Literature DB >> 35657794

Molecular characterization of a Novel NAD+-dependent farnesol dehydrogenase SoFLDH gene involved in sesquiterpenoid synthases from Salvia officinalis.

Mohammed Ali1, Elsayed Nishawy1, Walaa A Ramadan2, Mohamed Ewas1, Mokhtar Said Rizk1, Ahmed G M Sief-Eldein1, Mohamed Abd S El-Zayat1, Ahmed H M Hassan1, Mingquan Guo3,4, Guang-Wan Hu3,4, Shengwei Wang5, Fatma A Ahmed6, Mohamed Hamdy Amar1, Qing-Feng Wang4,5.   

Abstract

Salvia officinalis is one of the most important medicinal and aromatic plants in terms of nutritional and medicinal value because it contains a variety of vital active ingredients. Terpenoid compounds, particularly monoterpenes (C10) and sesquiterpenes, are the most important and abundant among these active substances (C15). Terpenes play a variety of roles and have beneficial biological properties in plants. With these considerations, the current study sought to clone theNAD+-dependent farnesol dehydrogenase (SoFLDH, EC: 1.1.1.354) gene from S. officinalis. Functional analysis revealed that, SoFLDH has an open reading frame of 2,580 base pairs that encodes 860 amino acids.SoFLDH has two conserved domains and four types of highly conserved motifs: YxxxK, RXR, RR (X8) W, TGxxGhaG. However, SoFLDH was cloned from Salvia officinalis leaves and functionally overexpressed in Arabidopsis thaliana to investigate its role in sesquiterpenoid synthases. In comparison to the transgenic plants, the wild-type plants showed a slight delay in growth and flowering formation. To this end, a gas chromatography-mass spectrometry analysis revealed that SoFLDH transgenic plants were responsible for numerous forms of terpene synthesis, particularly sesquiterpene. These results provide a base for further investigation on SoFLDH gene role and elucidating the regulatory mechanisms for sesquiterpene synthesis in S. offcinalis. And our study paves the way for the future metabolic engineering of the biosynthesis of useful terpene compounds in S. offcinalis.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35657794      PMCID: PMC9165828          DOI: 10.1371/journal.pone.0269045

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Background

The genus Salvia (Lamiaceae) includes more than (>1,000) species of woody aromatic shrubs, among which e.g., S. epidermindis, S. japonica, S. fruticosa, S. tuxtlensis, S. miltiorrhiza, S. aureus, S. przewalskii, S. hydrangea, S. isensis, S. tomentosa, S. santolinifolia, S. lavandulifolia, S. chloroleuca, S. glabrescens, S. nipponica, S. macrochlamys, S. allagospadonopsis and S. recognita are economically important and cultivated worldwide for its medical properties and their output of essential oils (EOs). Most of Salvia plant species are commonly spread universally in three areas but largely grown in South and Central America (~500 species), East and West Asia (~100 and ~200 species) respectively [1-4] Lately, Salvia species EOs have a valued source for aromatic and medical research for discovering and identifying the ingredient-compounds [3-5]. Essential oils of salvia species have antimicrobial, anticancer, anti-inflammatory, antioxidant, choleretic and antimutagenic properties [6-8]. It is well-known that Terpenoid form is the major cluster of natural compounds and a set of secondary metabolites, that have been identified from plant kingdom and other organisms with more than (>40,000) different structures [9]. Terpenoid derives its structural from the isopentenyl diphosphate (IPP), which involves five carbon atoms (C5) [10, 11]. However, the origin name of these different structures arises from the terebinth tree (Pistacia terebinthus), all of these identified as different structures terpene. The structure of the terpene unit was illustrated by Wallach and Altered by Ruzicka [12-15]. Some terpenes are related to the plant primary metabolism such as the carotenoid pigments, phytol side chain of chlorophyll, gibberellin plant hormones, and phytosterols of cellular membranes [16, 17], which are important for development and flower blooming of the plants. However, wide ranges of terpenes have been identified as categories of secondary metabolites with essential properties in the adaptation of plants to the stresses. Nonvolatile and volatile terpenes have an important role in the predators of herbivores and defense against photo-oxidative stress, haul of both pollinators and the direct defense against insects and microbes [18]. At present, several studies are focused to understand in-depth the mechanisms of terpene and its functions [3, 4]. It is prominent that salvia species involved high proportion of the essential oil; this fragrant oil mainly contains monoterpenes and sesquiterpenes. The composition of the monoterpenes and sesquiterpenes are differ depends on the plant species and cultivars, in addition to the type of tissues [3, 4, 19–24]. Biosynthesis gene for the sesquiterpene has remained elusive until recently. The main sesquiterpene in the Egyptian cultivar of S. officinalis are Isocaryophyllene, α-caryophyllene, Caryophyllene oxide and (−)-Germacrene D, which are encoded by three unigenes families [3]. So far, their biological or physiological functions have been widely unclear. This makes the enzymes that stimulate the formation both interesting and functionally difficult to differentiate. Through this research, we focus to clone and functionally expressed the S. officinalis NAD+-dependent farnesol dehydrogenase (SoFLDH, EC: 1.1.1.354) gene in Arabidopsis thaliana. The recombinant SoFLDH catalyzed the conversion of Farnesyl pyrophosphate (FPP) to the sole produce various types of terpene especially sesquiterpene. SoFLDH protein displayed a distinctive amino acid sequence, with highly preserved motifs, including the YxxxK, RXR, RR (X 8) W and TGxxGhaG motifs. Finally, this study reveals to use the protein modeling database to investigate the performance of the 3D structure protein and its function predict.

Materials and methods

Plant materials and tissue collection

Salvia officinalis seeds were kindly provided by the staff member of Egyptian Desert Gene Bank (EDGB) of Desert Research Center (DRC), Egypt. S. officinalis seeds had been growing in our growth chamber at National Research Centre (Cairo, Egypt), at temperature of 22ºC day/20ºC night with humidity of 50–70%, and photoperiod at 16 h day/8 h night, with a light density of 100–150 μmoles m 2-s 1- using fluorescent bulbs. For gene amplification, young leaves were picked up and instantly cast in liquid nitrogen and stowed at −80 °C until RNA extraction.

