Literature DB >> 35655916

CBR3-AS1 Accelerates the Malignant Proliferation of Gestational Choriocarcinoma Cells by Stabilizing SETD4.

Yajuan Zhang1, Hongxiu Zhang1, Xiaolei Zhang1, Bin Liu1.   

Abstract

Background: Gestational choriocarcinoma (GC) is a rare malignant gestational trophoblastic tumor. Long noncoding RNA (lncRNA) CBR3 antisense RNA 1 (CBR3-AS1) has been reported to serve as a critical oncogene and facilitate tumor progression. Besides, we found that CBR3-AS1 is implicated in GC progression. Materials and
Methods: Gene and protein expression was detected via quantitative reverse transcription PCR (RT-qPCR) and western blot analyses, respectively. CCK-8 assay and colony formation assay were performed to assess cell proliferative abilities while flow cytometry analysis was applied for cell cycle and apoptosis. To analyze the specific mechanism among CBR3-AS1, SET domain containing 4 (SETD4), and polypyrimidine tract binding protein 1 (PTBP1), RNA binding protein immunoprecipitation (RIP), RNA pulldown, and mRNA stability assays were conducted.
Results: CBR3-AS1 was markedly upregulated in GC cells, and its downregulation suppressed cell proliferation, induced cell cycle arrest, but promoted cell apoptosis in GC. SETD4 was determined as the downstream mRNA of CBR3-AS1 and positively regulated by CBR3-AS1 in GC cells. Furthermore, CBR3-AS1 could interact with its RNA binding protein (RBP) PTBP1, thereby stabilizing SETD4 mRNA. Rescue assays verified that CBR3-AS1 facilitates GC cell malignant proliferation via SETD4.
Conclusion: CBR3-AS1 accelerates the malignant proliferation of GC cells via stabilizing SETD4.
Copyright © 2022 Yajuan Zhang et al.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35655916      PMCID: PMC9155919          DOI: 10.1155/2022/7155525

Source DB:  PubMed          Journal:  Dis Markers        ISSN: 0278-0240            Impact factor:   3.464


1. Introduction

As the most aggressive type of gestational trophoblastic tumors, gestational choriocarcinoma (GC) is derived from placental villus trophoblastic cells and occurs after abortion, molar pregnancy, or ectopic pregnancy [1, 2]. Due to the hematogenous route affinity, GC is able to spread widely and speedily to other parts of the human body including the brain, kidneys, liver, and vagina [3]. Currently, chemotherapy is the main treatment for GC which is highly invasive, hyperplastic, and metastatic [3, 4]. However, in clinical treatment of GC, the application of chemotherapy has been seriously impeded by various side effects [5]. As a result, it is of great significance to find more molecular biomarkers for GC. Long noncoding RNAs (lncRNAs), which are longer than 200 nucleotides, are a class of transcripts with no ability to encode proteins and engaged in numerous biological processes [6]. A substantial amount of studies have reported the critical role of lncRNAs on the malignant progression of tumors. Wei and Wang have demonstrated that lncRNA MEG3 suppresses gastric cancer proliferation and metastasis [7]. Wang et al. have found that lncRNA PVT1 activates the KAT2A acetyltransferase and stabilizes HIF-1alpha to regulate nasopharyngeal carcinoma cell proliferation [8]. Pan et al. have verified that lncRNA-PDPK2P facilitates the progression of hepatocellular carcinoma via the PDK1/AKT/Caspase 3 pathway [9]. Nonetheless, studies exploring the role and mechanism of lncRNAs in GC were in short supply. lncRNA CBR3 antisense RNA 1 (CBR3-AS1) serves as a promising oncogene in several malignant tumors. Hou et al. have displayed that CBR3-AS1 regulates the proliferative, migratory, and invasive phenotypes of lung adenocarcinoma cells via enhancing the Wnt/β-catenin pathway [10]. Zhang et al. have found that CBR3-AS1 plays an oncogene role in the tumorigenesis of osteosarcoma [11]. Xu et al. have revealed that CBR3-AS1 overexpression contributes to the progression of breast cancer [12]. Consistently, Guan et al. have proved that CBR3-AS1 facilitates the malignant phenotypes of non-small-cell lung cancer via the miR-509-3p/HDAC9 axis [13]. However, the role of CBR3-AS1 on the malignant proliferation of GC remains vague. Intriguingly, we found a close association between CBR3-AS1 and GC via the prediction on the LncRNADisease v2.0 database. Therefore, this study was aimed at exploring the specific role and mechanism of CBR3-AS1 in GC and providing a promising therapeutic target for GC.

