Long-noncoding RNA HOXA transcript at the distal tip (HOTTIP) has been probed to exert essential effects on diabetes progression, while its function in gestational diabetes mellitus (GDM) remains unclear. This study was committed to unravel the effects of HOTTIP on GDM progression via the microRNA (miR)-423-5p/wingless-type MMTV integration site family member 7A (WNT7A) axis. The GDM mouse model was established. HOTTIP, miR-423-5p and WNT7A levels in GDM mice were examined. The saline with dissolved various constructs altering HOTTIP, miR-423-5p and WNT7A expression was injected into GDM mice to detect the levels of GDM-related biochemical indices, HOMA indices, liver gluconease: expression levels of phosphoenolpyruvate carboxykinase (PEPCK), glucose-6-phosphatase (G-6-Pase), glucose transporter 2 (GLUT2) and pathological changes of pancreatic tissues, and the apoptosis rate of pancreatic cells in GDM mice. The relations among HOTTIP, miR-423-5p and WNT7A were validated. HOTTIP and WNT7A levels were decreased while miR-423-5p was elevated in GDM mice. The enriched HOTTIP or silenced miR-423-5p alleviated the levels of GDM-relatedbiochemical indices, enhanced the insulin homeostasis, elevated GLUT2 expression and decreased G-6-pase and PEPCK expression, mitigated the pathological changes of pancreatic tissues, and hindered the apoptosis of pancreatic cells. MiR-143-5p upregulation abrogated the effects of elevated HOTTIP on repressing GDM; whereas WNT7A deletion reversed the therapeutic effects of reduced miR-423-5p. HOTTIP sponged miR-423-5p that targeted WNT7A. HOTTIP ameliorates insulin resistance and hepatic gluconeogenesis in GDM mice via the modulation of the miR-423-5p/WNT7A axis. This study affords novel therapeutic modalities for GDM treatment.
Long-noncoding RNA HOXA transcript at the distal tip (HOTTIP) has been probed to exert essential effects on diabetes progression, while its function in gestational diabetes mellitus (GDM) remains unclear. This study was committed to unravel the effects of HOTTIP on GDM progression via the microRNA (miR)-423-5p/wingless-type MMTV integration site family member 7A (WNT7A) axis. The GDM mouse model was established. HOTTIP, miR-423-5p and WNT7A levels in GDM mice were examined. The saline with dissolved various constructs altering HOTTIP, miR-423-5p and WNT7A expression was injected into GDM mice to detect the levels of GDM-related biochemical indices, HOMA indices, liver gluconease: expression levels of phosphoenolpyruvate carboxykinase (PEPCK), glucose-6-phosphatase (G-6-Pase), glucose transporter 2 (GLUT2) and pathological changes of pancreatic tissues, and the apoptosis rate of pancreatic cells in GDM mice. The relations among HOTTIP, miR-423-5p and WNT7A were validated. HOTTIP and WNT7A levels were decreased while miR-423-5p was elevated in GDM mice. The enriched HOTTIP or silenced miR-423-5p alleviated the levels of GDM-relatedbiochemical indices, enhanced the insulin homeostasis, elevated GLUT2 expression and decreased G-6-pase and PEPCK expression, mitigated the pathological changes of pancreatic tissues, and hindered the apoptosis of pancreatic cells. MiR-143-5p upregulation abrogated the effects of elevated HOTTIP on repressing GDM; whereas WNT7A deletion reversed the therapeutic effects of reduced miR-423-5p. HOTTIP sponged miR-423-5p that targeted WNT7A. HOTTIP ameliorates insulin resistance and hepatic gluconeogenesis in GDM mice via the modulation of the miR-423-5p/WNT7A axis. This study affords novel therapeutic modalities for GDM treatment.
Entities:
Keywords:
Gestational diabetes mellitus; apoptosis; insulin resistance; long-noncoding RNA HOXA transcript at the distal tip; microRNA-423-5p; wingless-type MMTV integration site family member 7A
HOTTIP and WNT7A are decreased while miR-423-5p is elevated in GDM mice.HOTTIP elevation or miR-423-5p silencing alleviates GDM development.HOTTIP binds to miR-423-5p which targets WNT7A.WNT7A deletion exacerbates GDM progression.The study provides novel references for the effects of HOTTIP/miR-423-5p/WNT7A on GDM.