In silico analysis of SoFLDH

SoFLDH nucleotide sequence was carefully selected from our previous RNA-Seq data [3]. The physiochemical assets of the SoFLDH were gritty using PROTPARAM website (http://web.expasy.org/protparam/). Putative tissue expression profile and cell subcellular localizations for SoFLDH gene was built using ePlant and cell eFP (http://bar.utoronto.ca/eplant/& http://bar.utoronto.ca/cell_efp/cgi-bin/cell_efp.cgi) based on Arabidopsis gene expression and protein localization at different tissues and cell organs. The open reading frames (ORF) for SoFLDH was analyzed for the presence of possible transit peptide using bioinformatics tools, iPSORT Prediction (http://ipsort.hgc.jp/). Sequence analysis of SoFLDH was executed using NCBI BLAST in contradiction of the protein database (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Clustal Omega software was used with the default parameters (https://www.ebi.ac.uk/Tools/msa/clustalo/) for multiple sequence alignment. Three-dimensional (3D) structure for SoFLDH protein was built using SWISS-MODEL (https://swissmodel.expasy.org) website based on the closest homologous structures. A maximum likelihood tree was constructed for SoFLDH gene using MEGA 6.6 program with default parameters. To assess the phylogeny of the SoFLDH protein sequence in relation to other orthologous terpene alcohol dehydrogenases and benzyl alcohol dehydrogenases genes, the protein sequences of characterized terpene alcohol dehydrogenases and benzyl alcohol dehydrogenases were regained from the National Center for Biotechnology Information (NCBI) database, and we looked for the other reported full-length sequences of terpene alcohol dehydrogenases and benzyl alcohol dehydrogenases from Salvia splendens (farnesol dehydrogenase; TEY48599.1), Persicaria minor (nerol dehydrogenase; AFQ59973.1), Salvia splendens (hypothetical protein Saspl_009804; TEY79171.1), Carpoglyphus lactis (geraniol dehydrogenase; BAG32342.1), Castellaniella defragrans (geraniol dehydrogenase; CCF55024.1), Arabidopsis thaliana (Rossmann-fold NAD(P)-binding domain-containing protein; AEE86213.1), Ocimum basilicum (geraniol dehydrogenase; AAX83107.1), Aedes aegypti (NADP+-dependent farnesol dehydrogenase; ADB03640.1), Fragaria x ananassa (cinnamyl alcohol dehydrogenase; AAD10327.1), Artemisia annua (cinnamyl alcohol dehydrogenase; ACB54931.1), Mentha x piperita ((-)-isopiperitenol dehydrogenase; AAU20370.1), Lavandula x intermedia (borneol dehydrogenase; AFV30207.1), Pseudomonas putida (p-cumic alcohol dehydrogenase; AAB62297.1), Nicotiana tabacum (allyl alcohol dehydrogenase; BAA89423.1), Arabidopsis thaliana (allyl alcohol dehydrogenase; AAG50689.1), Pseudomonas putida (aryl alcohol dehydrogenase; P39849.1), Picea abies (cinnamyl alcohol dehydrogenase; CAA0597.1), Streptomyces sp. NL15-2K (coniferyl alcohol dehydrogenase; BAN09098.1), and Pseudomonas putida (benzyl alcohol dehydrogenase; AAC32671.1) [25].

RNA extraction and cDNA library preparation

Young leaves of S. officinalis were used to extract the total RNA using TransZol Reagent (Focus Bioscience, Australia) according to the manufacturer’s instructions and cured with DNase I (Takara). RNA quality was performed on 1.4% Agarose gel, and the clarity was analyzed using a Nanodrop ND1000 (NanoDrop technologies, Wilmington, DE, USA). RNA pools were primed for cDNA libraries using mixing equal volumes from the three RNAs replications in one tube. Two micrograms of total RNA (800 ng approximately) per sample was used for the synthesis of total cDNA with TransScript® First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China) according to the manufacturer’s instructions. Afterwards, PCR was performed for cDNA synthesis at 42°C for 15 min followed by 85°C for 5 min [3, 4].

QRT-PCR, semiquantitative RT-PCR analysis and Western Blot (WB)

Quantitative RT-PCR was performed by an IQTM5 Multicolor Real-Time PCR Detection System (Bio-Rad, USA) as described previously Ali et al., and Hussain et al., [3, 4, 26, 27] with SYBR Green Master (ROX) (Newbio Industry, China) following the manufacturer’s instructions at a total reaction volume of 20 μl. A gene-specific primer for SoACTIN forward 5ʹ- GGCAGTTCTCTCCCTCTAT-3ʹ and reverse 5ʹ- GAGGTGGTCGGTGAGAT-3ʹ was used as a reference gene with 157 bp, and SoFLDH forward 5′- TTCCTGATCCCTCCAGATT-3′ and reverse 5′- CAATGTAGCCATCCGTTGA-3′ with 153 bp length. Moreover, semiquantitative real-time PCR was achieved on a Biometra PCR (Biometra T Gradient Thermo block PCR Thermocycler, American Laboratory Trading, San Diego, CA) system with a total reaction volume of 25 μl. A gene-specific primer for At-B-actin forward 5′-GGCTGAGGCTGATGATATTC-3′ and reverse 5′-CCTTCTGGTTCATCCCAAC -3′ was used as a reference gene with 155 bp and the same forward and reverse primers for SoFLDH, all the primers were designed using the primer designing tools of IDTdna (http://www.idtdna.com/scitools/Applications/RealTimePCR/). The semiquantitative RT-PCR conditions were as follows: pre-denaturation step at 95°C for 4 min, 35 cycles of amplification (95°C for 30 s, 58°C for 30 s and 72°C for 1 min), and a final extension step at 72°C for 10 min. The PCR products were resolved on 1.3% agarose gel, and the expression levels of At-B-actin and SoFLDH genes were detected. On the other hand, for confirmed the transformation stability of SoFLDH protein was isolated and detected from various lines of transgenic and wild-type A. thaliana using Western blotting (WB), fresh leaves were homogenized with pestles in prechilled mortars on ice in 1 ml of cold homogenization buffer (100 mM Tris, pH 7.5, 10% sucrose, 5 mM sodium EDTA, and 5 mM sodium EGTA) for each one gram of tissue as described by Ma et al., [28].

