analyzed for that serovar. A black bar represents the median. Dotted lines represent the BLAST score obtained when blasting the 14028s genome, and the score obtained from the 151* truncation prevalent in S. Paratyphi A serovars.

TABLE 2

ΔyhdJ differential gene expression in LB medium

Gene IDGene nameLog2 FCa (ΔyhdJ/WT)Corrected P valueATGCAT motif? (relative location)Methylated?
STM14_4375 dppA –0.752.95E–08Yes (Genic)Yes
STM14_4084 yhdJ –6.392.25E–07NoNo
STM14_5353 pyrB –3.251.12E–06Yes (Genic)No
STM14_4024 codB –1.524.51E–06NoNo
STM14_0699 cstA –0.481.25E–05NoNo
STM14_5352 pyrI –3.382.32E–05NoNo
STM14_0819 NA 0.853.34E–05NoNo
STM14_4495 pyrE –1.493.84E–05NoNo
STM14_5141 acs –0.745.74E–05NoNo
STM14_1558 yeaG –0.620.0001NoNo
STM14_3061 uraA –1.30.0001NoNo
STM14_0078 carB –2.490.0001NoNo
STM14_1885 hdeB 0.990.0002NoNo

FC, fold change.

TABLE 3

YhdJ does not enhance S. Typhimurium fitness in C57BL/6J mice

ParameteraΔmetJ/WTΔyhdJ/WTΔmetJ ΔyhdJ/WTΔmetJ ΔyhdJ/ΔmetJ
i.p. infection (CFU from spleen)
    No. of mice6877
    Median (95% CI)0.23 (0.07–0.47)1.31 (0.60–1.84)0.26 (0.13–0.78)1.09 (0.000065–2.19)
    P0.0020.30.0020.2
ΔyhdJ/WT (spleen)ΔyhdJ/WT (ileum)
Oral infection (CFU from spleen and ileum)
    No. of mice2221
    Median (95% CI)1.65 (0.72–2.22)1.154 (0.74–1.55)
    P0.020.4

All mice were age and sex matched, both sexes are represented in all experiments, and all data are from at least two experiments. The median competitive index (“median”) was calculated by dividing the number colonies obtained of each genotype at 4 days postinfection. Median > 1 = numerator strain outcompeted denominator. CI, confidence interval. P values were calculated using a one-sample t test on log-transformed data.

YhdJ has limited impacts on S. Typhimurium biology under standard laboratory conditions. (A and B). YhdJ has limited impacts on the S. Typhimurium transcriptome in LB (A) and SPI-2-inducing media (B). Corrected P values generated by calculating the FDR. (C and D) YhdJ is not required for S. Typhimurium growth in LB (C) or SPI-2-inducing media (D). Data from three independent experiments with time points taken every 30 min. Error bars represent the standard errors of the mean. (E and F) YhdJ is not required for S. Typhimurium uptake (E) or replication (F) in THP-1 monocytes. Cells were infected for 60 min with S. Typhimurium harboring an inducible-GFP plasmid before treatment with gentamicin. GFP was induced for 75 min before analysis by flow cytometry. The percent GFP+ and the median of the GFP+ cells were measured 3 and 24 h postinfection. Panel E shows the amount of invasion that occurred by reporting the percentage of infected cells at 3 h postinfection, and panel F shows the replication that occurred after infection by dividing the median of the GFP+ cells at 24 h postinfection by the median of the GFP+ cells at 3 h postinfection. Data are from two to three independent experiments; each dot represents an independent replicate, bars mark the mean, and error bars are the standard errors of the mean. For Panel E, data were normalized to the grand mean before plotting or performing statistics, and for panel F statistics were performed on the log transformed values. P values were generated by two-way analysis of variance (ANOVA) with Sidak’s multiple-comparison test. (G) YhdJ does not impact S. Typhimurium motility. Motility on soft agar was measured 6 h after inoculating the agar and after migration at 37°C. The data are from three independent experiments; each dot is the average of four to five technical replicates, bars mark the mean, and error bars mark the standard error of the mean. Data were normalized to the grand mean prior to plotting or performing statistics. P values were generated by one-way ANOVA with Sidak’s multiple-comparison test. (H) YhdJ is conserved across several Salmonella serovars. Salmonella genomes (1,000 Typhimurium, 1,000 Typhi, 1,000 Paratyphi A, 1,000 Paratyphi B, 999 Newport, 1,000 Dublin, 1,000 Enteritidis, 1,000 Agona, 1,000 Heidelberg, and 79 Derby genomes) were obtained from EnteroBase (94, 95). Genomes were combined into a single FASTA file per serovar and blasted against the S. Typhimurium strain 14028s YhdJ protein sequence using BLAST+ (96). The BLAST score from the top “n” hits were plotted, where “n” is the number of genomes analyzed for that serovar. A black bar represents the median. Dotted lines represent the BLAST score obtained when blasting the 14028s genome, and the score obtained from the 151* truncation prevalent in S. Paratyphi A serovars. ΔyhdJ differential gene expression in LB medium FC, fold change. YhdJ does not enhance S. Typhimurium fitness in C57BL/6J mice All mice were age and sex matched, both sexes are represented in all experiments, and all data are from at least two experiments. The median competitive index (“median”) was calculated by dividing the number colonies obtained of each genotype at 4 days postinfection. Median > 1 = numerator strain outcompeted denominator. CI, confidence interval. P values were calculated using a one-sample t test on log-transformed data. ΔyhdJ RNA-seq. Download Data Set S5, XLSX file, 2.7 MB. These findings suggest that YhdJ is almost entirely dispensable under the conditions tested here, despite methylating over 500 sites in the genome and methylation of its ATGCA*T motif being the most dynamic under the conditions tested. We questioned whether YhdJ may play roles outside transcription, and whether its dynamic nature is incidental. Supporting this hypothesis, an evolutionary analysis of over 9,000 strains from 10 serovars revealed that the methylase is highly conserved, with the exception of S. Paratyphi A, where most strains harbor a 151* truncation (Fig. 6H). This conservation paired with our RNA-seq data suggest that YhdJ methylation is likely important but is unlikely to play a large role in gene regulation.