Introduction
Gestational diabetes mellitus (GDM) is the most widespread metabolic disorder as a complication of pregnancy [1]. GDM is characterized by the incapability of pancreatic beta cells to meet the accumulating insulin requirements during pregnancy, causing different degrees of hyperglycemia [2]. It has been evidenced that women who have been diagnosed with GDM have a greater than sevenfold higher risk of being afflicted by postpartum diabetes [3] and hypertensive disorders [4]. GDM development is mainly implicated in race and ethnicity, obesity, physical activity, nutrition, and vitamin D level [5]. The initial management for GDM includes glucose monitoring and lifestyle modifications, following pharmacologic therapy with metformin, glyburide, or insulin if glucose levels exceed target values [6]. Although GDM still poses a great challenge to the public health-care system mainly because of the induced enormous economic burden and the insufficient prevention strategies [7]. Therefore, further efforts are necessary to identify novel therapeutic targets that would improve the clinical management of GDM.Long non-coding RNAs (LncRNAs) have been unveiled to function as novel markers with potential diagnostic, prognostic, and therapeutic utility in GDM [8]. For instance, silenced lncRNA plasmacytoma variant translocation 1 can facilitate GDM progression and preeclampsia via regulating human trophoblast cells [9]. LncRNA differentiation antagonizing nonprotein coding RNA can modulate the cell proliferation and insulin production of INS-1 cells in GDM [10]. As for lncRNA HOXA transcript at the distal tip (HOTTIP), it has been discovered that HOTTIP displays a low level in the islets of diabetic mice and involves in diabetes progression via regulating islet β cells function and insulin secretion [11]. However, the role of HOTTIP in GDM development remained largely unknown. In addition, HOTTIP was predicted to have a binding relation with microRNA (miR)-423-5p. Most miRNA signatures have been reported to predicate GDM in early pregnancy, such as miR-16-5p and miR-17-5p [12]. MiR-423-5p is accounted for inducing aggravated high glucose-induced apoptosis during diabetic retinopathy progression [13]. Furthermore, miR-423-5p even promotes gluconeogenesis and hyperglycemia in type 2 diabetes [14]. Nevertheless, it was obscure about the regulatory mechanism of miR-423-5p in GDM. MiR-423-5p had a target relation with wingless-type MMTV integration site family member 7A (WNT7A). WNT7A is derived from the WNT family that involves in embryogenesis and the pathological progression of malignant tumors and diabetes mellitus [15]. Moreover, the inactivated WNT signaling, oxidative and plasmic reticulum stress are also induced by GDM [16]. For WNT7A, Wang et al. have elucidated that WNT7A improves wound healing in diabetes via modulation of angiogenesis and inflammation [17].As stated above, the regulatory mechanism of HOTTIP on GDM via the miR-423-5p/WNT7A axis was not extensively explored. Hence, this study was committed to unveil the function of the HOTTIP/miR-423-5p/WNT7A axis on GDM. We hypothesized that HOTTIP augmentation contributed to decelerated GDM via repressing miR-423-5p expression and enhancing WNT7A expression, updating novel therapeutic targets for GDM treatment.
Material and methods
Ethics statement
The protocol of animal experiments was ratified by the Institutional Animal Care and Use Committee of The First Affiliated Hospital of Wenzhou Medical University (ethical number: 2015–0524).
Experimental animal
The specific pathogen-free grade C57BL/6 J female mice (weighed 23 ± 2 g; aged 8 ± 2 weeks) were offered by the animal center of Wenzhou Medical University (Zhejiang, China). Mice were raised at about 25°C with relative humidity at 38%–68% and natural light. The mice were supplied with food and freely supplied with water and food. After 1 week of adaptive feeding, the experiments were conducted [18].
The establishment of the GDM mouse model
GDM mouse model was established by intraperitoneal injection of streptozotocin (STZ). Before the experiment, the blood of the mouse tail vein was obtained to examine the fasting blood glucose (FBG), of which 3–5 mmol/L was regarded as the normal blood glucose value. The estrus cycle of mice was determined by vaginal smear. Mice in the early phase of estrus were mated. In the next morning, the vaginal orifice and vaginal fossa of mice were examined to examine if there was any vaginal suppository. The day when the detection of vaginal suppositories in mice was set as the start point of gestation. On the morning of the 6th day of gestation, mice were fasted for 12 h yet drank freely. Six mice were set as the normal group randomly. The remaining mice were given an intraperitoneal injection of STZ at 40 mg/kg (STZ was dissolved in 0.1 mol/L citric acid/sodium citrate buffer [pH = 4.2] and stored through an ice bath), while normal mice were given the same volume of citric acid/sodium citrate buffer. On the 7th day after injection, GDM mouse modeling was regarded to be successful when FBG > 5.1 mmol/L. The ultrasound was adopted to examine the number of embryos in pregnant mice, and those with 5 embryos were used for subsequent experiments [18].
Animal grouping and treatment
Mice were randomly classified into 10 groups (6 mice/per group): (1) control group (given intraperitoneal injection of citric acid/sodium citrate buffer at 40 mg/kg); (2) GDM group (given intraperitoneal injection of STZ at 40 mg/kg). Seven days after the injection, the successful modeled GDM mice were grouped and treated; (3) GDM + overexpression (oe)-negative control (NC) group (GDM mice were given injection of 20 μg HOTTIP NC that dissolved in 2.5 mL saline via tail vein); (4) GDM + oe-HOTTIP group (GDM mice were given injection of 20 μg oe-HOTTIP that dissolved in 2.5 mL normal saline via tail vein); (5) GDM + antagomiR NC group (GDM mice were given injection of 20 μg antagomiR NC that dissolved in 2.5 mL saline via tail vein); (6) GDM + miR-423-5p antagomiR group (GDM mice were given injection of 20 μg miR-423-5p antagomiR that dissolved in 2.5 mL saline via tail vein); (7) GDM + oe-HOTTIP + agomiR NC group (GDM mice were given injection of 20 μg oe-HOTTIP and 20 μg agomiR NC that dissolved in 2.5 mL saline via tail vein); (8) GDM + oe-HOTTIP + miR-423-5p agomiR group (GDM mice were given injection of 20 μg oe-HOTTIP and 20 μg miR-423-5p agomiR that dissolved in 2.5 mL saline via tail vein); (9) GDM + miR-423-5p antagomiR + sh-NC group (GDM mice were given injection of 20 μg miR-423-5p antagomiR and 20 μg shRNA NC that dissolved in 2.5 mL saline via tail vein); (10) GDM + miR-423-5p antagomiR + sh-WNT7A group (GDM mice were given injection of 10 μg miR-423-5p antagomiR and 10 μg WNT7A shRNA that dissolved in 2.5 mL saline via tail vein). Twenty ug of each was dissolved in 2.5 mL of saline and injected rapidly into the tail vein of mice [19,20]. oe- NC (NC of overexpressed vectors), oe- HOTTIP (5'- CTAGCTAGCGTGAAAGTGGGCACATTA -3'; 5'- CC GCTCGAGAACAAAAGAAACCAGAACAT-3' [21], antagomiR NC (5'- CAGUACUUUUGUGUGUAGUACAA -3'), miR-423-5p antagomiR (5'- AAAGUCUCGCUCUCUCUGCCCCUCA -3'), sh- NC (NC of silencing vectors), sh- WNT7A (5'- ATCTGAGTTCCCGAAGCAAA -3';5'- GGTGACCAGAAGGCTACCAA -3'), agomiR NC (5'- UUCUCCGAACGUGUCACGUTT -3'), and miR-423-5p agomiR (5'- UGAGGGGCAGAGAGCGAGACUUU -3') were obtained from Shanghai GenePharma Co., Ltd (Shanghai, China).