Full-length terpene synthase cDNA clone and vector

Full-length cDNAs sequence for SoFLDH was obtained based on RNA-Seq sequence information from our transcriptome sequencing of S. officinalis plant leaves [3], and SoFLDH was amplified from cDNA of young leaf using short and long gene-specific gene primers based on the Gateway pDONR221 vector manual system. The initial PCR amplification was performed by short primers, of SoFLDH forward 5′- ATGTGGGGATTAGGTGGGAGT -3′ and reverse 5′- TCAATCATGTCACTCACTCACTCAA -3′ using the KOD-Plus-Neo DNA polymerase (Novagen) under the following PCR conditions: 3 min at 96°C followed by 10 s at 98°C; 30 s at 60 °C (Annealing temperatures), 1.5 min at 68 °C, and then 10 min at 68 °C. This process was repeated for 33 cycles. The first PCR products was used as a template for the second PCR using long primers, SoFLDH forward 5′-GGGGACAAG TTTGTACAAAAAAGCAGGCTTCATGTGGGGATTAGGTGGG-3′ and reverse 5′-GGGGACCACTTTG TACAAGAAAGCT GGGTTCAATCATGTCACTCACT-3′. BP Clonase (Invitrogen, USA) was used to insert the PCR products into the Gateway entry vector pDONR221. The positive pDONR221- SoFLDH constructs harbouring target genes were sequenced and ligated with the destination vector pB2GW7 using Gateway LR Clonase (Invitrogen, USA), then the positive pB2GW7- SoFLDH was used for A. thaliana plant transformation [3, 4].

Arabidopsis plant growth conditions and preparation of Agrobacterium cultures for floral-dip transformation

The ecotype of A. thaliana seeds Columbia-0 (Col-0) has prepared for germination by adding 1.2 ml sterilized -water for seeds at a 2.0 ml Eppendorf tube, then nursed at ~ 4°C for three days at the refrigerator. Then A. thaliana seeds had been growing in a growth chamber with humidity of 60–70% under the day and night temperature of 22°C day/20°C night, using a light density of 100–150 mol m−2 s−1 using fluorescent bulbs and photoperiod at 16 h day/8 h night. For floral-dip transformation, plants at two-month age were used, and one week after, the primary inflorescences were clipped. The Plant watering was stopped at four days before the transformation to increase and improve the transformation efficiency. In addition, the constructs of pB2GW7-SoFLDH were introduced into Agrobacterium tumefaciens strain GV101 by direct electroporation. Recombinant GV101 was grown for 48 h at 28°C in solid LB media supplemented with 60 μg/ml of each rifampicin and spectinomycin. An individual colony was injected into 0.8 ml of liquid medium and grown at 28°C under 180 rpm agitation overnight with the same media composition. After 24 h, 0.8 ml of each sample of liquid medium was relocated to a 300 ml conical flask containing 60 ml of LB media supplemented with the same compositions; the samples were grown at 28°C in a shaker overnight until an optical density of 0.75 (OD600) was reached. Overnight cell cultures were harvested by centrifugation at 4,000 rpm for 12 min at 4°C, and the pellet was resuspended in the floral-dip inoculation medium contained 5.2% sucrose and 0.055% Silwet. A. thaliana was transformed by drenched the secondary inflorescences in the inoculation medium and stirred softly to allow the intake of Agrobacterium harbouring the pB2GW7-SoFLDH vector into the flower gynoecium. The transformed plants were kept in the dark and covered by plastic cover overnight to maintain humidity. After 24 h, the plants were returned back to their normal growth conditions. The transformation was repeated after 7–10 days to increase the transformation efficiency. Plants were grown for additional 30–37 days, until all of the siliques became brown and dry. The seeds were harvested and stored at ~4°C under desiccation [3, 4, 29, 30]. BASTA was used for selection of transformant seedlings which were also confirmed with PCR for positive transgenic lines, more than 12 positive plant lines with selective gene were analysed for terpenoid profiling and target gene expression.

Phenotypic evaluation

Transgenic plants were watered and fertilized regularly with Miracle Gro fertilizer (Scott’s Company, USA) prepared according to manufacturer’s instructions for phenotypic comparisons between A. thaliana transgenic lines and their counterpart wild-type plants. Plants were grown in the growth chamber under the previously reported conditions for vegetative growth and flowering. Plants were assessed with regard to leaf morphology, flowering time, and terpene metabolic [4].

Metabolite extraction from transgenic A. thaliana leaves

Terpenoid compounds from overexpression of SoFLDH- A.thaliana and wild type were extracted and isolated. Thirty six leaves from transgenic A. thaliana line (three leaf from each plant) were grind in liquid nitrogen with a mortar and pestle to fine powder, and directly soaked in n-hexane as a solvent in Amber storage bottles, 30 ml screw-top vials with silicone/PTFE septum lids (http://www.sigmaaldrich.com) were applied to diminish the loss of volatiles to the headspace then incubated with shaking at 37°C and 200 rpm for 72 h. Afterward, the solvent was transmitted using a glass pipette to a 10 ml glass centrifuge tube with screw-top vials with silicone/PTFE septum lids and centrifuged at 5,000 rpm for 10 min at 4°C to remove plant debris. The supernatant was pipette into glass vials with a screw cap and oil was concentrated until remaining 1.5 ml of concentrated oils under a stream of nitrogen gas with a nitrogen evaporator (Organomation) and water bath at room temperature (Toption-China-WD-12). The concentrated oils transferred to a fresh crimp vial amber glass, 1.5 ml screw-top vials with silicone/PTFE septum lids were used to diminish the loss of volatiles to the headspace. For absolute oil recovery, the remaining film crude oil in the internal surface of concentrated glass vials was dissolved in the minimum volume of n-hexane, thoroughly mixed and transferred to the same fresh crimp vial amber glass, 1.5 ml. And the crimp vial was placed on the auto sampler of the gas chromatography mass spectrometer (GC-MS) system for GC-MS analysis, or each tube was covered with parafilm after closed with screw-top vials with silicone/PTFE septum lids and stored at -20°C until GC-MS analysis [3, 4, 31].