2. Materials and Methods

2.1. Cell Line Culture and Vector Construction

Human chorionic trophoblast cell line HTR-8 and GC cell lines (JEG-3 and BeWo) were all procured from ATCC (Manassas, VA). GC cell line JAR was procured from Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All these cell lines were maintained in DMEM (#11885-076, Gibco, Grand Island, NY) containing 10% FBS (#16000–044, Gibco) and 1% penicillin/streptomycin (#15070063, Gibco) at 37°C with 5% CO2. For vector constructions, the specific short hairpin RNAs (shRNAs) targeting CBR3-AS1 or polypyrimidine tract binding protein 1 (PTBP1) plasmids sh-CBR3-AS1#1/2 or sh-PTBP1#1/2 with sh-NCs as negative control were ordered from GenScript (Nanjing, China). Full sequences of CBR3-AS1 were inserted into pcDNA3.1 vectors for overexpression with the empty vectors as negative control.

2.2. Quantitative Reverse Transcription PCR (RT-qPCR)

Total RNAs from GC cells were isolated using TRIzol (#15596018, Invitrogen, Carlsbad, CA). Then, the synthesis of cDNA was conducted via Transcriptor First Strand cDNA Synthesis Kit (#04896866001, Roche, Basel, Switzerland). Real-time PCR was conducted by SYBR™ Green PCR Master Mix (#4364346, Applied Biosystems™, Foster City, CA) on real-time PCR system (ABI 7500, Thermo Fisher, Rockford, IL). The results were calculated by the 2- method. GAPDH served as the internal control. The primers are summarized in Table 1.
Table 1

Primers used in this study.

Primer nameSequence (5′-3′)
CBR3-FGGCTTGGGAAAGCTGGAGAT
CBR3-RGGGATGGCAGACTGCTTTCT
SETD4-FAACATGGCCAAGGAGAGAGC
SETD4-RCTATCAGGCATGCTCTGGGG
CBR1-FACAGTCCACACTTGCCCAAA
CBR1-RAAATGAGCAGGGAGGCATCC
DOPEY2-FGCCTGGGATGCACAGAGAAT
DOPEY2-RTCATCATGGGGCACAGGTTC
GAPDH-FGAACCTGTGCCCCATGATGA
GAPDH-RGCCTTTTGAGGGGTTCCAGA

2.3. CCK-8 Assay and Colony Formation Assay

For CCK-8, GC cells were incubated with CCK-8 solution (#96992, Sigma-Aldrich, St. Louis, MO) in 96-well plates. The absorbance at 450 nm was detected with a Microplate Reader (ELx808™, BioTek, Winooski, VT) at 0, 24, 48, and 72 h. For colony formation, transfected cells were cultured in a 6-well plate for two weeks. The colonies were treated with methanol and stained in crystal violet.

2.4. Flow Cytometry Analysis

For the analysis of cell cycle, cells were washed with PBS and suspended in PI/RNase Staining Buffer (#550825, BD Biosciences, Franklin Lake, NJ) in the dark at 4°C. The fluorescence-activated cells were determined by a flow cytometer (FACSCanto II, BD Biosciences). For the analysis of cell apoptosis, transfected cells were stained by an Annexin V-FITC Apoptosis Detection Kit (85-BMS500FI-300, Invitrogen) and quantified.

2.5. Western Blot

Total proteins isolated in RIPA buffer (Thermo Fisher, Rockford, IL) were separated using SDS-PAGE and transferred onto PVDF membranes. Membranes were then blocked with 5% defatted milk for 1 h and cultured with primary antibodies at 4°C overnight. After TBST washing, blots were cultured with secondary antibodies at room temperature. The antibodies used in this assay include Anti-Cyclin D1 (#55506, Cell signaling Technology, Boston, MA), Anti-β-actin (#4970, Cell signaling Technology), Anti-PTBP1 (#72669, Cell signaling Technology), Anti-p21 (ab109520, Abcam, Cambridge, MA), Anti-p16 (ab108349, Abcam), Anti-Bcl-2 (ab182858, Abcam), Anti-Bax (ab32503, Abcam), and Anti-IgG (ab172730, Abcam).