Determination of serum biochemical indices
On the 1st, 7th, 14th, 19th day of gestation, mice were disinfected and blood was obtained through the tail vein. The FBG was measured using a blood glucose meter. On the 19th day of gestation, after being anesthetized with 3% pentobarbital sodium (Sigma-Aldrich, CA, USA), the eyeball blood was collected and stored for 2 h. The blood was subjected to centrifugation at 3000 r/min for 20 min for serum separation, and then stored at −80°C. The fasting insulin levels (FINS) were measured by radioimmunoassay using an enzyme-linked immunosorbent assay kit (Jianglai Biotechnology Company, Shanghai, China) . Total cholesterol (TC) and triglyceride (TG) levels were examined through the automatic biochemical analyzer (Beckman, DxC800, USA) using the end-point method [22].
Insulin homeostasis model assessment (HOMA)
On the 19th day of gestation, HOMA indices were calculated concerning the levels of FBG and FINS. The HOMA indices included insulin resistance index (HOMA-IRI = FBG × FINS/22.5), islet β cell function index (HOMA-β% = 20 × FINS/[FBG-3.5]) and insulin sensitivity index (HOMA-ISI = 1/FBG × FINS) [20].
Hematoxylin-eosin (HE) staining
On the 19th day of gestation, the mice were euthanized. The pancreas was then quickly removed and fixed with 10% formaldehyde solution. Pancreas tissues were embedded with paraffin, sectioned into 5 μm slices, fixed on slides and dried. Then, the slices were subjected to staining. In short, the slices were soaked in xylene, hydrated with gradient ethanol, stained with hematoxylin and sealed with resin. After drying, the morphology of islet cells was observed under a light microscope and photographed [23].
TdT-mediated dUTP-biotin nick end-labeling (TUNEL) staining
On the 19th day of gestation, the apoptosis of pancreatic cells was detected by TUNEL staining. Paraffin sections (5 μm) were cultured for 20 min with proteinase K (20 μg/ml, Invitrogen, CA, USA) at 37 °C. Subsequently, the blocking of the endogenous peroxidase activity was implemented by the incubation with 3% hydrogen peroxide in methanol. After that, the sections were subjected to TUNEL staining following the manufacturer’s instructions (Roche Biochemicals, Mannheim, Germany). Next, the conjugated-horseradish peroxidase was observed with diaminobenzidine (Sigma, MO, USA), followed by counterstaining with hematoxylin. The TUNEL positive cells were imaged and counted under a microscope after the double-blinded observation [24].
Total RNA was extracted using Trizol reagent (Invitrogen company, CA, USA). Next, RNA was reverse transcribed into cDNA using the script RT reagent kit (TaKaRa) or Mir-X miR First-Strand Synthesis Kit (TaKaRa), followed by RT-qPCR with SYBR Premix Ex Taq II (Takara) in a real-time PCR system (Applied Biosystems, CA, USA) . U6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were set as the endogenous controls of miR-423-5p and other genes, respectively. The relative expression was examined by the 2−ΔΔCt method. Supplementary Table S1 displayed the primer sequences of genes [25].
Western blot analysis
Tissues were lysed with radio-immunoprecipitation assay cell lysis buffer (1 mmol/ L PMSF, Beyotime, Shanghai, China). The protein contents were measured and the protein sample was separated on sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to the polyvinylidene fluoride membrane (Bio-Rad, Hercules, CA, USA). The specific primary antibodies WNT7A (1:500, Abcam, MA. USA), GAPDH (1:1000, Cell Signaling Technology, MA, USA) were incubated overnight at 4°C, washed with Tris buffered saline, and subjected to 1 h incubation with the corresponding secondary antibody. The blots were measured with enhanced chemiluminescence. GAPDH was set as the endogenous control to ensure equal protein loading. The blot strength was quantified using ImageJ [26].