GC-MS analysis of essential oil components

GC analysis was implemented using a Shimadzu model GCMS-QP2010 Ultra (Tokyo, Japan) system. 1μl aliquot of each sample was introduced (split ratios of 15:1) into a GC-MS equipped with an HP-5 fused silica capillary column (30 m x 0.25 mm ID, 0.25 μm film thicknesses). Helium was used as the carrier gas at a constant flow of 1.0 ml/min-1. The mass spectra were monitored between 50–450 m/z. Temperature was initially under isothermal conditions at 60°C for 10 minutes. Temperature was then increased at a rate of 4°C/min-1 to 220°C, held isothermal at 220°C for 10 minutes, increased by 1°C/ min-1 to 240°C, held isothermal at 240°C for 2 min, and finally held isothermal for 10 minutes at 350°C. The identification of the volatile constituents was determined by parallel comparison of their recorded mass spectra with the data stored in the Wiley GC/MS Library (10th Edition) (Wiley, New York, NY, USA), the Volatile Organic Compounds (VOC) Analysis S/W software, and the NIST Library (2014 edition). The relative percent amount of each component was calculated by comparing its average peak area to the total areas. All of the experiments were performed simultaneously three times under the same conditions for each isolation technique with total GC running time was 80 minutes [3, 4, 31].

Results and discussion

The SoFLDH gene with 2,580 bp of open reading frame, which encodes a 860 amino acid and a 95.114 kDa of molecular mass and a 8.59 PI of theoretical isoelectric point (pI). The surmised amino acid sequence of SoFLDH showed signal peptide longer than monoterpene synthases (600–650 aa), and other sesquiterpene synthases of 550–580 aa. Furthermore, the presence of 30 amino acid long targets sequence using ‘iPSORT’ program suggested that SoFLDH protein was localized into the Mitochondrial and chloroplast where sesquiterpene and triterpene biosynthesis takes place. BLASTX analysis revealed that the Salvia splendens farnesol dehydrogenase was the nearest homologue gene to SoFLDH, with 91.74% identity, 91% Query cover and 0.0 E-value (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Also, from the phylogenetic tree analysis we found the surmised amino acid sequence of SoFLDH similar to farnesol dehydrogenase (TEY48599.1) gene from Salvia splendens, and other terpene alcohol dehydrogenases and benzyl alcohol dehydrogenases genes from different plant species (Fig 1). The function of SoFLDH gene was initially foretell depended on sequence alignment with well-known others terpene alcohol dehydrogenases and benzyl alcohol dehydrogenases genes sequences and other conserved motifs from Lamiaceae family and other plants (Fig 2). For instance, SoFLDH protein contained two highly conserved motifs YxxxK (residues 9–13) and (residues 585–589) motifs. Moreover, SoFLDH protein contained other commonly conserved RXR motif (residues 285–287), which is important for product cyclization in Class III TPS proteins [32-34] (Fig 2). Furthermore, SoFLDH protein contained another conserved motif such as, RR (X8) W (residues 405–415) region, which are located in most of the sesquiterpene synthases were marked in (Fig 2). Also, SoFLDH protein contained another conserved motif TGxxGhaG (residues 440–447), and all these previous motifs have previously stated to flank the entrance of the active site. The nucleotide‐binding motif TGxxxGhG is the highly conserved motif for coenzyme binding and the stabilizing the central β‐sheet. Moreover, the YxxxK motif displayes the catalytic center [35] and remains responsible for the predilection for NADP(H) over NAD(H) [36, 37]. Finally, each protein sequences have one or two or all of these conserved domains are belong to the terpene synthase family [3, 4, 11, 38–40].
Fig 1

Phylogenetic analysis of SoFLDH gene from S. officinalis and other plants, based on the primary amino acid sequences.

A maximum likelihood tree was constructed for SoFLDH gene using MEGA 6.6 program with default parameters. The percentage of bootstrap values is provided in the branches. Sequences are labeled with the accession numbers and species names.

Fig 2

Multiple sequence alignment. The deduced amino acid sequence of SoFLDH was aligned with homologues identified from the BLASTX analysis.

The conserved motifs YxxxK, RXR, RR(X8) W and TGxxGhaG aremarked. SoFLDH: NAD+-dependent farnesol dehydrogenase [Salvia officinalis]; farnesol dehydrogenase [Salvia splendens: TEY48599.1]; hypothetical protein Saspl_009804 [Salvia splendens: TEY79171.1]; NAD(P)-binding Rossmann-fold superfamily protein [Arabidopsis thaliana, AEE86213.1].

Phylogenetic analysis of SoFLDH gene from S. officinalis and other plants, based on the primary amino acid sequences.

A maximum likelihood tree was constructed for SoFLDH gene using MEGA 6.6 program with default parameters. The percentage of bootstrap values is provided in the branches. Sequences are labeled with the accession numbers and species names.

Multiple sequence alignment. The deduced amino acid sequence of SoFLDH was aligned with homologues identified from the BLASTX analysis.

The conserved motifs YxxxK, RXR, RR(X8) W and TGxxGhaG aremarked. SoFLDH: NAD+-dependent farnesol dehydrogenase [Salvia officinalis]; farnesol dehydrogenase [Salvia splendens: TEY48599.1]; hypothetical protein Saspl_009804 [Salvia splendens: TEY79171.1]; NAD(P)-binding Rossmann-fold superfamily protein [Arabidopsis thaliana, AEE86213.1].

Putative tissue expression pattern and subcellular localizations of SgCINS gene

We analyzed the putative SoFLDH gene expression profile maps based on Arabidopsis transcript expression for further understanding the functions of SoFLDH gene at different Arabidopsis tissues (Fig 3a–3c). It is clear from the Arabidopsis Electronic Fluorescent Pictograph Expression Profile Browser that the SoFLDH gene was expresses at all Arabidopsis tissues. And SoFLDH gene was highly expressed at Root then Petals, Sepals and Hypocotyl (Fig 3a). In context, GmTPS21, SoHUMS, SoLINS2, SoNEOD, SgTPSV, SgFARD and SgGERIS genes from G. max, S. officinalis and S. guaranitica were reported with higher expression levels in roots and seeds by liu et al., and Ali et al., [3, 4, 41], respectively. Moreover, the putative tissue specific stem epidermis for SoFLDH was analyzed and we found the highly expressed was record in top of stem epidermis more than the bottom of stem epidermis (Fig 3b). Furthermore, the putative subcellular localizations of SoFLDH was analyzed based on Arabidopsis protein localization for identified the SoFLDH synthesis sites at different cell organs (cell plate, cytoskeleton, cytosol, extracellular, golgi, endoplasmic reticulum, plasma membrane, mitochondrion, nucleus, peroxisome, plastid, unclear, unknown and vacuole) (Fig 3c). It is clear from the Arabidopsis Cell Electronic Fluorescent Pictograph subcellular localizations profiles that the SoFLDH gene was highly expressed and presented in plasma membrane then endoplasmic reticulum, vacuole, cytosol, mitochondrion, golgi pody and plastid (Fig 3c). These results are in line with Ali et al.,Taniguchi et al., Chen et al., and Wang et al., [26, 42–44] who reported that most of TPSs genes were targeted to the plastid or other cell organelles such as mitochondrion and nucleus.
Fig 3

