| Literature DB >> 35651935 |
Yuening Li1, Xianglong Wang1, Qingxun Guo1, Xinsheng Zhang1, Lianxia Zhou1, Yang Zhang2, Chunyu Zhang1.
Abstract
MicroRNA166 (miR166) is highly conserved and has diverse functions across plant species. The highbush blueberry (Vaccinium corymbosum) genome is thought to harbor 10 miRNA166 loci (Vco-miR166), but the extent of their evolutionary conservation or functional diversification remains unknown. In this study, we identified six additional Vco-miR166 loci based on conserved features of the miR166 family. Phylogenetic analyses showed that mature Vco-miR166s and their precursor cluster in several clades are evolutionary conserved with diverse species. The cis-regulatory elements in the Vco-miR166 promoters indicated functions related to different phytohormones and defense responses. We also identified putative targets of vco-miR166s, which targeted the same gene families, suggesting the functional conservation and diversification of Vco-miR166 family members. Furthermore, we examined the accumulation patterns of six mature Vco-miR166s in response to abiotic stresses by stem-loop reverse RT-qPCR, which revealed their upregulation under freezing, cold, and heat stress, while they were downregulated by drought compared to control growth conditions. However, Vco-miR166 members showed different expression patterns when exposed to salt stress. These results showed that conserved Vco-miR166 family members display functional diversification but also coordinately influence plant responses to abiotic stress.Entities:
Keywords: abiotic stress; evolutionary conservation; functional diversification; highbush blueberry; miR166; target genes
Year: 2022 PMID: 35651935 PMCID: PMC9149266 DOI: 10.3389/fgene.2022.919856
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
Characteristics of three newly identified miR166 precursors in highbush blueberry.
| Locus ID | Length (nt) | NM | MFE | MFEI | Sequence region on Draper genome | Scaffold_ID on Draper genome | Sequence comparison with similar species in NCBI | |||
|---|---|---|---|---|---|---|---|---|---|---|
| Accession | Species | Name | Identity (%) | |||||||
|
| 107 | 3 | −45.30 | 0.85 | 9,638,758–9,638,864 | VaccDscaff1 |
|
|
| 90 |
|
| 114 | 3 | −51.70 | 1.08 | 37,329,235–37,329,348 | VaccDscaff19 |
|
|
| 90 |
|
| 186 | 4 | −67.9 | 0.89 | 28,809,023–28,809,208 | VaccDscaff33 | NR_107,986 |
|
| 63 |
NM, number of mismatches between predicted 3′ and 5′ arms of the miRNA.
Minimal folding free energy.
Minimal folding free energy index.
Characteristics of six newly identified mature miR166s in highbush blueberry.
| ID | Sequence | Length (nt) | Homologs | Species | NM |
|---|---|---|---|---|---|
| Vco-miR166g-3p | UCUCGGACCAGGCUUCAUUCC | 21 | Gma-miR166h-3p, Csi-miR166 b,d,g-3p |
| 0 |
| Vco-miR166g-5p | GGGAAUGCUGUCUGGUUCGAG | 21 | Csi-miR166c-5p |
| 1 |
| Vco-miR166h-3p | AUUUCGGACCAGGCUUCAUUCC | 22 | Lja-miR166-3p |
| 0 |
| Vco-miR166h-5p | GGAAUGUUGUCUGGUUCGAGA | 21 | Csi-miR166c-5p, Zma-miR166g-5p, Bdi-miR166d-5p, Ata-miR166e-5p, Vca-miR166a-5p |
| 1 |
| Vco-miR166i-3p | UCGGACCAGGCUUCAUUCCCC | 21 | Bdi-miR166 b,c,d,i-3p, Gma-miR166c,i-3p, Stu-miR166a,c,d,h-3p, Aly-miR166h-3p, Ata-miR166a,b,d,e-3p, Vca-miR166a,b,c-3p, Eun-miR166-3p, Fve-miR166d-3p, Cas-miR166c,f-3p |
| 0 |
| Vco-miR166i-5p | GGGAUGUUGUCUGGCUCGAUG | 21 | Cly-miR166c-5p, Zma-miR166c-5p, Csi-miR166a,e,f-5p, Aly-miR166a,c,d-5p, Gma-miR166a,c-5p, Osa-miR166d-5p, Mtr-miR166g-5p, Bdi-miR166e-5p, Stu-miR166a-5p, Vca-miR166b-5p, Eun-miR166-5p |
| 2 |
Number of mismatches between predicted Vco-miR166s, and their homologs.