2.6. Subcellular Fractionation Analysis

The separation of cytoplasmic and nuclear RNA was performed through PARIS Kit (AM1921, Invitrogen) under the manufacturer's instructions. U1 served as a nuclear control and GAPDH served as a cytoplasmic control.

2.7. ActD Experiments

Briefly, actinomycin D (ActD, SBR00013, Sigma-Aldrich) was added into GC cells to block RNA synthesis prior to RNA extraction with TRIzol reagent. The SET domain containing 4 (SETD4) mRNA level was detected by RT-qPCR.

2.8. RNA Pulldown Assay and Mass Spectrometry

The CBR3-AS1 lncRNA was biotinylated to construct secondary structure using structure buffer. Biotinylated RNA was mixed with cell lysate and cultured with the M-280 streptavidin beads (S3762, Sigma-Aldrich) at 4°C overnight. After centrifugation, the complex was boiled in 5× SDS loading buffer. The retrieved proteins were isolated and identified by mass spectrometry and western blot.

2.9. RNA Binding Protein Immunoprecipitation (RIP) Assay

The EZMagna RIP kit (17-701, Sigma-Aldrich) was used for RIP assays under the manufacturer's instructions. In short, the collected cells were cultured in lysis buffer. Then, the magnetic beads with antibodies targeting PTBP1 or IgG were cultured with cell lysate at 4°C overnight. After a brief washing of beads, the precipitated RNA was purified and quantified through the analysis of RT-qPCR.

2.10. Statistical Analysis

All data were presented as mean ± standard deviation (SD). All experiments were performed in triplicate. The differences between two groups were analyzed by Student's t test, and the differences between multiple groups were determined by using one-way ANOVA followed by Dunnett's post hoc test. One-tailed P value less than 0.05 was considered as statistically significant.

3. Results

3.1. CBR3-AS1 Silencing Inhibits Cell Proliferation in GC

Firstly, we found that CBR3-AS1 was highly expressed in GC cells, especially in JEG-3 and BeWo cells (Figure 1(a)). Subsequently, we performed loss-of-function assays in JER-3 and BeWo cells after the knockdown efficiency of CBR3-AS1 being verified by RT-qPCR (Figure 1(b)). According to proliferation assays, CBR3-AS1 silencing notably decreased OD value and colony numbers, manifesting that CBR3-AS1 silencing suppresses GC cell proliferation (Figures 1(c) and 1(d)). According to flow cytometry analyses, CBR3-AS1 silencing blocked GC cells in the G1 phase and promoted cell apoptosis (Figures 1(e) and 1(f)). Meanwhile, the levels of cell cycle-related proteins (Cyclin D1, p21, and p16) and apoptosis-related proteins (Bcl-2 and Bax) were measured by western blot. It turned out that the levels of procyclical Cyclin D1 and antiapoptotic Bcl-2 were decreased by CBR3-AS1 silencing whereas the levels of p21/p16 and proapoptotic Bax were enhanced (Figure 1(g)). To sum up, CBR3-AS1 is highly expressed in GC cells and its downregulation inhibits cell proliferation, induces cell cycle arrest, and facilitates cell apoptosis in GC.
Figure 1

CBR3-AS1 silencing suppresses the malignant progression of GC in vitro. (a) RT-qPCR analysis of CBR3-AS1 expression in GC cells (JEG-3, BeWo, and JAR) and normal HTR-8 cells. (b) The knockdown efficiency of CBR3-AS1 in JEG-3 and BeWo cells was certified by RT-qPCR. (c, d) GC cell proliferation was analyzed with CBR3-AS1 silencing through CCK-8 and colony formation assays. (e, f) Flow cytometry analysis on cell cycle and cell apoptosis was performed with CBR3-AS1 downregulation. (g) Western blot analysis on the level of cell cycle-related proteins (Cyclin D1, p21, and p16) and cell apoptosis-related proteins (Bcl-2 and Bax). ∗P < 0.05; ∗∗P < 0.01.