Visualization the putative an “electronic fluorescent pictograph” browsers for exploring the putative tissue expression and cell localization of SoFLDH (AT4G33360) gene, based on Arabidopsis gene expression and protein localization at different tissues and cell organs.

a Expression data at different tissues from seedling to flowering stages. b Expression data of tissue specific stem epidermis at top and bottom. c Expression data at different cell organs. The blue arrow points the expression scale (the more intense red color, the more gene expression).

Visualization the putative an “electronic fluorescent pictograph” browsers for exploring the putative tissue expression and cell localization of SoFLDH (AT4G33360) gene, based on Arabidopsis gene expression and protein localization at different tissues and cell organs.

a Expression data at different tissues from seedling to flowering stages. b Expression data of tissue specific stem epidermis at top and bottom. c Expression data at different cell organs. The blue arrow points the expression scale (the more intense red color, the more gene expression).

Tissue-specific expression of SoFLDH gene by quantitative RT-PCR

To determinate the organ-specific expression pattern of SoFLDH, we quantified the expression levels of SoFLDH transcripts in S. officinalis young leaves, old leaves, stems, bud flowers, flowers and roots tissues using qPCR-PCR (Fig 4). From our results, we found the SoFLDH gene is expressed in all tissue with distinct expression patterns. In old leaves, SoFLDH transcripts gene showed the highest expression levels, followed by stems, flowers, bud flowers, young leaves and roots (Fig 4). Similar results were obtained by Ali et al., [4] of which, the highest expression for sesquiterpene gene encoded by Selinene synthase (SgTPS-3) was reported in old leaves, followed by bud flowers [4].
Fig 4

Quantitative RT-PCR validation of expression of SoFLDH gene from various tissues of S. offcinalis.

Total RNAs were extracted from young leaves, old leaves, stem, flower, bud fower and root samples and the expression of SoFLDH gene was analyzed using quantitative real-time. SoACTIN was used as the internal reference. The values are means ±SE of three biological replicates.

Quantitative RT-PCR validation of expression of SoFLDH gene from various tissues of S. offcinalis.

Total RNAs were extracted from young leaves, old leaves, stem, flower, bud fower and root samples and the expression of SoFLDH gene was analyzed using quantitative real-time. SoACTIN was used as the internal reference. The values are means ±SE of three biological replicates.

The 3D structure of SoFLDH protein

SoFLDH protein sequence contains large, conserved domain, which was identified using the InterPro protein sequence analysis & classification (https://www.ebi.ac.uk/interpro/) database. In context that, The SoFLDH protein with a 860-aa length has an NAD(P)-binding domain superfamily domain (IPR036291) from 433–625 aa, and this previous domain have overlapping entries with other domains superfamily, such as Oxidoreductase, N-terminal (IPR000683), Semialdehyde dehydrogenase, NAD-binding (IPR000534), Lactate/malate dehydrogenase, N-terminal (IPR001236), Dihydrodipicolinate reductase, N-terminal (IPR000846), and NAD-dependent epimerase/dehydratase (IPR001509). This domain is shown in the 3D model built using SWISS-MODELserver (https://swissmodel.expasy.org). The 3D protein model was constructed using UDP-N-acetylglucosamine C4-epimerase (PelX) gene that belong to short-chain dehydrogenase/reductase (SDR) superfamily from Pseudomonas aeruginosa [PDB accession: 6wjb] as a template [45] (Fig 5). From the 3D model, SoFLDH was shown to consist entirely of alpha-helices and beta-sheets, long and short connecting loops and turns. Four conserved domains NAD 1: Nicotinamide-Adenine-Dinucleotide, NAD 3: Nicotinamide-Adenine-Dinucleotide, UD1.2: Uridine-Diphosphate-N-Acetylglucosamine and UD1.4: Uridine-Diphosphate-N-Acetylglucosamine were found in the ligands pocket, which encompass the active site (Fig 5).
Fig 5

Predicted 3D model of SoFLDH generated by the SWISS-MODEL software.

The arrows represent the ligands pocket with predicted active binding residues, the Nicotinamide-adenine-dinucleotide (NAD) domain and the Uridine-diphosphate-n-acetylglucosamine (UD) domain.

Predicted 3D model of SoFLDH generated by the SWISS-MODEL software.

The arrows represent the ligands pocket with predicted active binding residues, the Nicotinamide-adenine-dinucleotide (NAD) domain and the Uridine-diphosphate-n-acetylglucosamine (UD) domain.

Functional characterization of SoFLDH gene in transgenic A. thaliana leaves

The function and specificity of SoFLDH have been detected by A. thaliana Columbia-0 (Col-0) transgenic plants. Overexpression of SoFLDH in A. thaliana was achieved using Agrobacterium tumefaciens strain GV101 harboring the transformation vector pB2GW7-SoFLDH. Twelve BASTA-resistant transgenic A. thaliana were generated with longer flowering stems (Fig 6a and 6b). In contrast, the transgenic A. thaliana showed longer flowering stems with many flowers compare with wild-type (Fig 6a). Expression of the SoFLDH gene in positive transgenic A. thaliana was confirmed using semi-quantitative RT-PCR(Fig 6b). The transcription level of the transgenic plants were verified using Quantitative RT-PCR (Fig 6c). Leaves of twelve 35-day-old transgenic plants and wild types were sampled for RNA isolation and cDNA synthesis. The transgenic plants represent high expression of the SoFLDH gene than wild-type. Moreover, we used Western blotting (WB) analysis for confirmed the transformation stability by SoFLDH gene, and protein expression success (Fig 6d). This finding confirmed that the SoFLDH gene was overexpressed successfully in A. thaliana. Based on the transcription level and WB analysis results, we select OE-SoFLDH-2, OE-SoFLDH-5 and OE-SoFLDH-7 for further analysis. Meanwhile the morphological analysis resulted in delayed in flowering formation in wild type compared to the transgenic plants (Fig 6a). In context, this results are in line with Ali et al., [3, 4], which found that the overexpression of terpenoids and TPS synthesis genes, such as SoLINS, SoNEOD, SoTPS6,, SoSABS, SoCINS, SgGPS, SgFPPS and SgLINS from S. officinalis and Salvia guaranitica in Nicotiana tabacum and A. thaliana, occurred delayed in growth and flowering formation in wild type plants compared to the transgenic plants.
Fig 6

Overexpression of SoFLDH gene in transgenic Arabidopsis.