Dual luciferase reporter gene assay
Wild-type (WT) luciferase vectors for HOTTIP or WNT7A 3'UTR (HOTTIP-WT and WNT7A-WT) comprising the binding sites of miR-423-5p, together with their mutant controls (HOTTIP-MUT and WNT7A-MUT), were constructed with the basic luciferase vector psiCHECK-2 (Promega, Madison, WI, USA). HEK293T cells were co-transfected with miR-423-5p mimic or its NC and MUT or WT plasmids. After 48-h transfection, luciferase activities were tested through a dual luciferase reporter gene assay system [27].
RNA immunoprecipitation (RIP) assay
The Magna RIP RNA binding protein immunoprecipitation kit (Shanghai Canspec Scientific Instruments Co., Ltd., Shanghai, China) was adopted. Cell lysates were incubated with anti-Ago2 conjugated magnetic beads in RIP buffer. The input protein and immunoglobulin G (IgG) were set as controls. The immunoprecipitated RNA was separated by protease K. RT-qPCR was employed to examine the purified RNA. Antibodies used in RIP were Ago2 (1:50, Abcam) and IgG (1:100, Abcam) [28].
Statistical analysis
All data were analyzed using SPSS21.0 statistical software (IBM, Armonk, NY, USA). The data were expressed as mean value ± standard deviation. The t-test was used to compare the data in two groups; the analysis of variance (ANOVA) and Tukey posttest were adopted to compare data in multiple groups. P < 0.05 indicated statistical significance.
Results
The study was conducted to investigate the mechanism of HOTTIP in alleviating insulin resistance and hepatic gluconeogenesis in GDM mice by suppressing miR-423-5p to modulate WNT7A, thus providing a new treatment direction for GDM. It was hypothesized that HOTTIP modulated WNT7A expression through targeting miR-423-5p, and further affected insulin resistance and hepatic gluconeogenesis in GDM mice. To verify the hypothesis, the GDM mouse model was successfully established. Thereafter, it was evidenced that HOTTIP and WNT7A levels were reduced and miR-423-5p expression was elevated in GDM mice. Overexpression of HOTTIP or inhibition of miR-423-5p effectively alleviated insulin resistance and hepatic gluconeogenesis in GDM mice. Upregulation of miR-423-5p reversed the improvement of overexpression of HOTTIP on insulin resistance and hepatic gluconeogenesis in GDM mice; downregulation of WNT7A reversed the ameliorated effect of miR-423-5p knockdown on insulin resistance and hepatic gluconeogenesis in GDM mice. HOTTIP bound to miR-423-5p and miR-423-5p targeted WNT7A.
The successful establishment of GDM mouse models
As reflected by RT-qPCR and Western blot analysis, HOTTIP, WNT7A and glucose transporter 2 (GLUT-2) were low-expressed, while miR-423-5p and Glucose 6 Phosphatase(G-6-Pase) and phosphoenolpyruvate carboxykinase (PEPCK) were high-expressed in GDM mice (Figure 1(a–e)). The levels of serum biochemical indices FBG, FINS, TC, and TG as well as mice weight were elevated in GDM mice (Figure 1(f–i)). Through HOMA, it was revealed that HOMA-IRI level was augmented while HOMA-β% and HOMA-ISI levels were reduced in GDM mice (Figure 1(j–l)). After HE staining of pancreatic tissue sections of mice, it was observed that the pancreatic islets in normal mice displayed regular morphology, with neat cell arrangement, uniform cell size, clear chromatin, and mostly round nucleus; whereas in GDM mice, the pancreatic islets exhibited irregular and atrophic morphology, with disordered cell arrangement, denatured vacuole, reduced cell number, pyknotic and dissolving nuclear. Inflammatory cells lymphocytes and monocytes were infiltrated (Figure 1(m)). Moreover, the apoptosis rate of pancreatic cells was augmented in GDM mice as observed in TUNEL staining (Figure 1(n)). These above outcomes indicated that there were insulin resistance and hepatic gluconeogenesis in GDM mice, suggesting the GDM mouse model was successfully established.
Figure 1.
Successful establishment of a GDM mouse model. (a-c), HOTTIP, miR-423-5p and WNT7A levels in liver tissues of mice were detected by RT-qPCR; (d), the WNT7A protein expression was examined by Western blot analysis; e, the expression of GLUT-2, PEPCK and G-6-Pase in liver tissues of mice was assessed by RT-qPCR; f-i, the levels of serum biochemical indices FBG, FINS, TC and TG as well as mice weight were detected; (j-l), HOMA-IRI, HOMA-β% and HOMA-ISI levels were assessed by HOMA; (m), the pathological change of pancreatic cells was examined by HE staining; (n), the apoptosis rate of pancreatic cells was detected by TUNEL staining. The data in the figure were all measurement data and the expressed as mean value ± standard derivation; n = 6 mice; * P < 0.05 vs. the Control group.
Successful establishment of a GDM mouse model. (a-c), HOTTIP, miR-423-5p and WNT7A levels in liver tissues of mice were detected by RT-qPCR; (d), the WNT7A protein expression was examined by Western blot analysis; e, the expression of GLUT-2, PEPCK and G-6-Pase in liver tissues of mice was assessed by RT-qPCR; f-i, the levels of serum biochemical indices FBG, FINS, TC and TG as well as mice weight were detected; (j-l), HOMA-IRI, HOMA-β% and HOMA-ISI levels were assessed by HOMA; (m), the pathological change of pancreatic cells was examined by HE staining; (n), the apoptosis rate of pancreatic cells was detected by TUNEL staining. The data in the figure were all measurement data and the expressed as mean value ± standard derivation; n = 6 mice; * P < 0.05 vs. the Control group.