Integration of previous Δdam literature with methylomics data reveals stdA hypomethylation correlates with expression in LB.

After demonstrating that a ΔyhdJ mutant could not be leveraged to identify instances where gene expression and methylation are linked, we turned to the Δdam literature. Previous work on Salmonella transcriptomics revealed 17 virulence genes (making up 11 operons) that are differentially expressed between wild-type and Δdam S. Typhimurium grown in LB to mid-exponential phase (31). We hypothesized that these sites may show differential methylation and expression between our LB and SPI-2 media, since Salmonella deploy radically different virulence programs across these conditions and many of these 17 virulence genes are known to be expressed specifically under only one of these two conditions (14 of 17 were DEGs comparing these two conditions in our data, and the remaining three (STM14_3654, stdB, and stdC) lacked high enough expression to analyze). In order to test this hypothesis, we searched for GATC motifs upstream (within 500 bp) of the DEGs. Interestingly, 10/11 genes or operons we examined contain GATC sites within 500 bp upstream of these genes (Table 4). However, only one gene (stdA) showed evidence of differential methylation under physiological conditions. Interestingly, stdA is the only one of these 11 genes/operons where methylation of its promoter has been extensively studied (58, 81). The three GATC sites had reduced methylation following growth in LB; however, each was only hypomethylated on a single strand (Fig. 7A). Interestingly, this hypomethylation agrees with a previous report that Dam and transcription factors compete for binding to the stdA promoter (58), since we also observed significantly higher expression of stdA in LB than in SPI-2 media (Fig. 7B). Whether this represents a mechanism by which stdA is turned off in SPI-2 media or is a correlated consequence of increased stdA transcription in LB (or vice versa) is unclear, but this finding demonstrates that the phenomenon that García-Pastor et al. describe in Δdam mutants occurs naturally under biologically relevant conditions. For the other 10 virulence genes/operons that are reported to undergo differential gene expression in the dam mutant, we found no evidence that differential methylation plays any role during their induction during SPI-1 or SPI-2-inducing conditions.
TABLE 4

Percent methylation of GATC sites in experiment 1 within 500 bp upstream of Δdam differentially expressed virulence genes

Gene/operon (unlisted genes)Base ID% methylated in:
WT LBWT SPI-2Δdam LBΔdam SPI-2
fliC 206055210010000
20605531008800
206066810010000
206066910010000
206083610010000
206083710010000
fliD (fliS-fliT also in operon)206055210010000
20605531008800
206066810010000
206066910010000
lppB 146950810010000
14695099310000
146969710010000
 1469698878000
prgH-prgI-prgJ (prgK also in operon)NoneNoneNoneNoneNone
sicA-sipB-sipC 3051884928600
3051885989900
305193610010000
305193710010000
30520081009800
30520099910000
305205010010000
 305205110010000
sipD (sipA-iacP also in operon)304834610010000
 3048347999900
pipC (sopB also in operon)1138389999000
1138390969700
1138429999900
113843010010000
11384419910000
113844210010000
11385259610000
 11385269810000
cheR (STM14_2332-STM14_2331-cheZ also in operon)2026159909900
20261609610000
202638510010000
202638610010000
202641510010000
20264169210000
stdA 3211770769600
321177110010000
32117799610000
3211780879800
32117929710000
 3211793849400
stdB-stdC (STM14_3655 also in operon)321092410010000
321092510010000
3211283999900
 3211284899500
STM14_3654-STM14_3653 32068091009400
320681010010000

Based on reference 31.

FIG 7

The stdA promoter has differential methylation after growth in LB or SPI-2-inducing media. (A) Schematic of the region upstream of stdA. The percent methylation values for each GATC site on both strands are graphed based on data from wild-type bacteria in methylation experiment 1. (B) stdA is differentially expressed in wild-type bacteria grown in LB and SPI-2-inducing media. RNA-seq experiment 1 values are from the RNA-seq experiment, including ΔmetJ bacteria, and are listed in Data Set S4. RNA-seq experiment 2 values are from the experiment, including ΔyhdJ bacteria, and are listed in Data Set S5.

The stdA promoter has differential methylation after growth in LB or SPI-2-inducing media. (A) Schematic of the region upstream of stdA. The percent methylation values for each GATC site on both strands are graphed based on data from wild-type bacteria in methylation experiment 1. (B) stdA is differentially expressed in wild-type bacteria grown in LB and SPI-2-inducing media. RNA-seq experiment 1 values are from the RNA-seq experiment, including ΔmetJ bacteria, and are listed in Data Set S4. RNA-seq experiment 2 values are from the experiment, including ΔyhdJ bacteria, and are listed in Data Set S5. Percent methylation of GATC sites in experiment 1 within 500 bp upstream of Δdam differentially expressed virulence genes Based on reference 31. We also attempted to integrate our data with a recent study that examined genetic heterogeneity in S. Typhimurium (82). We examined the 16 hypomethylated sites they identified to determine whether our data set could find the same signatures of hypomethylation. Of the seven sites we were able to find in our data set, four showed signs of hypomethylation (see Table S3). Of these four, two sites upstream of carA and dgoR showed differential methylation across our conditions; however, no consistent trends were observed with differential gene expression across our two RNA-seq data sets (see Fig. S1G to J). Thus, while we were able to observe an association of gene expression and DNA methylation for one canonical example (stdA) during growth in LB versus SPI-2-inducing conditions, we did not find this to be a generalizable phenomenon for other genes reported to be differentially regulated in the dam mutant or hypomethylated in S. Typhimurium. Percent methylation compared to previous hypomethylation studies. Download Table S3, DOCX file, 0.02 MB.

Despite limited changes to the GA*TC methylome, metJ and dam interact to influence S. Typhimurium invasion and motility.