(A) Comparison of the phenotypes of the transgenic and wild type A. thaliana. (B) Semiquantitative RT-PCR to confirm the expression of terpenoid genes. (C) Quantitative RT-PCR validation of expression of SoFLDH gene from wild-type and transgenic A. thaliana lines. (D) Western blotting (WB) detection of SoFLDH protein in transgenic and wild-type A. thaliana, the first left-hand most lane represent molecular marker proteins (M), OE-SoFLDH-2 (lane 1), OE-SoFLDH-5 (lane 2), OE-SoFLDH-7 (lane 3) and wild-type (W.T; lane 4).

Overexpression of SoFLDH gene in transgenic Arabidopsis.

(A) Comparison of the phenotypes of the transgenic and wild type A. thaliana. (B) Semiquantitative RT-PCR to confirm the expression of terpenoid genes. (C) Quantitative RT-PCR validation of expression of SoFLDH gene from wild-type and transgenic A. thaliana lines. (D) Western blotting (WB) detection of SoFLDH protein in transgenic and wild-type A. thaliana, the first left-hand most lane represent molecular marker proteins (M), OE-SoFLDH-2 (lane 1), OE-SoFLDH-5 (lane 2), OE-SoFLDH-7 (lane 3) and wild-type (W.T; lane 4).

Terpene contents in transgenic A. thaliana leaves

The metabolite was analyzed by GC-MS to recognized the unique terpenes that formed by transformation with the SoFLDH gene (S1 Fig). The mono-, sesqui- and diterpene peaks were obviously measured. The type and number of metabolites were displayed by the percentage of peak area (% peak area) (Table 1). We are using the mass spectra libraries, reported references and the extracts of wild-type Arabidopsis which produce disparate amounts and types from terpenoids for identified the terpenes in wild type and transgenic A. thaliana. As expected, the leaves of transgenic A. thaliana plants emitted a high level of various terpenoids compare with leaves of wild-type. Furthermore, in transgenic A. thaliana leaves the diterpene compounds were reported as the main group after (30.49%), followed by sesquiterpenes group (15.46%) then one monoterpene compound (0.89%). While, in wild-type A. thaliana the diterpene compounds group was detected as the only group (13.12%) (S1 Fig and Table 1). Moreover, the results shown in S1 Fig and Table 1, represent clear alteration in the transgenic plants, with many new peaks at 29.297, 30.303, 32.328, 35.301, 39.599, 49.213 and 63.242 of retention time. This peak was identified as Levo-β-Elemene, Cis-Caryophyllene, Gamma.-Muurolene, (-)-β-Bourbonene, Cis-Thujanol, Trans-Phytol and Farnesan, based on the nearest hit from a search of the Wiley GC/MS, NIST Library and VOC Analysis S/W software (S1 Fig and Table 1). The production of various terpene by overexpression of SoFLDH gene in A. thaliana, was getting previously by [4, 29]. With more direct interest in our results, the SoFLDH was responsible for the production of various types of terpene specially sesquiterpene through the same common isoprenoid pathway in sesquiterpene biosynthesis. It is worth noting that our results are in lines with several previously evidence supported that various terpene synthases genes have ability to synthesize a number of metabolite simultaneously, like, carene synthases, (±)-linalool synthases, cineole synthases, myrcene synthase, β-amyrin synthases and terpinolene synthases[10, 11, 46–49].
Table 1

The major Terpenoid compositions in transgenic A. thaliana leave over-expressing of SoFLDH.

NCompound nameR.T (min.)FormulaMolecular Mass (g mol-1)Terpene Type% Peak area
AtW.T SoFLDH
1Dimethylsiloxane pentamer19.503C10H30O5Si5370.76971.16
2Thiourea, tetramethyl-22.326C5H12N2S132.2271.41-
3Dodecamethylcyclohexasiloxane26.276C12H36O6Si6444.9236-2.32
4Levo-β-Elemene29.297C15H24204.3511Sesqui-1.9
5Cis-Caryophyllene30.303C15H24204.3511Sesqui-1.54
6Tetradecamethylcycloheptasiloxane31.896C14H42O7Si7519.0776-4.58
7Gamma.-Muurolene32.328C15H24204.3511Sesqui-9.04
8Topanol O33.006C15H24O220.3505-2.02
9(-)-β-Bourbonene35.301C15H24204.3511Sesqui-2.2
10Hexadecamethylcyclooctasiloxane36.82C16H48O8Si8593.2315-2.9
11Allethrin38.032C19H26O3302.4079-1.33
12Pyrethrin I38.456C21H28O3328.4452-2.1
13Cis-Thujanol39.599C10H18O154.2493Mono-0.89
14Octadecamethylcyclononasiloxane41.04C18H54O9Si9667.3855-2.23
15Phytan41.196C20H42282.5475Diter2.76-
16Hexahydrofarnesyl acetone42.676C18H36O268.4778-1.95
17Oleic Acid43.799C18H34O2282.4683.00-
18Cyclohexasiloxane, dodecamethyl-44.792C12H36O6Si6444.9236-1.31
19Palmitic acid45.31C16H32O2256.424131.16-
20(Z)-9-Tetradecenal46.587C14H26O210.3556-1.41
21Palmitic acid, trimethylsilyl ester47.316C19H40O2Si328.60525.69-
22Methyl dehydroabietate47.469C21H30O2314.4617-2.49
23Heneicosane48.625C21H44296.57413.73-
24Trans-Phytol49.213C20H40O296.531Diter-30.49
25Trans-Elaidic acid49.488C18H34O2282.461429.59-
26Dodecanoyl chloride49.889C12H23ClO218.763-10.35
27Heptadecane, 8-methyl-50.911C17H36240.46771.84-
28Octadecamethylcyclononasiloxane51.454C18H54O9Si9667.3855-1.12
29Cadinane51.916C20H41Cl316.993Diter10.36-
304-Methyldodecane54.362C13H28184.3614-1.11
31Stigmasterol acetate57.289C31H50O2454.7275-1.05
32Octadecamethylcyclononasiloxane61.974C18H54O9Si9667.3855-0.77
33Farnesan63.242C15H32212.4146Sesqui-0.78
34Bis(2-ethylhexyl) phthalate64.443C24H38O4390.5561-6.5
35Dihomo-γ-linolenic acid; (Z,Z,Z)-icosatri-8,11,14-enoic acid65.99C20H34O2306.4828-1.37
36Heneicosane74.674C21H44296.5741-3.97
372,6,10,14-Hexadecatetraen-1-ol, 3,7,11,15-tetramethyl-, acetate, (E,E,E)-77.731C22H36O2332.5200-1.12
38Tetrapentacontane78.973C54H110759.451210.46-
Total % Peak area% 100% 100
Total Precentage of Monoterpenes-0.89
Total Precentage of Sesquiterpenes-15.46
Total Precentage of Diterpenes13.1230.49