HOTTIP overexpression improves insulin resistance and hepatic gluconeogenesis in GDM mice
To verify the effect of HOTTIP on GDM mice, the GDM mice were given an injection of oe-HOTTIP and its NC plasmids that dissolved in saline, and it revealed that HOTTIP level was increased in GDM mice after the up-regulation of HOTTIP (Figure 2(a)). Meanwhile, in response to the elevated HOTTIP in GDM mice, it was observed that G-6-Pase and PEPCK levels were decreased in the liver tissues of GDM mice, while GLUT-2 level was increased (Figure 2(b)); the serum biochemical markers FBG, FINS, TC, and TG levels were depleted (Figure 2(c–f)); HOMA-IRI was reduced; whereas the levels of HOMA-β% and HOMA-ISI were amplified (Figure 2(g–i)); the islet morphology was relatively regular with less cell number and vacuolar denaturation (Figure 2(j)); the low apoptosis rate of pancreatic cells was also observed (Figure 2(k)). Taken together, HOTTIP exerted therapeutic effects on GDM mice.
Figure 2.
HOTTIP overexpression improves insulin resistance and hepatic gluconeogenesis in GDM mice. (a), the expression of HOTTIP in liver tissues of mice after the up-regulation of HOTTIP was detected by RT-qPCR; (b), GLUT-2, PEPCK and G-6-Pase levels in liver tissues of mice after the up-regulation of HOTTIP were detected by RT-qPCR; (c-f), mice weight and the levels of serum biochemical indices FBG, FINS, TC and TG were determined after the up-regulation of HOTTIP; g-i, HOMA-IRI, HOMA-β% and HOMA-ISI levels after the up-regulation of HOTTIP were assessed in HOMA; (j), the pathological change of pancreatic cells after the up-regulation of HOTTIP was examined by HE staining; (k), the apoptosis rate of pancreatic cells after the up-regulation of HOTTIP was detected by TUNEL staining. The data in the figure were all measurement data and the expressed as mean value ± standard derivation; n = 6 mice; * P < 0.05 vs. the GDM + oe-NC group.
HOTTIP overexpression improves insulin resistance and hepatic gluconeogenesis in GDM mice. (a), the expression of HOTTIP in liver tissues of mice after the up-regulation of HOTTIP was detected by RT-qPCR; (b), GLUT-2, PEPCK and G-6-Pase levels in liver tissues of mice after the up-regulation of HOTTIP were detected by RT-qPCR; (c-f), mice weight and the levels of serum biochemical indices FBG, FINS, TC and TG were determined after the up-regulation of HOTTIP; g-i, HOMA-IRI, HOMA-β% and HOMA-ISI levels after the up-regulation of HOTTIP were assessed in HOMA; (j), the pathological change of pancreatic cells after the up-regulation of HOTTIP was examined by HE staining; (k), the apoptosis rate of pancreatic cells after the up-regulation of HOTTIP was detected by TUNEL staining. The data in the figure were all measurement data and the expressed as mean value ± standard derivation; n = 6 mice; * P < 0.05 vs. the GDM + oe-NC group.
HOTTIP binds to miR-423-5p
The website DIANA (http://carolina.imis.athena-innovation.gr/diana_tools/web/index.php?r=lncbasev2/index-predicted) predicted binding sites between HOTTIP and miR-423-5p (Figure 3(a)). The dual-luciferase reporter gene assay disclosed that the luciferase activity was repressed after being treated with HOTTIP-WT and miR-423-5p mimic (Figure 3(b)). To validate the interaction between HOTTIP and miR-423-5p, the RIP experiment was performed and it indicated that Ago2 had a function in the formation of HOTTIP and miR-423-5p complex (Figure 3(c)). Finally, after given injection of saline containing dissolved oe-HOTTIP plasmids, miR-423-5p level in GDM mice was evaluated through RT-qPCR, it was unraveled that miR-423-5p expression was depleted after the overexpression of HOTTIP (Figure 3(d)). These discoveries indicated that HOTTIP combined with miR-423-5p.
Figure 3.
HOTTIP binds to miR-423-5p. (a). the binding relationship between HOTTIP and miR-423-5p was predicated through the bioinformatic website DIANA; B, the binding relationship between HOTTIP and miR-423-5p was validated by dual luciferase reporter gene assay; (c), relative HOTTIP level was detected by RIP experiment; (d), miR-423-5p expression in mouse liver tissues after the up-regulation of was HOTTIP was examined by RT-qPCR. The data in the figure were all measurement data and the expressed as mean value ± standard derivation; (b-c): cell experiments were repeated three times; (d): n = 6 mice; * P < 0.05 vs. the mimic NC group; # P < 0.05 vs. the GDM + oe-NC group.
HOTTIP binds to miR-423-5p. (a). the binding relationship between HOTTIP and miR-423-5p was predicated through the bioinformatic website DIANA; B, the binding relationship between HOTTIP and miR-423-5p was validated by dual luciferase reporter gene assay; (c), relative HOTTIP level was detected by RIP experiment; (d), miR-423-5p expression in mouse liver tissues after the up-regulation of was HOTTIP was examined by RT-qPCR. The data in the figure were all measurement data and the expressed as mean value ± standard derivation; (b-c): cell experiments were repeated three times; (d): n = 6 mice; * P < 0.05 vs. the mimic NC group; # P < 0.05 vs. the GDM + oe-NC group.