Having successfully used Δdam transcriptomics to identify one biologically meaningful cooccurrence of differential expression and methylation, we next attempted to leverage Δdam mutants to test our hypothesis that aberrant methylation in ΔmetJ bacteria contribute to the impact of the ΔmetJ mutation on invasion and motility (73). Importantly, we observed a small growth defect in Δdam and Δdam ΔmetJ bacteria, and so all bacteria used for these experiments were grown an extra 30 min prior to infection to standardize the growth phase used. Knocking out dam only modestly reduced the impact of ΔmetJ on invasion and is therefore unlikely to be the primary mechanism by which metJ deletion impacts invasion (Fig. 8A). In contrast, impairment in motility caused by metJ deletion was completely abrogated in Δdam genetic background, suggesting that dam and metJ impact motility through the same pathway (Fig. 8B). Importantly, comparing isogenic strains (wild-type versus ΔmetJ; Δdam versus Δdam ΔmetJ; Δdam pdam versus Δdam ΔmetJ pdam) revealed that complementation of dam on a low-copy-number plasmid (pWSK129) restored differences between Δdam and Δdam ΔmetJ bacteria, though we observed that dam complementation itself reduces motility further. This is likely due to modest dam overexpression, which has previously been reported to be a more potent inhibitor of S. Typhimurium 14028s motility than dam deletion (34).
FIG 8

dam is epistatic to ΔmetJ despite limited changes to the ΔmetJ GA*TC methylome. (A) The impacts of ΔmetJ on invasion partially depend on dam. THP-1 monocytes were infected for 60 min with S. Typhimurium harboring an inducible-GFP plasmid before treatment with gentamicin. GFP was induced for 75 min before analysis by flow cytometry. The percent GFP+ was measured at 3 h postinfection. The data are from three experiments; each dot represents an independent replicate, the bars mark the mean, and the error bars are the standard errors of the mean. (B) The impact of ΔmetJ on motility depends entirely on dam. Motility on soft agar was measured 6 h after inoculating the agar and after migration at 37°C. The data are from three independent experiments; each dot is the mean of four to five technical replicates, bars mark the mean, and error bars mark the standard errors of the mean. (C and D) Quantitative analysis reveals subtle changes to the GA*TC methylome in ΔmetJ bacteria. Each dot represents the difference average percent methylation of GA*TC bases in which the closest gene in differentially expressed (C) or GA*TC bases specifically upstream of differentially expressed genes (D), between WT and ΔmetJ bacteria grown in LB. The data are in duplicate from the methylation experiment 1 and the replication methylation experiment, with error bars showing the error of the mean. Data from panel D are expanded in Table 4. For panels C and D, any base with greater than or less than 0 differential methylation is colored green (more methylated in ΔmetJ bacteria) or blue (more methylated in wild-type bacteria). (E) The tsr promoter is modestly hypermethylated in ΔmetJ. Percent methylation is plotted for the −146 and −145 GATC motifs from the methylation experiment 1 and the replication methylation experiment, with error bars showing the errors of the mean. Site numbering is relative to the start codon. (F) The impacts of the ΔmetJ mutation on motility are partially tsr dependent. The data are from three independent experiments; each dot is the mean of four to five technical replicates, bars mark the mean, and error bars mark the standard errors of the mean. For panels A, B, and F, data were normalized to the grand mean prior to plotting or performing statistics and P values were generated by two-way ANOVA with Sidak’s multiple-comparison test.

dam is epistatic to ΔmetJ despite limited changes to the ΔmetJ GA*TC methylome. (A) The impacts of ΔmetJ on invasion partially depend on dam. THP-1 monocytes were infected for 60 min with S. Typhimurium harboring an inducible-GFP plasmid before treatment with gentamicin. GFP was induced for 75 min before analysis by flow cytometry. The percent GFP+ was measured at 3 h postinfection. The data are from three experiments; each dot represents an independent replicate, the bars mark the mean, and the error bars are the standard errors of the mean. (B) The impact of ΔmetJ on motility depends entirely on dam. Motility on soft agar was measured 6 h after inoculating the agar and after migration at 37°C. The data are from three independent experiments; each dot is the mean of four to five technical replicates, bars mark the mean, and error bars mark the standard errors of the mean. (C and D) Quantitative analysis reveals subtle changes to the GA*TC methylome in ΔmetJ bacteria. Each dot represents the difference average percent methylation of GA*TC bases in which the closest gene in differentially expressed (C) or GA*TC bases specifically upstream of differentially expressed genes (D), between WT and ΔmetJ bacteria grown in LB. The data are in duplicate from the methylation experiment 1 and the replication methylation experiment, with error bars showing the error of the mean. Data from panel D are expanded in Table 4. For panels C and D, any base with greater than or less than 0 differential methylation is colored green (more methylated in ΔmetJ bacteria) or blue (more methylated in wild-type bacteria). (E) The tsr promoter is modestly hypermethylated in ΔmetJ. Percent methylation is plotted for the −146 and −145 GATC motifs from the methylation experiment 1 and the replication methylation experiment, with error bars showing the errors of the mean. Site numbering is relative to the start codon. (F) The impacts of the ΔmetJ mutation on motility are partially tsr dependent. The data are from three independent experiments; each dot is the mean of four to five technical replicates, bars mark the mean, and error bars mark the standard errors of the mean. For panels A, B, and F, data were normalized to the grand mean prior to plotting or performing statistics and P values were generated by two-way ANOVA with Sidak’s multiple-comparison test.

The motility defect of ΔmetJ S. Typhimurium partially depends on tsr.