Conclusions

The present study highlighted to clone and functionally identify one of the narrowly expressed sesquiterpene synthase (SoFLDH), which is responsible for the production of NAD+-dependent farnesol dehydrogenase [EC:1.1.1.354] in S. officinalis. Overexpression SoFLDH in A. thaliana resulted in accelerating the growth and flowering of OE-SoFLDH -2, OE-SoFLDH-5 and OE-SoFLDH-7 transgenic lines. These three lines exhibited a high expression of the SoFLDH gene, which regulate the production of various terpenes. The various types of terpene especially sesquiterpene formed in these A. thaliana transgenic plants reveal the dexterity of A. thaliana for synthesizing the same product through the common mevalonate pathway of sesquiterpene biosynthesis. While, SoFLDH protein exhibits a strong sequence similarity to farnesol dehydrogenase (TEY48599.1) gene from Salvia splendens, in addition to other terpene alcohol dehydrogenases and benzyl alcohol dehydrogenases genes from different plant species. Whereas, SoFLDH protein contained four types from highly conserved motifs YxxxK, RXR, RR (X8) W, TGxxGhaG and four conserved domains in the ligands pocket, and these previous domains have overlapping entries with another important superfamily domain. Overall, these data revealed that the A. thaliana plant can strongly use as a successfully transformation system for study the terpene synthase genes in S. officinalis.

Typical GC-MS mass spectrographs for terpenoids from leaf of A. thaliana plants.

(DOCX) Click here for additional data file. 2 Feb 2022
PONE-D-22-00853
Molecular characterization of a Novel NAD+-dependent farnesol dehydrogenase  SoFLDH  gene involved in sesquiterpenoid synthases from Salviaofficinalis.
PLOS ONE Dear Dr. Amar, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Mar 19 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Jen-Tsung Chen, Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Thank you for stating the following financial disclosure: "This study was funding by the National Natural Science Foundation of China and with Academy of Scientific Research and Technology (ASRT) under the collaboration project between Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan, 430074, China, and Desert Research Center (DRC), Cairo, Egypt." At this time, please address the following queries: a) Please clarify the sources of funding (financial or material support) for your study. List the grants or organizations that supported your study, including funding received from your institution. b) State what role the funders took in the study. If the funders had no role in your study, please state: “The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.” c) If any authors received a salary from any of your funders, please state which authors and which funders. d) If you did not receive any funding for this study, please state: “The authors received no specific funding for this work.” Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 3. Thank you for stating the following in the Acknowledgments Section of your manuscript: "This work was supported and financial by the Academy of Scientific Research and Technology (ASRT) with the National Natural Science Foundation of China." We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "This study was funding by the National Natural Science Foundation of China and with Academy of Scientific Research and Technology (ASRT) under the collaboration project between Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan, 430074, China, and Desert Research Center (DRC), Cairo, Egypt." Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 4. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ 5. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Partly Reviewer #3: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: N/A Reviewer #3: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: No Reviewer #2: Yes Reviewer #3: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: No Reviewer #3: No ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: 1. Authors needs to reconstruct phylogeny based on Maxmium likelihood analysis. Please see: The BAHD Gene Family in Cacao (Theobroma cacao, Malvaceae): Genome-Wide Identification and Expression Analysis Magnesium transporter Gene Family: Genome-Wide Identification and Characterization in Theobroma cacao, Corchorus capsularis and Gossypium hirsutum of Family Malvaceae 2. The authors did not mentioned about the transformation stability. The authors did not used Southern or Northern blotting analysis experiment. The primers used in PCR is also not mentioned. The authors need to justify the choice in the discussion. I think the data of the manuscript is good but these two point give very much limitation to the study. Reviewer #2: The present study cloned and functionally verified one of the narrowly expressed sesquiterpene synthase (SoFLDH) genes, responsible for producing NAD+-dependent farnesol dehydrogenase in S. officinalis. Overexpression SoFLDH in A. thaliana resulted in accelerating the growth and flowering of OE-SoFLDH -2, OE-SoFLDH-5, and OE-SoFLDH-7 transgenic lines. These three lines exhibited a high expression of the SoFLDH gene, which regulates the production of various terpenes. Mainly, the methodology, results, and discussion need to be improved. 1. Add abstract in the main text. Also, add the key findings and take-home message in 1-2 sentences at the end of the abstract. 2. Line 48, please specify the growth conditions. 3. Line 53, PROTPARAM is an online tool/website, not software. 4. Line 84-85, also add “following the manufacturer's instructions. 5. One of the major issues is the presentation of the results and discussion. Combining results and discussion can be considered. However, the authors must divide the contents into subheadings for more clarity. Also, the current discussion is quite superficial and must be improved accordingly. 6. The results regarding metabolites can be better explained, not just describe the data. Also, explain what does dataset suggests. Thus, I strongly suggest dividing the results into different subheadings and improving the results and discussion presentation. 7. There are spacing and spelling mistakes. The authors are requested to proofread the whole text. 8. The English quality can further be improved. Reviewer #3: - ENGLISH of the manuscript needs to polish and be improved. - Line 63-64: please rewrite this sentence. - All gene names should be in italic format. - Line 90: "85°C for 5 second", it is 5 second or 5 min? I think it is 5 min. Please check it. - Line 100-102: After 33 cycles, the final extension (10 min at 68°C) was applied. Please consider it again. - Line 223, 229, 238, etc.: protein name should not be italic. - Line 253: these instated to this. - Line 253: after "by" provide the names of the authors. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 15 Apr 2022 Dear editor, Thank you for your useful comments. We have been revised the manuscript “Molecular characterization of a Novel NAD+-dependent farnesol dehydrogenase SoFLDH gene involved in sesquiterpenoid synthases from Salvia officinalis” and make corrections required by the reviewers and the detailed information are listed as attached file Responses to reviewers Submitted filename: 5 Responses to reviewers 17-03-2022-Dr. MA.doc Click here for additional data file. 13 May 2022 Molecular characterization of a Novel NAD+-dependent farnesol dehydrogenase  SoFLDH  gene involved in sesquiterpenoid synthases from Salviaofficinalis. PONE-D-22-00853R1 Dear Dr. Amar, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Jen-Tsung Chen, Ph.D. Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: (No Response) ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: (No Response) ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: (No Response) ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: (No Response) ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: (No Response) Reviewer #2: The authors have satisfactorily addressed all the comments. Thus, the revised version can be accepted for publication. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No 24 May 2022 PONE-D-22-00853R1 Molecular characterization of a Novel NAD+-dependent farnesol dehydrogenase SoFLDH gene involved in sesquiterpenoid synthases from Salvia officinalis. Dear Dr. Amar: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Jen-Tsung Chen Academic Editor PLOS ONE
  38 in total