3.2. CBR3-AS1 Positively Regulates SETD4 in GC Cells

Furthermore, we focused on the molecular mechanism of CBR3-AS1 in GC cells. After finding four potential mRNAs of CBR3-AS1 via the LncRNADisease v2.0 prediction (Figure 2(a)), we detected the expression of candidate mRNAs (SETD4, CBR3, CBR1, and DOPEY2) via RT-qPCR. Only the expression of SETD4 was notably decreased by CBR3-AS1 knockdown in GC cells (Figure 2(b)). Then, we verified the overexpression efficiency of CBR3-AS1 in JAR cells (Figure 2(c)). As shown in Figure 2(d), CBR3-AS1 overexpression markedly increased the expression of SETD4 in JAR cells, indicating that CBR3-AS1 positively regulates SETD4 in GC cells. Therefore, SETD4 was determined as the target mRNA of CBR3-AS1 in the subsequent experiments. According to subcellular fractionation analysis, we found that CBR3-AS1 was mainly distributed in GC cell cytoplasm (Figure 2(e)). Since cytoplasmic lncRNAs are implicated in posttranscriptional regulations such as mRNA stability, we then detected the level of SETD4 mRNA after the treatment of actinomycin D (ActD, transcription inhibitor). The results showed that CBR3-AS1 knockdown decreased SETD4 mRNA but CBR3-AS1 overexpression increased it, indicating that CBR3-AS1 stabilizes SETD4 mRNA (Figures 2(f) and 2(g)). Collectively, CBR3-AS1 stabilizes SETD4 mRNA to upregulate SETD4 expression in GC cells.
Figure 2

CBR3-AS1 stabilizes SETD4 mRNA to upregulate its expression in GC cells. (a) The LncRNADisease v2.0 prediction of the potential mRNAs of CBR3-AS1. (b) The expression of 4 candidate mRNAs was detected by RT-qPCR with CBR3-AS1 deficiency. (c) The overexpression efficiency of CBR3-AS1 was verified by RT-qPCR. (d) RT-qPCR analysis of SETD4 expression with CBR3-AS1 overexpression. (e) Subcellular fractionation analysis of CBR3-AS1 distribution in GC cells. (f, g) The level of SETD4 mRNA was analyzed by RT-qPCR with CBR3-AS1 knockdown at different treatment times of ActD. ∗∗P < 0.01.

3.3. CBR3-AS1 Interacts with PTBP1 to Enhance SETD4 Stability

Considering that lncRNAs play vital roles in cells via interacting with RNA binding proteins (RBPs) [14], we speculated that CBR3-AS1 may interact with the target RBP to regulate SETD4. According to RNA pulldown assay followed by mass spectrometry analysis, PTBP1 could interact with CBR3-AS1 (Figure 3(a)). RIP assays showed that CBR3-AS1 was notably enriched in Anti-PTBP1 groups versus the control groups (Figure 3(b)). Meanwhile, the binding between PTBP1 and SETD4 was certified by RIP assays (Figure 3(c)). After verifying the knockdown efficiency of PTBP1 (Figure 3(d)), we verified that PTBP1 silencing suppressed the expression of SETD4 (Figure 3(e)). After ActD treatment, PTBP1 knockdown decreased the level of SETD4, indicating that PTBP1 could stabilize SETD4 mRNA (Figure 3(f)). According to western blot analysis, CBR3-AS1 silencing could not affect the protein level of PTBP1 in GC cells (Figure 3(g)). RIP assays demonstrated that CBR3-AS1 knockdown impaired the enrichment of SETD4 in Anti-PTBP1 groups and CBR3-AS1 overexpression enhanced it (Figures 3(h) and 3(i)). Collectively, CBR3-AS1 interacts with PTBP1 and thereby stabilizes SETD4 mRNA.
Figure 3

CBR3-AS1 interacts with PTBP1 to stabilize SETD4 mRNA. (a) RNA pulldown assay followed by mass spectrometry analysis was performed to explore the potential proteins interacting with CBR3-AS1. (b) The binding between CBR3-AS1 and PTBP1 was proved via RIP assay. (c) The binding between PTBP1 and SETD4 was analyzed by RIP assay in GC cells. (d) The knockdown efficiency of SETD4 was detected through western blot. (e) RT-qPCR analysis of SETD4 expression with PTBP1 knockdown. (f) The level of SETD4 mRNA was measured via RT-qPCR after ActD treatment. (g) Western blot analysis of PTBP1 level with CBR3-AS1 knockdown. The binding between PTBP1 and SETD4 was analyzed by RIP assays with CBR3-AS1 (h) knockdown or (i) overexpression. ∗∗P < 0.01.