We hypothesized that the genetic interaction between dam and metJ could signify that differential GA*TC methylation in the ΔmetJ mutant suppresses bacterial motility. In striking contrast to this hypothesis, our combined binary data set revealed no genes that were both differentially GA*TC methylated and expressed (except for the deleted metJ itself) (Table 5). We next turned to our percent methylation data to examine whether a shift in methylation could explain differences in flagellar gene regulation between the two bacteria. Comparing percent methylation in both methylation data sets at all GA*TC methylated sites in which the nearest gene is differentially expressed identified 17 sites that had a ≥10% average difference in methylation between wild-type and ΔmetJ bacteria (Fig. 8C). Because cooccurrence of differential methylation and differential expression is expected to occur frequently by chance, we sought to limit our analyses to bases most likely to impact gene expression. To do this, we restricted our search to GA*TC sites that are upstream of differentially expressed genes and found two sites of interest. Specifically, these sites are both strands of a single GATC motif upstream of the chemotaxis gene tsr that shows elevated methylation in ΔmetJ bacteria (Fig. 8D and E and Table 6).
TABLE 5

Unique GA*TC sites between wild-type and ΔmetJ S. Typhimurium (combined data set)

Genomic locationaBaseGenic locationGeneProductDifferentially expressed?
Unique WT LB GA*TC sites
    NoneNoneNoneNoneNoneNAb
Unique ΔmetJ LB GA*TC sites
    NC_016856.11177765UpstreamSTM14_1293N-Acetylneuraminate EpimeraseNo
    NC_016856.14289018DownstreamSTM14_4888CDP-diacylglycerol PyrophosphataseNo

*, The metJ gene is excluded from these analyses due to artificial excision from the genome.

NA, not applicable.

TABLE 6

Percent methylation differences for GA*TC motifs upstream of ΔmetJ differentially expressed genes following growth in LB medium

BaseClosest gene (STM14 no.)Closest gene (common name)% methylation (WT – ΔmetJ)
Gene expression
Methylation expt 1Replication exptAvgLog2 FC (ΔmetJ/WT)Corrected P
4802770STM14_5446 tsr −23−5−14−1.280.006
4802769STM14_5446 tsr −15−8−11.5−1.280.006
2033749STM14_2341 flhD −1−18−9.5−0.530.05
3243659STM14_3699 serA −10−1−5.51.485.09E–13
4415526STM14_5029 aceB −100−51.886.67E–06
3335887STM14_38212−10−4–1.210.04
3400695STM14_38930−5−2.5−1.320.007
3400696STM14_3893−2−3−2.5−1.320.007
4415527STM14_5029 aceB −1−4−2.51.886.67E–06
2060553STM14_23782−6−2−1.520.0005
3335886STM14_3821−40−2−1.210.04
571705STM14_06002−5−1.54.11.63E–39
4415556STM14_5029 aceB −31−11.886.67E–06
4802790STM14_5446 tsr −1−1−1−1.280.006
3758504STM14_4305−21−0.5−1.416.13E–06
3846384STM14_4392−10−0.53.053.03E–07
571704STM14_06000004.11.63E–39
2060669STM14_2378000−1.520.0005
2746734STM14_3135 hmpA 0001.797.28E–05
2746735STM14_3135 hmpA 0001.797.27E–05
3243658STM14_3699 serA 0001.485.09E–13
3402626STM14_3894000−1.237.87E–08
4185969STM14_47720003.174.96E–10
4185987STM14_47720003.174.96E–10
4185988STM14_47720003.174.96E–10
4415557STM14_5029 aceB 100.51.886.67E–06
1049501STM14_1130 ompF 1111.084.46E–07
2060668STM14_2378201–1.520.0005
4185970STM14_47722013.174.96E–10
3758505STM14_4305132−1.416.13E–06
3846383STM14_4392−162.53.053.04E–07
2060552STM14_2378513–1.520.0005
4802791STM14_5446 tsr 703.5–1.280.006
1049502STM14_1130 ompF 544.51.084.46E–07
3402625STM14_3894454.5–1.237.86E–08
2072703STM14_2394 fliJ 15−45.5−1.550.006
2072704STM14_2394 fliJ 19−66.5−1.550.006

*, The metJ gene was excluded from these analyses due to artificial excision from the genome.

Unique GA*TC sites between wild-type and ΔmetJ S. Typhimurium (combined data set) *, The metJ gene is excluded from these analyses due to artificial excision from the genome. NA, not applicable. Percent methylation differences for GA*TC motifs upstream of ΔmetJ differentially expressed genes following growth in LB medium *, The metJ gene was excluded from these analyses due to artificial excision from the genome. This hypermethylation led us to hypothesize that increased methylation upstream of tsr in ΔmetJ bacteria could decrease tsr expression and thereby reduce motility. In line with this hypothesis, replacing tsr with a kanamycin resistance cassette partially ablated the ability for the ΔmetJ mutation to cause a motility defect (Fig. 8F, interaction term P = 0.005). Curiously, a search for the methylation-sensitive transcription factor CRP (41) binding motif (AAATGTGATCTAGATCACATTT) in the tsr promoter with the MEME FIMO Tool (83) demonstrated that the hypermethylated residue lies within a putative CRP binding site. Together, these data tentatively support a model in which hypermethylation upstream of tsr in ΔmetJ bacteria may contribute to the motility defect. However, additional studies are necessary to confirm a causal relationship.

Increased methylation in the flhDC promoter does not contribute to the ΔmetJ motility defect.

Given that unlike Δdam (Fig. 8B), Δtsr does not account for the entire impact of metJ deletion on motility (Fig. 8F, Δtsr::kanΔ metJ/Δtsr::kan ratio = 0.9), we hypothesized that there may be additional differences in GA*TC methylation between wild-type and ΔmetJ bacteria that impact motility. Further examination of our quantitative methylation data set (Table 6) revealed one additional plausible hypothesis: a site in the flhDC promoter (−278) that barely missed our 10% threshold (9.5% more methylated in ΔmetJ bacteria). We decided to test this site as well, since FlhDC make up the master flagellar regulator, and thus modest methylated-mediated regulation of the operon could explain our findings. To test whether differential methylation of the flhDC promoter could explain the motility defect in ΔmetJ bacteria, we performed site directed mutagenesis on the S. Typhimurium chromosome to mutate the base from GATC to GTTC. However, this mutation had no effect on motility in wild-type or ΔmetJ bacteria (see Fig. S1K), disproving the hypothesis that this site could contribute to the Δdam epistatic effect. Notably, this does not rule out that hypermethylation of this site could play a role in flagellar gene expression in other contexts but does demonstrate that it does not contribute to the ΔmetJ motility defect.