FIGURE 1Sequence alignment of miR166 precursors. Vco, Vaccinium corymbosum; Csi, Citrus sinensis; Vvi, Vitis vinifera; Mdm, Malus domestic. Pink, 100% conservation; green, ≥75% conservation; yellow, ≥50% conservation. The core region of the mature miRNA is indicated in the black box.
FIGURE 2Phylogenetic analyses of miR166 loci and their predicted 3′ and 5′ arms. Sequences were aligned in MEGA X, and the phylogenetic tree was constructed with the UPGMA method (A) Phylogenetic analysis of Vco-miR166 precursors and related sequences from Csi, Citrus sinensis; Vvi, Vitis vinifera ; and Mdm, Malus domestica. Csi-MIR167 b served as the outgroup (B,C) Phylogenetic analysis of mature Vco-miR166s and Csi-miR166s for the 3′ arm (B) and 5′ arm (C). Black and red dots indicate mature miR166s or their precursors of highbush blueberry from a previous study (Hou et al., 2017) and this study, respectively. The numbers at the nodes indicate the percentage of support from 1,000 bootstrap replicates. The scale indicates the average number of amino acid substitutions per site.
Putative cis-regulatory elements in upstream sequences of blueberry Vco-miR166s.
|
| Phytohormone-related elements | Defense-related elements | |||||||
|---|---|---|---|---|---|---|---|---|---|
| Gibberellin responsive | Methyl jasmonate responsiveness | Salicylic acid responsiveness | Auxin responsiveness | Abscisic acid responsiveness | Defense and stress responsiveness | Drought inducibility | Low-temperature responsiveness | Anaerobic induction | |
|
| GARE-motif, P-box | -- | TCA-element | -- | -- | -- | MBS | LTR | ARE |
|
| P-box | TGACG-motif, CGTCA-motif | -- | TGA-box, TGA-element | ABRE | -- | -- | -- | ARE |
|
| -- | -- | -- | AuxRR-core | ABRE | -- | -- | -- | ARE |
|
| P-box | -- | -- | TGA-box | ABRE | TC-rich | MBS | -- | ARE |
|
| P-box | TGACG-motif, CGTCA-motif | -- | TGA-box, TGA-element | ABRE | -- | -- | -- | ARE |
|
| GARE-motif | TGACG-motif, CGTCA-motif | -- | -- | ABRE | -- | MBS | -- | ARE |
|
| GARE-motif | TGACG-motif, CGTCA-motif | -- | TGA-element, AuxRR-core | ABRE | -- | -- | LTR | ARE |
|
| -- | TGACG-motif, CGTCA-motif | TCA-element | AuxRR-core | ABRE | -- | MBS | LTR | ARE |
|
| GARE-motif | TGACG-motif, CGTCA-motif | -- | -- | -- | TC-rich | -- | -- | ARE |
TC-rich: cis-acting element involved in defense and stress responsiveness; MBS: MYB, binding site involved in drought-inducibility; LTR: cis-acting element involved in low-temperature responsiveness; ARE: cis-acting regulatory element essential for the anaerobic induction.