3.4. CBR3-AS1 Promotes GC Cell Proliferation via SETD4

Finally, we performed rescue experiments to explore the role of CBR3-AS1 in GC cells. After verifying the overexpression efficiency of SETD4 (Figure 4(a)), we found that SETD4 overexpression counteracted the inhibition of SETD4 expression induced by CBR3-AS1 silencing (Figure 4(b)). According to proliferation assays, the decreased OD value and colony numbers caused by CBR3-AS1 silencing could be counteracted by SETD4 overexpression (Figures 4(c) and 4(d)). Flow cytometry analysis found that SETD4 overexpression could offset the block role of CBR3-AS1 knockdown on cell cycle (Figure 4(e)). Meanwhile, the increased cell apoptosis rate caused by CBR3-AS1 was reversed by SETD4 overexpression (Figure 4(f)). Furthermore, western blot analysis found that SETD4 overexpressed reversed the effect of CBR3-AS1 silencing on the level of cell cycle/apoptosis-related proteins (Figure 4(g)). To sum up, CBR3-AS1 facilitates the malignant progression of GC via upregulating SETD4 in vitro.
Figure 4

CBR3-AS1 promotes GC cell malignant proliferation via upregulating SETD4. (a) RT-qPCR analysis of SETD4 overexpression efficiency. (b) RT-qPCR analysis on SETD4 expression was implemented under different transfections. (c, d) GC cell proliferative ability was detected under different transfections. (e, f) GC cell cycle and apoptosis were analyzed by flow cytometry analysis under different transfections. (g) Western blot analysis was performed on the level of cycle-related proteins and apoptosis-related proteins in GC cells under different transfections. ∗P < 0.05; ∗∗P < 0.01.

4. Discussion

In our research, we demonstrated that CBR3-AS1 is upregulated in GC cells and promotes cell proliferation for the first time. Functional assays including CCK-8, colony formation, and flow cytometry assays verified that cell proliferation and cell cycle were suppressed by CBR3-AS1 knockdown while cell apoptosis was enhanced. Several genes have also been reported to play an oncogene role in choriocarcinoma cells. Wang et al. have certified that ADAM1 depletion facilitates choriocarcinoma cell apoptosis via activating autophagy [15]. Zhao et al. have found that aberrantly expressed SALL4 facilitates choriocarcinoma cell proliferation through the β-catenin/c-Myc pathway [16]. Wu et al. have proved that β-catenin/LIN28B facilitates choriocarcinoma cell proliferation by Let-7a [17]. The specific role and mechanism of CBR3-AS1 in GC have not been stated in the previous studies, which may provide a novel molecular marker for GC diagnosis and treatment. Through RT-qPCR analysis, we found that CBR3-AS1 positively regulates SETD4 and primarily distributed in the cell cytoplasm, which suggests that CBR3-AS1 may regulate the expression of SETD4 via posttranscriptional regulation. Considering the interaction of lncRNA and its target RBP in tumor progression [18-20], we performed RNA pulldown and mass spectrometry analysis to search the target RBP of CBR3-AS1 in GC cells. It turned out that CBR3-AS1 could interact with PTBP1 in GC cells. Different from other proteins in the PTBP family, PTBP1 is expressed in almost all human cell types and could be regulated by various molecules [21]. Sun et al. have demonstrated that circMYBL2 could regulate the translation of FLT3 via recruiting PTBP1 to facilitate FLT3-ITD AML progression [22]. Zhang et al. have revealed that lncRNA MEG3 could induce cholestatic liver injury via interacting with PTBP1 and thus promote shp mRNA decay [23]. Sheng et al. have found that lncRNA which was targeted by p53 could act as a tumor suppressor via interacting with PTBP1 to inhibit the Wnt/β-catenin pathway in glioma [24]. According to RIP and mRNA stability assays, we certified that PTBP1 could bind with SETD4 and stabilize SETD4 mRNA. Furthermore, we found that CBR3-AS1 knockdown impaired the binding between PTBP1 and SETD4, and PTBP1 silencing could reverse the promotion of SETD4 mRNA level caused by CER3-AS1 overexpression. Hence, we concluded that CBR3-AS1 could interact with RBP PTBP1 and thereby stabilizing SETD4 mRNA in GC cells, which is another novel finding in our study. Finally, the functional role of CBR3-AS1 on cell proliferation, cell cycle, and apoptosis in GC was analyzed by rescue experiments. It turned out that CBR3-AS1 facilitates GC cell proliferation via upregulating SETD4. In this research, we confirmed that CBR3-AS1 interacts with PTBP1 to enhance the binding affinity of PTBP1 and SETD4 mRNA and eventually stabilizes and upregulates SETD4 mRNA. Meanwhile, we verified that SETD4 protein could promote GC cell proliferation and cell cycle and inhibit cell apoptosis. In a word, CBR3-AS1 accelerates the malignant proliferation of GC cells via stabilizing SETD4. Unfortunately, clinicopathological analysis was not performed in this study due to difficult tissue collection. We will perform this analysis in future research.
  24 in total

1.  Prediction of the RBP binding sites on lncRNAs using the high-order nucleotide encoding convolutional neural network.