DISCUSSION

Here, we demonstrate that at the genome-wide level differential methylation and differential expression are not correlated. Under the critical conditions of SPI-1 or SPI-2 induction, we observed no association between DEGs and DMGs, whether examining binary changes in methylation or quantitative shifts in methylation of >10%. However, our results do demonstrate that genome-wide methylation studies of biologically relevant conditions can be integrated with data from methylase knockout mutants to identify methyl-bases that may be coupled with gene expression, as exemplified by the stdA and tsr examples. Integration of data from future methylomic studies with our publicly available data sets could reveal additional naturally occurring instances and potentially important cooccurrence of differential methylation and differential expression. As our work demonstrates, such instances will likely be challenging to identify, since they do not occur more often than expected by chance and therefore do not appear to be a general mechanism of gene regulation in Salmonella. In addition, we hope that this work encourages the generation of additional methylomic data sets under diverse and biologically relevant conditions in order to enable more intraspecies comparative methylomics. A surprising aspect of our work was that the most differentially active methylase we observed, YhdJ, appears to have almost no impact on the S. Typhimurium transcriptome under standard conditions. In contrast to Dam which has known impacts on DNA and bacterial replication (10–19), YhdJ also appears to be completely nonessential for S. Typhimurium fitness under our growth conditions and in mice. This raises questions about the broader role of DNA methylation, and in particular YhdJ methylation, in the bacterial cell. One tantalizing hypothesis is that YhdJ plays a role in phage defense, which would have been missed studying the conditions here. Alternatively, YhdJ may contribute to physical genomic structural stability under stress conditions, similar to a proposed role for Dam during antibiotic treatment (32). Although these hypotheses could explain why YhdJ does not impact gene expression, they fail to address why we observed reproducible changes in the YhdJ methylome across different conditions. As an answer to this, we speculate that these differences are due to changes in the accessibility of YhdJ to ATGCAT motifs under the different conditions, rather than intentional targeting of YhdJ to these sites. This could be due to differences in other genomic modifications that antagonize YhdJ function, altered protein-DNA interactions that mask ATGCAT sites, and/or changes to the three-dimensional (3D) conformation of the genome that prevent interactions between YhdJ and its motif. We propose three potential explanations for the lack of a consistent correlation between global m6A DNA methylation and gene expression in our data. The first is that while S. Typhimurium can and do use m6A methylation as a mechanism to promote bistability or otherwise regulate transcription, they do so sparingly. This would suggest that while the canonical examples of this are elegant (12, 21, 22, 29, 30, 36, 54–58, 82), they are rare exceptions to the general rules of S. Typhimurium gene regulation. While we are certainly not the first to discover individual sites of differential m6A methylation that do not correlate with gene expression (84, 85), this is the first analysis to demonstrate how widespread the phenomenon is in S. Typhimurium. The second hypothesis is that three of the four conditions tested here (wild-type or ΔmetJ bacteria grown in LB or SPI-2-inducing media) are nonrepresentative conditions, whereas our results with the wild-type versus the ΔmetJ mutant in SPI-2 media are more representative of methylation’s relationship with transcription. Notably, while this is possible, these conditions were specifically chosen since they (i) are relevant to the pathogenic capacity of the bacteria, (ii) are relevant to the conditions most frequently studied in laboratory settings, or (iii) disrupt metabolic pathways directly connected to methylation. Therefore, even if methylation plays larger roles in regulating gene expression under other conditions (e.g., nutrient poor conditions at ambient temperature, following phage insult, etc.), our findings would still suggest that most observed S. Typhimurium phenomenon are unlikely to be linked to changes in m6A methylation. The third possibility is that while m6A is the most common modification to the S. Typhimurium genome, other modifications (m5C, phosphorothioation, etc.) may have more important impacts on gene expression. In conclusion, through this work we have increased our understanding of the S. Typhimurium methylome by defining it as a highly stable system that is largely decoupled from the transcriptome at the genome-wide level. We hope that this work will serve as a reference for how to perform, analyze, and follow-up on DNA methylation studies and that it will help redefine how we think about m6A methylation in bacteria.

MATERIALS AND METHODS

Bacterial cell culture.

All Salmonella strains are derived from S. Typhimurium NCTC 12023 (ATCC 14028s) and are included in Table S1. All plasmids are included in Table S1. Chromosomal knockouts were generated by lambda-red recombineering (86). Site-directed mutagenesis of the chromosome was performed using a modified version of lambda-red recombineering, as previously described (87). Complementation plasmids were generated by cut and paste cloning using the pWSK129 plasmid (88). For all experiments, bacteria were maintained on LB (BD, Miller formulation) agar plates, grown in LB media overnight at 37°C at 250 rpm, and subcultured the following morning prior to experiments. The SPI-2-inducing media is the low phosphate and magnesium (LPM) media from Coombes et al. (59) and contains 5 mM KCl, 7.5 mM (NH4)2SO4, 0.5 mM K2SO4, 38 mM glycerol (0.3% [vol/vol]), 0.1% casein hydrolysate, 8 μM MgCl2, 337 μM K2HPO4 (pH 5.8), 80 mM MES (pH 5.8), with the final solution pH equal to 5.8. Propagation of temperature-sensitive plasmids occurred at 30°C and were cured at 42°C. Ampicillin was added to media at 100 μg/mL, kanamycin at 50 μg/mL, and apramycin at 100 μg/mL. Bacterial strains and plasmids used in this study. Download Table S1, DOCX file, 0.02 MB.

Mammalian cell culture.

