| Literature DB >> 35646090 |
Lei Cao1,2, Kunming Zheng1,2, Yanhong Liu1,2, Peng Song1,2, Chuntao Wang1,2, Hongzhi Wang1,2, Nan Wang1,2, Shiwu Zhang1,2, Yongjie Zhao1,2.
Abstract
Gastrointestinal stromal tumors (GISTs) are common ICC precursor sarcomas, which are considered to be a potential malignant mesenchymal tumor driven by specific KIT or PDGFRA signals in the gastrointestinal tract. The standard treatment for GIST without metastasis is surgical resection. GIST with metastasis is usually treated with tyrosine kinase inhibitors (TKIs) only but cannot be cured. The TKI imatinib is the main drug of GIST drug therapy. In adjuvant therapy, the duration of imatinib adjuvant therapy is 3 years. It has been proved that imatinib can improve the overall survival time (OS). However, many GIST patients develop drug resistance due to the long-term use of imatinib. We were forced to look for new strategies to treat GIST. The purpose of the current academic work is to study the drug-resistant genes of imatinib and their potential mechanisms. A total of 897 differentially expressed genes (DEGs) were found between imatinib-sensitive cell line GIST882 and imatinib-resistant cell line GIST430 by RNA sequencing (RNA-seq). After analyzing the DEGs, 10 top genes were selected (NDN, FABP4, COL4A1, COLEC11, MEG3, EPHA3, EDN3, LMO3, RGS4, and CRISP2). These genes were analyzed by RT-PCR, and it was confirmed that the expression trend of FABP4, COL4A1, and RGS4 in different imatinib-resistant cell lines was in accord with the GEO database. It is suggested that these genes may play a potential role in the clinical diagnosis and treatment of imatinib resistance in GIST.Entities:
Keywords: DEG (differentially expressed gene) analysis; GIST; gastrointestinal stromal tumor; gene chip; imatinib; resistance
Year: 2022 PMID: 35646090 PMCID: PMC9136294 DOI: 10.3389/fgene.2022.878145
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
Primer sequences used for real-time PCR assay.
| Gene | Forward primer (5–3′) | Forward primer (5–3′) |
|---|---|---|
| GAPDH | GAAGGTGAAGGTCGGAGTCAAC | TGGAAGATGGTGATGGGATTTC |
| FABP4 | ACTGGGCCAGGAATTTGACG | CTCGTGGAAGTGACGCCTT |
| COL4A1 | GGGATGCTGTTGAAAGGTGAA | GGTGGTCCGGTAAATCCTGG |
| RGS4 | ACATCGGCTAGGTTTCCTGC | GTTGTGGGAAGAATTGTGTTCAC |
FIGURE 1Volcano map of differential expression analysis in GIST882 and GIST430 data sets.
FIGURE 2Heatmap of differentially expressed genes in GIST882 and GIST430 data sets.
FIGURE 3Analysis results of functional enrichment.
FIGURE 4Enrichment analysis by KEGG of DEGS.
Top ten upregulated genes of DEGs.
| Gene symbol logFC AveExpr P.Value adj.P.Va |
|---|
| NDN 8.0670 11.0970 3.35E-23 2.37E-19 |
| FABP4 7.2881 10.7183 1.83E-23 2.37E-19 |
| COL4A1 6.7008 10.2284 2.42E-22 7.60E-19 |
| COLEC11 6.6720 10.5963 2.01E-21 2.60E-18 |
| MEG3 6.3592 10.2336 2.31E-22 7.60E-19 |
| EPHA3 6.3025 9.8446 1.16E-21 1.92E-18 |
| EDN3 6.1380 9.6867 8.42E-22 1.76E-18 |
| LMO3 6.1217 9.6960 1.60E-22 7.20E-19 |
| RGS4 6.0082 10.2738 5.82E-22 1.45E-18 |
| CRISP2 6.0010 9.8171 1.19E-20 8.87E-18 |
| Abbreviations: FC, fold change; AveExpr, average expression quantity; adj.P.Va, adjusted P value |
FIGURE 5Expression levels of FABP4, COL4A1, and RGS4 in different GIST cell lines determined using quantitative real-time polymerase chain reaction. “**” means p-value < 0.01, “***” means p-value < 0.001.
FIGURE 6PPI network of DEGs obtained from the STRING database. The protein network was calculated based on the neighborhood score with higher confidence (confidence score >0.99).