Down-regulation of miR-423-5p alleviates insulin resistance and hepatic gluconeogenesis in GDM mice
The miR-423-5p level in GDM mice was evaluated by RT-qPCR, with the findings suggested that miR-423-5p level was decreased after injection of saline containing dissolved miR-423-5p antagomiR (Figure 4(a)). After the down-regulation of miR-423-5p, GLUT-2, PEPCK, and G-6-Pase levels were then detected by RT-qPCR in the liver tissues of GDM mice, which showed that G-6-Pase and PEPCK levels were reduced, while GLUT-2 displayed a high level (Figure 4(b)); the levels of FBG, FINS, TC and TG were also depleted (Figure 4(c–f)); HOMA-IRI was reduced but HOMA-β% and HOMA-ISI were amplified (Figure 4(g–i)); the degree histopathologic damage in pancreatic tissues was mitigated (Figure 4(j)) and the apoptosis rate of pancreatic cells was also lowered (Figure 4(k)). Taken together, the silenced miR-423-5p can alleviate insulin resistance and hepatic gluconeogenesis in GDM mice.
Figure 4.
Down-regulation of miR-423-5p alleviates insulin resistance and hepatic gluconeogenesis in GDM mice. (a), miR-423-5p level in liver tissues of mice after the down-regulation of miR-423-5p was detected by RT-qPCR; (b), the levels of GLUT-2, PEPCK and G-6-Pase in liver tissues of mice after the down-regulation of miR-423-5p were detected by RT-qPCR; (c-f), mice weight and serum biochemical indices FBG, FINS, TC and TG levels were examined after the down-regulation of miR-423-5p; (g-i), HOMA-IRI, HOMA-β% and HOMA-ISI levels after the the down-regulation of miR-423-5p were assessed by HOMA; (j), the pathological change of pancreatic cells after the down-regulation of miR-423-5p was examined by HE staining; (k), the apoptosis rate of pancreatic cells after the down-regulation of miR-423-5p was detected by TUNEL staining. The data in the figure were all measurement data and the expressed as mean value ± standard derivation; n = 6 mice; * P < 0.05 vs. the GDM + antagomiR NC group.
Down-regulation of miR-423-5p alleviates insulin resistance and hepatic gluconeogenesis in GDM mice. (a), miR-423-5p level in liver tissues of mice after the down-regulation of miR-423-5p was detected by RT-qPCR; (b), the levels of GLUT-2, PEPCK and G-6-Pase in liver tissues of mice after the down-regulation of miR-423-5p were detected by RT-qPCR; (c-f), mice weight and serum biochemical indices FBG, FINS, TC and TG levels were examined after the down-regulation of miR-423-5p; (g-i), HOMA-IRI, HOMA-β% and HOMA-ISI levels after the the down-regulation of miR-423-5p were assessed by HOMA; (j), the pathological change of pancreatic cells after the down-regulation of miR-423-5p was examined by HE staining; (k), the apoptosis rate of pancreatic cells after the down-regulation of miR-423-5p was detected by TUNEL staining. The data in the figure were all measurement data and the expressed as mean value ± standard derivation; n = 6 mice; * P < 0.05 vs. the GDM + antagomiR NC group.
MiR-423-5p targets WNT7A
The connection sites between miR-423-5p and WNT7A were predicted through the bioinformatic website TargetScanHuman 7.2 (http://www.targetscan.org/vert_72/) (Figure 5(a)). Subsequently, as reflected in dual-luciferase reporter gene assay, the luciferase activity was impaired after co-transfection of WNT7A-WT and miR-423-5p mimic (Figure 5(b)). In the RIP assay, it came out that miR-423-5p and WNT7A could bind to Ago2 protein (Figure 5(c)). Thereafter, the WNT7A expression was measured after treatment of miR-423-5p antagomiR and antagomiR NC by RT-qPCR and Western blot analysis, which uncovered that WNT7A was elevated after the silencing of miR-423-5p (Figure 5(d,e)). These findings evidenced that there miR-423-5p and WNT7A displayed a binding relation.
Figure 5.
MiR-423-5p targets WNT7A. (a), the binding sites between miR-423-5p and WNT7A were predicated through the bioinformatic website TargetScan; b, the targeting relationship between miR-423-5p and WNT7A was detected by the dual luciferase gene reporter gene assay; (c), WNT7A level after transfected with miR-423-5p mimic was detected in RIP experiment; (d/e), WNT7A expression level in mouse liver tissues after the down-regulation of miR-423-5p was detected by RT-qPCR and Western blot analysis. The data in the figure were all measurement data and the expressed as mean value ± standard derivation; (b-c): cell experiments were repeated three times; (d-e): n = 6 mice; * P < 0.05 vs. the mimic NC group; # P < 0.05 vs. the GDM + antagomiR NC group.