1.  PelX is a UDP-N-acetylglucosamine C4-epimerase involved in Pel polysaccharide-dependent biofilm formation.

Authors:  Lindsey S Marmont; Gregory B Whitfield; Roland Pfoh; Rohan J Williams; Trevor E Randall; Alexandra Ostaszewski; Erum Razvi; Ryan A Groves; Howard Robinson; Mark Nitz; Matthew R Parsek; Ian A Lewis; John C Whitney; Joe J Harrison; P Lynne Howell
Journal:  J Biol Chem       Date:  2020-06-29       Impact factor: 5.157

2.  Phylogenetic relationships among subgenera, species, and varieties of Japanese Salvia L. (Lamiaceae).

Authors:  Atsuko Takano; Hiroshi Okada
Journal:  J Plant Res       Date:  2010-07-14       Impact factor: 2.629

3.  Structure of limonene synthase, a simple model for terpenoid cyclase catalysis.

Authors:  David C Hyatt; Buhyun Youn; Yuxin Zhao; Bindu Santhamma; Robert M Coates; Rodney B Croteau; ChulHee Kang
Journal:  Proc Natl Acad Sci U S A       Date:  2007-03-19       Impact factor: 11.205

4.  Active site directed mutagenesis of 3 beta/17 beta-hydroxysteroid dehydrogenase establishes differential effects on short-chain dehydrogenase/reductase reactions.

Authors:  U C Oppermann; C Filling; K D Berndt; B Persson; J Benach; R Ladenstein; H Jörnvall
Journal:  Biochemistry       Date:  1997-01-07       Impact factor: 3.162

5.  Molecular modeling and site-directed mutagenesis reveal the benzylisoquinoline binding site of the short-chain dehydrogenase/reductase salutaridine reductase.

Authors:  René Geissler; Wolfgang Brandt; Jörg Ziegler
Journal:  Plant Physiol       Date:  2007-03-02       Impact factor: 8.340

6.  Comparative chemical composition and antiproliferative activity of aerial parts of Salvia leriifolia Benth. and Salvia acetabulosa L. essential oils against human tumor cell in vitro models.

Authors:  Monica R Loizzo; Federica Menichini; Rosa Tundis; Marco Bonesi; Farsad Nadjafi; Antoine M Saab; Natale Giuseppe Frega; Francesco Menichini
Journal:  J Med Food       Date:  2010-02       Impact factor: 2.786

7.  Overexpression of a synthetic insect-plant geranyl pyrophosphate synthase gene in Camelina sativa alters plant growth and terpene biosynthesis.

Authors:  Jing Xi; Lorenzo Rossi; Xiuli Lin; De-Yu Xie
Journal:  Planta       Date:  2016-03-29       Impact factor: 4.116

Review 8.  Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants.

Authors:  Jörg Degenhardt; Tobias G Köllner; Jonathan Gershenzon
Journal:  Phytochemistry       Date:  2009-09-28       Impact factor: 4.072

9.  Functional characterization of sesquiterpene synthase from Polygonum minus.

Authors:  Su-Fang Ee; Zeti-Azura Mohamed-Hussein; Roohaida Othman; Noor Azmi Shaharuddin; Ismanizan Ismail; Zamri Zainal
Journal:  ScientificWorldJournal       Date:  2014-02-11

10.  Overexpression of Terpenoid Biosynthesis Genes From Garden Sage (Salvia officinalis) Modulates Rhizobia Interaction and Nodulation in Soybean.

Authors:  Mohammed Ali; Long Miao; Qiuqiang Hou; Doaa B Darwish; Salma Saleh Alrdahe; Ahmed Ali; Vagner A Benedito; Million Tadege; Xiaobo Wang; Jian Zhao
Journal:  Front Plant Sci       Date:  2021-12-23       Impact factor: 5.753

View more
  1 in total

1.  Overexpression of Terpenoid Biosynthesis Genes Modifies Root Growth and Nodulation in Soybean (Glycine max).

Authors:  Mohammed Ali; Long Miao; Fathia A Soudy; Doaa Bahaa Eldin Darwish; Salma Saleh Alrdahe; Dikhnah Alshehri; Vagner A Benedito; Million Tadege; Xiaobo Wang; Jian Zhao
Journal:  Cells       Date:  2022-08-23       Impact factor: 7.666

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.