Genetic distance and genetic similarity between Vco-miR166s from highbush blueberry according to the functions of target genes.
| Vco-miR166a | Vco-miR166b/i-3p | Vco-miR166c-3p | Vco-miR166d-3p | Vco-miR166e-3p | Vco-miR166g-3p | Vco-miR166h-3p | Vco-miR166b-5p | Vco-miR166c-5p | Vco-miR166d/i-5 | Vco-miR166e-5p | Vco-miR166f-5p | Vco-miR166g-5p | Vco-miR166h-5p | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Vco-miR166a | 0.12 | 1.27 | 0.31 | 1.23 | 1.66 | 1.28 | 2.91 | 2.28 | 2.56 | 2.85 | 2.63 | 2.83 | 2.57 | |
| Vco-miR166b/i-3 | 0.88 | 1.28 | 0.24 | 1.15 | 1.67 | 1.30 | 3.03 | 2.40 | 2.68 | 2.97 | 2.76 | 2.95 | 2.70 | |
| Vco-miR166c-3p | 0.28 | 0.27 | 1.02 | 1.61 | 1.92 | 1.66 | 2.48 | 2.25 | 2.94 | 2.41 | 2.60 | 2.40 | 2.03 | |
| Vco-miR166d-3p | 0.73 | 0.78 | 0.36 | 1.19 | 1.62 | 1.04 | 2.86 | 2.01 | 2.52 | 2.80 | 2.59 | 2.79 | 2.24 | |
| Vco-miR166e-3p | 0.29 | 0.31 | 0.20 | 0.31 | 0.59 | 1.81 | 2.15 | 1.65 | 1.99 | 2.09 | 1.72 | 2.36 | 2.22 | |
| Vco-miR166g-3p | 0.18 | 0.19 | 0.14 | 0.19 | 0.53 | 2.12 | 1.37 | 1.61 | 1.96 | 1.71 | 1.49 | 2.16 | 1.62 | |
| Vco-miR166h-3p | 0.28 | 0.27 | 0.19 | 0.35 | 0.16 | 0.12 | 2.90 | 2.26 | 2.55 | 2.83 | 2.33 | 2.82 | 2.56 | |
| Vco-miR166b-5p | 0.05 | 0.05 | 0.08 | 0.06 | 0.11 | 0.25 | 0.05 | 1.57 | 1.57 | 0.82 | 0.80 | 0.74 | 1.01 | |
| Vco-miR166c-5p | 0.10 | 0.09 | 0.10 | 0.13 | 0.19 | 0.20 | 0.10 | 0.21 | 1.53 | 1.91 | 1.33 | 1.90 | 1.13 | |
| Vco-miR166d/i-5 | 0.08 | 0.07 | 0.05 | 0.08 | 0.13 | 0.14 | 0.08 | 0.21 | 0.22 | 1.51 | 0.96 | 2.08 | 1.44 | |
| Vco-miR166e-5p | 0.06 | 0.05 | 0.09 | 0.06 | 0.12 | 0.18 | 0.06 | 0.44 | 0.15 | 0.22 | 0.89 | 1.49 | 1.52 | |
| Vco-miR166f-5p | 0.07 | 0.06 | 0.07 | 0.07 | 0.17 | 0.22 | 0.09 | 0.45 | 0.26 | 0.38 | 0.40 | 1.28 | 0.97 | |
| Vco-miR166g-5p | 0.06 | 0.05 | 0.09 | 0.06 | 0.09 | 0.11 | 0.06 | 0.47 | 0.15 | 0.12 | 0.23 | 0.27 | 1.22 | |
| Vco-miR166h-5p | 0.08 | 0.07 | 0.13 | 0.10 | 0.11 | 0.20 | 0.08 | 0.36 | 0.32 | 0.24 | 0.22 | 0.38 | 0.29 |
Genetic distances are indicated in the upper right triangle; genetic similarity is shown in the lower left triangle.
FIGURE 3RT-qPCR analysis of Vco-miR166 abundance under various stress conditions. Highbush blueberry plants were exposed to freezing (A), cold (B), heat (C), drought (D), and salt (E) stress. Data represent the means ± standard deviation (SD) of three independent biological replicates, each with three technical replicates. Different letters indicate significant differences (p < 0.05) between samples, as determined by Tukey’s test.