THP-1 monocytes from the Duke Cell Culture Facility were cultured at 37°C in 5% CO2 in RPMI 1650 media (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum, 2 μM glutamine, 100 U/mL penicillin-G, and 100 mg/mL streptomycin. Cells used for Salmonella gentamicin protection assays were grown in antibiotic-free media 1 h prior to infection.

Sample preparation for SMRT-Seq.

S. Typhimurium were grown overnight, washed once, and subcultured 1:33 in LB for 2 h and 45 min to induce SPI-1 expression or 1:50 in SPI-2-inducing media for 4 h in order to induce SPI-2 expression. A total of 2 × 109 bacteria were pelleted, and DNA was extracted using a DNeasy blood and tissue kit (Qiagen). The optional RNase step in the protocol was performed to remove contaminating RNA according to the manufacturer’s instructions. DNA was stored at 4°C until library preparation. Multiplexed SMRTbell libraries for sequencing on a PacBio Sequel system were prepared from 1 μg of each microbial gDNA sample. Shearing of gDNA was performed using g-TUBE and centrifugation at 2,029 × g for 2 min to achieve a target mode size of 10 to 15 kb. SMRTbell libraries were then prepared using the SMRTbell Express Template Prep kit 2.0. Two pools of eight indexed libraries were prepared. Each pool was then sequenced on a PacBio Sequel SMRTcell using sequencing chemistry 3.0 and 10-h movie length.

Sample preparation for RNA-Seq.

S. Typhimurium were grown overnight, washed once, and subcultured 1:33 in LB for 2 h and 45 min or 1:50 in SPI-2-inducing media for 4 h. A total of 2 × 109 bacteria were pelleted at 5,000 × g for 5 min and resuspended in RNAprotect bacterial reagent (Qiagen) in order to stabilize transcripts. After 5 min, bacteria were repelleted, and resuspended in 200 μL of TE buffer containing lysozyme (15 mg/mL) and 20 μL of proteinase K. Bacteria were vortexed every 2 min for 15 min. Then, 700 μL of β-mercaptoethanol-containing RLT buffer was added. After vortexing, 500 μL of 96% ethanol was added, and the solution was mixed and applied to a RNeasy extraction column (Qiagen). The remainder of the RNeasy protocol was followed according to the manufacturer’s instructions. After RNA isolation, 3 to 6 μg of RNA was treated with Turbo DNase (Thermo-Fisher) according to the manufacturer’s instructions, with the exception that two successive 30-min DNase treatments were performed. To remove DNase after treatment, the solution was mixed with 350 μL of β-mercaptoethanol-containing RLT buffer, and then 700 μL of 96% ethanol was added. The mixture was then added to a RNeasy MinElute column (Qiagen), and RNA was reisolated according to the manufacturer’s instructions. RNA samples QC was performed with an Agilent fragment analyzer and a Qubit assay on the Perkin-Elmer Victor X2. An Illumina TruSeq Stranded total RNA-Seq kit combined with a Ribo-Zero rRNA removal kit (bacteria) was used to prepare total RNA-seq libraries. Total RNA was first depleted of the rRNA using biotinylated probes that selectively bind to rRNA molecules. The rRNA depleted RNA was then reverse transcribed. During the second-strand synthesis, the cDNA:RNA hybrid is converted into to double-stranded cDNA (dscDNA) and dUTP incorporated into the second cDNA strand, effectively marking the second strand. Illumina sequencing adapters were then ligated to the dscDNA fragments and amplified to produce the final RNA-seq library. The strand marked with dUTP is not amplified, allowing strand specificity sequencing. Libraries were indexed using a dual indexing approach allowing for multiple libraries to be pooled and sequenced on the same sequencing flow cell of an Illumina MiSeq sequencing platform. Before pooling and sequencing, fragment length distribution and library quality were first assessed on a fragment analyzer using a high-sensitivity DNA kit (Agilent Technologies). All libraries were then pooled in equimolar ratio and sequenced. Sequencing was done using 50-bp single-end reads. Once generated, sequence data were demultiplexed and Fastq files generated using Bcl2Fastq conversion software from Illumina.

SMRT-seq mapping and m6A analysis.

m6A methylation calls were performed using the pbsmrtpipe base modification and motif detection pipeline (Smrtlink v7.0.1.66975) with Salmonella enterica serovar Typhimurium strain 14028s (ASM2216v1) as the reference genome. For sites at or above 50× coverage, sites with a phred-based quality score greater than 40 were marked as “1,” for strong evidence of methylation; sites with ≥50× coverage but below QV40 were marked as “0,” for unlikely to be methylated. For sites below 50× coverage, methylation status was not estimated. Assigning methylated bases to motif(s) was performed by comparing the context of the base to known or identified motifs using Microsoft Excel. Motif enrichment was calculated by dividing the frequency of the motif in a given subset (e.g., frequency of the motif in bases only methylated in bacteria grown in LB) and dividing by the frequency of the motif in condition tested (e.g., frequency of the motif among all methylated bases in bacteria grown in LB). Additional methyl-bases were detected on the pWSK29 plasmid harbored in these strains; however, we did not include these bases in our analyses since this plasmid is not involved in the natural lifestyle of S. Typhimurium.

RNA-seq analysis and integration with methylomics.

RNA-seq data were processed using the TrimGalore toolkit (http://www.bioinformatics.babraham.ac.uk/projects/trim_galore) which employs Cutadapt (89) to trim low-quality bases and Illumina sequencing adapters from the 3′ end of the reads. Only reads that were 20 nucleotides or longer after trimming were kept for further analysis. Reads were mapped to the ASM2216v1 version of the Salmonella enterica strain 14028S genome and transcriptome (90) using the STAR RNA-seq alignment tool (91). Reads were kept for subsequent analysis if they mapped to a single genomic location. Gene counts were compiled using the HTSeq tool (http://www-huber.embl.de/users/anders/HTSeq/). Only genes that had at least 10 reads in any given library were used in subsequent analysis. Normalization and differential expression were carried out using the DESeq2 (92) Bioconductor (93) package with the R statistical programming environment (https://www.R-project.org/). The FDR was calculated to control for multiple hypothesis testing. Integration of methylomics and RNA-seq analysis occurred in three steps. First, a list of genes present in both analyses was generated. Second, rates of differential expression among (i) the entire list of genes present in both analyses and (ii) differentially methylated genes were called as genes containing 1+ base that was methylated in one condition but not another. Third, expected (frequency of differential expression in the entire list of genes present in both analyses multiplied by the frequency of differential methylation multiplied by the total number of genes in the analysis) and observed differentially methylated and differentially expressed genes were compared. A Fisher exact test was used to determine whether there were statistically significant associations between differential methylation and differential expression.