MiR-423-5p targets WNT7A. (a), the binding sites between miR-423-5p and WNT7A were predicated through the bioinformatic website TargetScan; b, the targeting relationship between miR-423-5p and WNT7A was detected by the dual luciferase gene reporter gene assay; (c), WNT7A level after transfected with miR-423-5p mimic was detected in RIP experiment; (d/e), WNT7A expression level in mouse liver tissues after the down-regulation of miR-423-5p was detected by RT-qPCR and Western blot analysis. The data in the figure were all measurement data and the expressed as mean value ± standard derivation; (b-c): cell experiments were repeated three times; (d-e): n = 6 mice; * P < 0.05 vs. the mimic NC group; # P < 0.05 vs. the GDM + antagomiR NC group.
Up-regulated HOTTIP attenuates GDM via the modulation of miR-423-5p/WNT7A axis
GDM mice were treated with GDM + oe-HOTTIP + miR-423-5p agomiR, GDM + oe-HOTTIP + agomiR NC, GDM + miR-423-5p antagomiR + sh-WNT7A and GDM + miR-423-5p antagomiR + sh-NC, respectively. RT-qPCR and Western blot analysis suggested that increased miR-423-5p reversed the suppressive effects of upregulated HOTTIP on reducing miR-423-5p expression; whereas silenced WNT7A inverted the effects of reduced miR-423-5p on elevating WNT7A expression (Figure 6(a–c)). Thereafter, the results of serum biochemical indices, HOMA, HE and TUNEL staining revealed that miR-423-5p overexpression could reverse the therapeutic effects of elevated HOTTIP on GDM mice; while WNT7A deletion reversed the effects of downregulated miR-423-5p on improving GDM (Figure 6(d–m)). The discoveries validated that up-regulated HOTTIP attenuated GDM via the miR-423-5p/WNT7Aaxis.
Figure 6.
Up-regulated HOTTIP attenuates GDM via the miR-423-5p/WNT7A axis. (a), miR-423-5p level in liver tissues of mice after give injection of saline with dissolved oe-HOTTIP and miR-423-5p agomiR was detected by RT-qPCR; (b/c), WNT7A expression in liver tissues of mice after given injection of saline with dissolved miR-423-5p antagomiR and sh-WNT7A was examined by RT-qPCR and Western blot analysis; (d), the level of GLUT-2, PEPCK and G-6-Pase in liver tissues of mice after give injection of saline with dissolved oe-HOTTIP + miR-423-5p agomiR or miR-423-5p antagomiR + sh-WNT7A was detected by RT-qPCR; (e-h), mice weight and serum biochemical indices FBG, FINS, TC and TG levels were examined after give injection of saline with dissolved oe-HOTTIP + miR-423-5p agomiR or miR-423-5p antagomiR + sh-WNT7A were examined; i-k, HOMA-IRI, HOMA-β% and HOMA-ISI levels after give injection of saline with dissolved oe-HOTTIP + miR-423-5p agomiR or miR-423-5p antagomiR + sh-WNT7A were assessed by HOMA; (l), the pathological change of pancreatic cells after give injection of saline with dissolved oe-HOTTIP + miR-423-5p agomiR or miR-423-5p antagomiR + sh-WNT7A was examined by HE staining; (m), the apoptosis rate of pancreatic cells after give injection of saline with dissolved oe-HOTTIP + miR-423-5p agomiR or miR-423-5p antagomiR + sh-WNT7A was detected by TUNEL staining. The data in the figure were all measurement data and the expressed as mean value ± standard derivation. n = 6 mice; * P < 0.05 vs. the GDM + oe-HOTTIP + agomiRNC group; # P < 0.05 vs. the GDM + miR-423-5p antagomiR + sh-NC group.
Up-regulated HOTTIP attenuates GDM via the miR-423-5p/WNT7A axis. (a), miR-423-5p level in liver tissues of mice after give injection of saline with dissolved oe-HOTTIP and miR-423-5p agomiR was detected by RT-qPCR; (b/c), WNT7A expression in liver tissues of mice after given injection of saline with dissolved miR-423-5p antagomiR and sh-WNT7A was examined by RT-qPCR and Western blot analysis; (d), the level of GLUT-2, PEPCK and G-6-Pase in liver tissues of mice after give injection of saline with dissolved oe-HOTTIP + miR-423-5p agomiR or miR-423-5p antagomiR + sh-WNT7A was detected by RT-qPCR; (e-h), mice weight and serum biochemical indices FBG, FINS, TC and TG levels were examined after give injection of saline with dissolved oe-HOTTIP + miR-423-5p agomiR or miR-423-5p antagomiR + sh-WNT7A were examined; i-k, HOMA-IRI, HOMA-β% and HOMA-ISI levels after give injection of saline with dissolved oe-HOTTIP + miR-423-5p agomiR or miR-423-5p antagomiR + sh-WNT7A were assessed by HOMA; (l), the pathological change of pancreatic cells after give injection of saline with dissolved oe-HOTTIP + miR-423-5p agomiR or miR-423-5p antagomiR + sh-WNT7A was examined by HE staining; (m), the apoptosis rate of pancreatic cells after give injection of saline with dissolved oe-HOTTIP + miR-423-5p agomiR or miR-423-5p antagomiR + sh-WNT7A was detected by TUNEL staining. The data in the figure were all measurement data and the expressed as mean value ± standard derivation. n = 6 mice; * P < 0.05 vs. the GDM + oe-HOTTIP + agomiRNC group; # P < 0.05 vs. the GDM + miR-423-5p antagomiR + sh-NC group.