Authors:  Shao-Wu Zhang; Ya Wang; Xi-Xi Zhang; Jia-Qi Wang
Journal:  Anal Biochem       Date:  2019-07-16       Impact factor: 3.365

2.  Treatment of metastatic gestational choriocarcinoma with oral methotrexate in a combat environment.

Authors:  John H Farley; R Brian Heathcock; Walter Branch; Wilma Larsen; Dallas Homas
Journal:  Obstet Gynecol       Date:  2005-05       Impact factor: 7.661

3.  β-catenin/LIN28B promotes the proliferation of human choriocarcinoma cells via Let-7a repression.

Authors:  Jing Wu; Xuan Feng; Yan Du; Baoxin Luan; Huandi Yu; Yinhua Yu; Lanxiang Wu; Hongbo Zhao
Journal:  Acta Biochim Biophys Sin (Shanghai)       Date:  2019-05-23       Impact factor: 3.848

4.  LncRNA CBR3-AS1 predicts unfavorable prognosis and promotes tumorigenesis in osteosarcoma.

Authors:  Yunxing Zhang; Wang Meng; Hongxia Cui
Journal:  Biomed Pharmacother       Date:  2018-03-22       Impact factor: 6.529

Review 5.  Roles of PTBP1 in alternative splicing, glycolysis, and oncogensis.

Authors:  Wei Zhu; Bo-Lun Zhou; Li-Juan Rong; Li Ye; Hong-Juan Xu; Yao Zhou; Xue-Jun Yan; Wei-Dong Liu; Bin Zhu; Lei Wang; Xing-Jun Jiang; Cai-Ping Ren
Journal:  J Zhejiang Univ Sci B       Date:  2020-02-05       Impact factor: 3.066

6.  circMYBL2, a circRNA from MYBL2, regulates FLT3 translation by recruiting PTBP1 to promote FLT3-ITD AML progression.

Authors:  Yu-Meng Sun; Wen-Tao Wang; Zhan-Cheng Zeng; Tian-Qi Chen; Cai Han; Qi Pan; Wei Huang; Ke Fang; Lin-Yu Sun; Yan-Fei Zhou; Xue-Qun Luo; Chengwei Luo; Xin Du; Yue-Qin Chen
Journal:  Blood       Date:  2019-10-31       Impact factor: 22.113

7.  Long intergenic non-coding RNA 00324 promotes gastric cancer cell proliferation via binding with HuR and stabilizing FAM83B expression.

Authors:  Zigui Zou; Tianshi Ma; Xuezhi He; Jinxing Zhou; Hongwei Ma; Min Xie; Yanhua Liu; Die Lu; Shihao Di; Zhihong Zhang
Journal:  Cell Death Dis       Date:  2018-06-18       Impact factor: 9.685

8.  lncRNA-PDPK2P promotes hepatocellular carcinoma progression through the PDK1/AKT/Caspase 3 pathway.

Authors:  Weidong Pan; Wen Li; Jun Zhao; Zhiyi Huang; Jingyuan Zhao; Shuxian Chen; Chusi Wang; Youqiu Xue; Feng Huang; Qiannan Fang; Julie Wang; David Brand; Song Guo Zheng
Journal:  Mol Oncol       Date:  2019-08-22       Impact factor: 6.603

9.  LncRNA CBR3-AS1 potentiates Wnt/β-catenin signaling to regulate lung adenocarcinoma cells proliferation, migration and invasion.

Authors:  Min Hou; Nannan Wu; Lili Yao
Journal:  Cancer Cell Int       Date:  2021-01-09       Impact factor: 5.722

10.  LNCcation: lncRNA localization and function.

Authors:  Mary Catherine Bridges; Amanda C Daulagala; Antonis Kourtidis
Journal:  J Cell Biol       Date:  2021-02-01       Impact factor: 10.539

View more
  1 in total

1.  Unmasking the mammalian SET domain-containing protein 4.

Authors:  Yuan Wang; Zhiyuan Shen
Journal:  NAR Cancer       Date:  2022-07-13
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.