Analysis of yhdJ across Salmonella genomes.

In order to analyze conservation of yhdJ across the Salmonella enterica genomes, 9,078 genomes (1,000 Typhimurium, 1,000 Typhi, 1,000 Paratyphi A, 1,000 Paratyphi B, 999 Newport, 1,000 Dublin, 1,000 Enteritidis, 1,000 Agona, 1,000 Heidelberg, and 79 Derby genomes) were obtained from the EnteroBase repository (94, 95). Serovars examined here were specifically chosen to test for conservation among a diverse group of Salmonella. The specific strains were randomly selected and represented a variety of sources (human, agricultural animal, avian, reptiles, environment, etc.) within serovars, when possible. After downloading the genomes, all genomes of a given serovar were concatenated into a single FASTA file and used for analysis with the BLAST+ command line software (96). The 14028s YhdJ protein sequence was used as query for the pBLASTn program. To determine conservation, the program produced BLAST scores for “n” sequences, where n = the number of strains tested within each serovar. The BLAST scores were then plotted relative to the BLAST score obtained using the 14028s genome.

GO-term analysis.

All GO-terms were generated using the Gene Ontology Resource (http://geneontology.org/) (79, 80). A PANTHER overrepresentation test was run using the Salmonella Typhimurium GO biological process reference, the test used the Fisher exact test, and the correction was based on a calculated false discovery rate. All calculations were run automatically though the web portal software. Any gene that was not present in the GO-term database was “unmapped” and excluded from the analysis.

Growth curves.

S. Typhimurium were grown overnight in LB, subcultured 1:50 into 5 mL of either LB or SPI-2-inducing media, and grown at 37°C at 250RPM. OD600 measurements were taken every 30 min using a spectrophotometer (Pharmacia Biotech Novaspec II).

Gentamicin protection assay.

Invasion and replication were measured as previously described (97–99). Briefly, bacteria were grown overnight, subcultured 1:33 into 1 mL of LB, and grown for 2 h and 45 min or until all strains entered late-log phase growth (OD600 = 1.5 to 2.0) at 37°C with 250 rpm. For any experiment using Δdam bacteria, all bacteria were grown an extra 30 min (3 h and 15 min) so that the Δdam and Δdam ΔmetJ mutants reached late-exponential-phase growth. A total of 100,000 THP-1 monocytes in antibiotic-free media were then infected by S. Typhimurium (MOI of 5). At 1 h postinfection, cells were treated with gentamicin (50 μg/mL), and IPTG (isopropyl-β-d-thiogalactopyranoside) was added 2 h postinfection to induce bacterial GFP expression. At 3 h and 15 min postinfection, cells were read by using a Guava Easycyte Plus flow cytometer (Millipore). At 22 h and 45 min postinfection, IPTG was added to remaining wells to induce GFP, and at 24 h postinfection the cells were quantified by flow cytometry. The percent host cell invasion was determined by quantifying the number of GFP+ cells 3 h and 15 min postinfection, and replication was assessed by determining the ratio of the median intensity of GFP+ cells at 24 h postinfection divided by the median of the GFP+ cells at 3 h and 15 min postinfection.

Motility assays.

All strains were cultured overnight in LB, subcultured 1:33 into LB, and grown for 2 h and 45 min at 37°C with 250 rpm. A pipette tip was used to puncture and deliver 2 μL of S. Typhimurium into the center of a 0.3% LB agar plate. Plates were incubated at 37°C for 6 h before the halo diameter was quantified.

Murine competitive index experiments.

Mouse studies were approved by the Duke Institutional Animal Care and Use Committee and adhere to the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All experiments were performed with age- and sex-matched C57BL/6J (7- to 14-week-old) mice. Bacteria were grown overnight, subcultured 1:33, and grown for 2 h and 45 min at 37°C at 250 rpm. The bacteria were then washed and resuspended in phosphate-buffered saline. Inoculua were confirmed by plating for CFU. For oral infections, mice were fasted for 12 h before infection and given 100 μL of a 10% sodium bicarbonate solution by oral gavage 30 min before infection. Mice then received a 1:1 mixture of two S. Typhimurium strains containing either pWSK29 (AmpR) or pWSK129 (KanR) (88), totaling 108 CFU in 100 μL, by oral gavage. For i.p. infections, mice were injected with a 1:1 mixture of two S. Typhimurium strains, totaling 103 CFU in 100 μL, into the i.p. space. For both models, tissues were harvested 4 days postinfection, homogenized, and plated on LB agar containing either ampicillin or kanamycin. The competitive index was calculated as follows: (no. of strain A CFU in tissue/no. of strain B CFU in tissue)/(no. of strain A CFU in inoculum/no. of strain B CFU in inoculum). Statistics were calculated by log transforming this ratio from each mouse and comparing to an expected value of 0 using a one-sample t test.

RT-qPCR.