Discussion
GDM is termed as the typical intolerance to glucose with its first recognition only during pregnancy [29]. STZ are injected into mice to establish the GDM mouse model according to the previous literature [18]. The experimental principle of using STZ to induce GDM in animal models is that STZ can induce maternal hyperglycemia and it is imported by β-cells via GLUT2 transporter protein, thus inducing β-cell necrosis [30,31]. The high-fat diet may enhance poor glucose tolerance and reduce insulin-mediated glucose transport in muscle and adipose tissues, and promote insulin resistance and obesity during pregnancy [32,33]. This study focused on the regulatory mechanism of HOTTIP on GDM progression. To sum up, it was manifested that highly expressed HOTTIP mitigated insulin resistance and hepatic gluconeogenesis in GDM mice via modulating the miR-423-5p/WNT7A axis.Initially, HOTTIP was disclosed to exhibit a low level in GDM mice. As reflected by restrained biochemical index level, strengthened insulin homeostasis, mitigated pathological changes, and reduced apoptosis rate of pancreatic cells, it was validated that HOTTIP overexpression could relieve the insulin resistance and hepatic gluconeogenesis in GDM mice. The studies for directly investigating HOTTIP function in GDM were extremely insufficient. However, in diabetic nephropathy, Zhu et al. have elucidated that HOTTIP can modulate the high-glucose-induced inflammation [34]. Specifically, the amplification HOTTIP contributes to reducing inflammatory factors in the retina and improving the viability of high-glucose-treated RF/6A cells [35]. As for the expression tendency of HOTTIP, Xu et al. have uncovered that HOTTIP also displayed a low level in islet tissues of diabetic mice [11]. In other pregnancy-specific diseases like preeclampsia, Zhang et al. have validated that HOTTIP is low-expressed in preeclampsia patients. Functionally, up-regulated HOTTIP can restrain the preeclampsia development via promoting the proliferation of trophoblast cells [36]. In addition, HOTTIP overexpression can also diminish oxygen-glucose deprivation-induced apoptosis and the caspase-3 activity of neurons in ischemic cerebral injury [37].Thereafter, it was predicated through the bioinformatic website that HOTTIP had binding sites with miR-423-5p, which was enriched in GDM mice. The research then uncovered that miR-423-5p decrement could hinder insulin resistance and hepatic gluconeogenesis in GDM mice via suppressing biochemical index levels, enhancing insulin homeostasis, relieving pathological changes, and reducing the apoptosis rate of pancreatic cells. Overall, miRNA exerts pivotal effects on maternal hyperglycemia through the interaction with mRNA [38]. Comparatively, our study specifically investigated the mechanism of miR-423-5p on GDM progression. Specifically, miR-423-5p has been evidenced to associate with the onset of type 1 diabetes [39]. The high-expressed miR-423-5p is also validated to exist in human diabetic retinopathy [40]. As reported by Yang et al., miR-423-5p expression is highly in the livers of obese diabetic mice, moreover, miR-423-5p silencing can constrain gluconeogenesis, and attenuate insulin resistance, hyperglycemia and fatty liver in obese diabetic mice [14]. Specifically, enriched miR-423-5p in children with obesity born small for gestational age is implicated in HOMA-IRI [41]. Furthermore, Zhang et al. have discovered that the alleviated insulin resistance after exercise is concurrent with depleted miR-423-5p levels [42]. As for the apoptosis rate, miR-423-5p has been disclosed to exhibit a high level in proliferative diabetic retinopathy, aggravating high glucose-induced apoptosis in retinal pigment epithelial cells [13].Subsequently, the bioinformatic website predicated that there were binding sites between miR-423-5p and WNT7A. Low-expressed WNT7A was detected in GDM mice, and the further down-regulation of WNT7A contributed to deteriorating insulin resistance and hepatic gluconeogenesis in GDM mice. Partly in line with our findings, the diminished WNT7A expression has been validated in streptozotocin-induced diabetic rats [43]. In streptozotocin-induced type 2 diabetic rats, Wang et al. have illustrated that the reduced expression of WNT7A may further exacerbate the increment of autophagy and the inflammatory markers induced by high-glucose environment [44]. Furthermore, depleted WNT7A is also found in streptozotocin-induced diabetic rats that display impaired wound healing [17]. In chronic alcoholic liver disease, the WNT7A deficiency has been uncovered to associate with chronic ethanol exposure, whose malignant impacts can be relieved by insulin sensitizer [45].
Conclusion
In conclusion, this study manifests that HOTTIP and WNT7A levels are reduced while miR-423-5p expression is enriched in GDM mice. The overexpression of HOTTIP can relieve insulin resistance and hepatic gluconeogenesis in GDM mice via the modulation of miR-423-5pWNT7A axis. By stressing the regulatory mechanism of the HOTTIP/miR-423-5p/WNT7A axis in GDM mice, the current study advances the understanding of the therapeutic strategies of GDM, affording novel insights for the treatment modalities of GDM. However, the effect of silencing HOTTIP using in vitro studies awaits further verification. Furthermore, we will investigate whether HOTTIP can influence GDM by regulating high glucose-induced inflammation when future experimental conditions permit.Click here for additional data file.Click here for additional data file.
Authors: Emily M Segar; Andrew W Norris; Jian-Rong Yao; Shanming Hu; Stacia L Koppenhafer; Robert D Roghair; Jeffrey L Segar; Thomas D Scholz Journal: Clin Sci (Lond) Date: 2009-07-02 Impact factor: 6.124