RNA was harvested as described above and used to create cDNA using the iScript cDNA synthesis kit (Bio-Rad Laboratories). qPCR was performed using the iTaq Universal SYBR green Supermix (Bio-Rad Laboratories). Next, 10-μL reactions contained 5 μL of the supermix, a final 500 nM concentration of each primer, and 2 μL of cDNA. Reactions were run on a QuantStudio 3 Thermo Cycler. The cycling conditions were as follows: (i) 95°C for 30 s, (ii) 40 cycles of 95°C for 15 s and 60°C for 60 s, and then (iii) 60°C for 60 s. A melting curve was determined in order to verify single PCR products. The comparative threshold cycle (C) method was used to quantify transcripts, with the ribosomal rrs gene serving as the endogenous control. The fold change represents 2–ΔΔ. Oligonucleotides are listed in Table S2. Oligonucleotides used in this study. Download Table S2, DOCX file, 0.02 MB.

Western blotting.

flhC was tagged with the 3xFLAG tag using recombineering as previously described (100). S. Typhimurium bacteria were grown overnight in LB, subcultured 1:33 in LB at 37°C and 250 rpm until reaching late log phase (OD600 = 1.5 to 2.0), and then pelleted by centrifugation at 6,000 × g for 5 min. Pellets were resuspended in 2× Laemmli buffer (Bio-Rad) with 5% 2-mercaptoethanol and boiled for 10 min, and lysates were run on Mini-Protean TGX stain-free gels (Bio-Rad). After electrophoresis, the gels’ total protein dye was activated by a 5-min UV exposure. After transfer onto Immun-Blot low-fluorescence polyvinylidene difluoride membrane (Bio-Rad) using a Hoefer TE77X, blots were probed using an anti-FLAG M2 antibody (Sigma, catalog no. F3165). A florescent secondary antibody (LI-COR IRDye) was used to detect bands on a LI-COR Odyssey Classic. Band intensity was quantified using LI-COR Odyssey Imaging System Software v3.0. Total protein was detected by 30 s of UV exposure and quantified using Fiji (101). The graphed relative signal was calculated as follows: (FLAG band intensity/total protein)/(FLAG band intensity in wild-type flhC:FLAG3× bacteria/total protein in wild-type flhC:FLAG3× bacteria).

Statistical analyses.

Statistics were performed using GraphPad Prism 9 or Microsoft Excel, except where otherwise noted. Where noted, interexperimental noise was removed from gentamicin protection assays and motility assays prior to data visualization or statistical analysis by standardizing data to the grand mean by multiplying values within an experiment by a constant (the average of all experiments divided by the averages of specific experiments). All statistical tests corresponding to reported P values are described in the appropriate figure legends.

Data availability.

All sequencing data are available in the NCBI’s Gene Expression Omnibus (GEO) (102) Super Series (GSE185077). This includes both SMRT-seq experiments (GSE185578 and GSE185501), as well as both RNA-seq experiments (GSE185072 and GSE185073). All biological resources are available upon request to Dennis Ko.
  100 in total

1.  DNA adenine methylase mutants of Salmonella typhimurium show defects in protein secretion, cell invasion, and M cell cytotoxicity.

Authors:  F García-Del Portillo; M G Pucciarelli; J Casadesús
Journal:  Proc Natl Acad Sci U S A       Date:  1999-09-28       Impact factor: 11.205

2.  Gene ontology: tool for the unification of biology. The Gene Ontology Consortium.

Authors:  M Ashburner; C A Ball; J A Blake; D Botstein; H Butler; J M Cherry; A P Davis; K Dolinski; S S Dwight; J T Eppig; M A Harris; D P Hill; L Issel-Tarver; A Kasarskis; S Lewis; J C Matese; J E Richardson; M Ringwald; G M Rubin; G Sherlock
Journal:  Nat Genet       Date:  2000-05       Impact factor: 38.330

3.  DNA adenine methylase mutants of Salmonella typhimurium and a novel dam-regulated locus.

Authors:  J Torreblanca; J Casadesús
Journal:  Genetics       Date:  1996-09       Impact factor: 4.562

Review 4.  The bacterial epigenome.

Authors:  María A Sánchez-Romero; Josep Casadesús
Journal:  Nat Rev Microbiol       Date:  2019-11-14       Impact factor: 60.633

5.  DNA adenine methylation regulates virulence gene expression in Salmonella enterica serovar Typhimurium.

Authors:  Roberto Balbontín; Gary Rowley; M Graciela Pucciarelli; Javier López-Garrido; Yvette Wormstone; Sacha Lucchini; Francisco García-Del Portillo; Jay C D Hinton; Josep Casadesús
Journal:  J Bacteriol       Date:  2006-09-22       Impact factor: 3.490

6.  Synthesis of FinP RNA by plasmids F and pSLT is regulated by DNA adenine methylation.

Authors:  J Torreblanca; S Marqués; J Casadesús
Journal:  Genetics       Date:  1999-05       Impact factor: 4.562

7.  Identification of a pathogenicity island required for Salmonella survival in host cells.

Authors:  H Ochman; F C Soncini; F Solomon; E A Groisman
Journal:  Proc Natl Acad Sci U S A       Date:  1996-07-23       Impact factor: 11.205

8.  Competitive Lrp and Dam assembly at the pap regulatory region: implications for mechanisms of epigenetic regulation.

Authors:  Stacey N Peterson; Norbert O Reich
Journal:  J Mol Biol       Date:  2008-08-06       Impact factor: 5.469

Review 9.  Phasevarions of Bacterial Pathogens: Methylomics Sheds New Light on Old Enemies.

Authors:  John M Atack; Aimee Tan; Lauren O Bakaletz; Michael P Jennings; Kate L Seib
Journal:  Trends Microbiol       Date:  2018-02-13       Impact factor: 17.079

10.  The Gene Ontology resource: enriching a GOld mine.

Authors: 
Journal:  Nucleic Acids Res       Date:  2021-01-08       Impact factor: 16.971

View more
  1 in total

1.  Diverse Roles for a Conserved DNA-Methyltransferase in the Entomopathogenic Bacterium Xenorhabdus.

Authors:  Nadège Ginibre; Ludovic Legrand; Victoria Bientz; Jean-Claude Ogier; Anne Lanois; Sylvie Pages; Julien Brillard
Journal:  Int J Mol Sci       Date:  2022-10-09       Impact factor: 6.208

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.