Peiyu Han1, Li Shen1, Nan Nan1, Renwu Zhou2, Tianci Li1, Xiaofeng Dai1,3. 1. Wuxi School of Medicine, Jiangnan University, Wuxi 214122, China. 2. School of Chemical and Biomolecular Engineering, University of Sydney, Sydney, 2008, Australia. 3. CAPsoul Medical Biotechnology Company, Ltd, Beijing, 100000, China.
Vaccination is an effective approach for infectious disease prevention and possibly the only solution for eradicating viral diseases that have low virulence but rapid transmission and with the potential of eventually evolving into symbiosis with human. Cell-based vaccine manufacturing that utilizes cultured mammalian cells as the virus production factory represents a flexible approach for viral vaccine production regarding the yield and spectrum of viral diseases it can control 1. Rapid vaccine production can deliver critical benefits especially under urgent situations such as the outbreak of Coronavirus Disease 2019 (COVID-19) epidemic 2. Enhancing virus titer is a practical strategy to meet the large and increasing demand on cell-based vaccine manufacturing against viral diseases.Cold atmospheric plasma (CAP), belonging to the fourth state of matter, has been shown capable of preventing COVID-19 3, deactivating viruses, removing pathogens such as bacteria and fungi 4, and selectively killing cancer cells via inducing, e.g., cell cycle arrest 5, senescence 6, autophagy 7, apoptosis 8, ferroptosis 9, 10, ICD 11, and necrosis 12 in a dose-dependent fashion 13. It is composed of long-lived and short-lived reactive oxygen and nitrogen species, the chemical properties of which have been intensively studied 14-19. We had previously shown that CAP could hijack host signaling towards enhanced virus production under controlled dosing and following specified protocol 7, 20. It is thus possible that CAP can function as a tool to boost virus multiplication that ultimately leads to rapid vaccine production for viral disease control.Motivated as such, we explored the efficacy of CAP in triggering increased virus titration and the underlying biological mechanism with the focus laid on cell survival including selective autophagy and cell cycle arrest. Using infectious bovine rhinotrachieitis virus (IBRV) and Madin-Darby Bovine Kidney (MDBK) cells as the virus and cell models, respectively, we found that CAP could boost virus propagation through enhancing cell mitophagy that was dynamically modulated by the activity and location of phosphorylated EGFR (Tyr1068). Interestingly, removing H2O2 from CAP-activated medium (PAM) further enhanced virus titer via releasing cells from H2O2-triggered halt at the G0/G1 stage. Similar effect of CAP on boosting virus titer was observed for other viruses such as canine parvovirus (CPV) and canine distemper virus (CDV). Our study makes CAP an effective approach enabling rapid viral vaccine manufacturing and, also a potential dose-dependent tool for modulating cell mitophagy and mitochondria dynamics towards desirable cell outcomes for other research and clinical purposes.
Materials and methods
Home-made CAP ejection device and parameter configuration
The home-made CAP ejection device is composed of a power controller, a helium (He) gas cylinder, a rotor flow meter, and a CAP jet (). The peak-to-peak voltage applied to the electrode, the sinusoidal wave frequency, the He flow rate, and the distance from the CAP jet to the medium surface were set to 0.96-1.24 kV, 10 kHz, 1 L/min, and 13 mm, respectively. Plasma activated medium (PAM) was prepared by exposing 1 mL medium to CAP for 2 or 4 min for each well in a 24-well plate.
Cells and viruses
IBRV (NCBI TaxId: 79889) was purchased from the Type Culture Collection of the Chinese Academy of Sciences, Shanghai, China and propagated using MDBK cells. The MDBK cell line was purchased from Cell Bank of the Chinese Academy of Sciences Cell Bank and cultured in RPMI medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin.
Virus infection and CAP treatment
Cells were grown to 80%-90% confluence prior to incubation with different doses of PAM for 1 h. Cells were infected with viruses for 1 h. The medium was refreshed, and cells were cocultured with viruses for additional 46 h.
Tissue culture infective dose
Tissue culture infective dose (TCID50) was measured as the virus dilution fold when 50% cells were infected. Cells were plated in a 96-well plate. Inoculating cells with a 10-gradient sequentially diluted solutions of viral fluid at a step-size of 10 folds, and monitoring cells for 5 to 7 days until the occurrence of cytopathic effect (CPE) in 50% cells. TCID50 was calculated following previously recommended protocol 21.
qRT-PCR
Basic qRT-PCR protocol: 4 μL cDNA samples, 10 μL 2×UltraSYBR MixTure, 1 μL forward and 1 μL backward primers, 4 μL ddH2O were mixed and centrifuged before running the qRT-PCR program (pre-denature at 95 °C for 10 min; 95 °C for 10 s, 60 °C for 1 min, 72 °C for 20 s, for 40 cycles) in Roche LightCycler 480 RT-PCR. Each sample had 3 replicates.For virus detection, supernatants were collected and boiled following the protocol of UltraSYBR MixTure Kit (Catalog Number: CW0957M, Cwbio Co. Ltd., China) prior to the aforementioned basic q-PCR protocol. For EGFR mRNA quantification, intracellular mRNA was extracted followed by reverse transcription into cDNA prior to the aforementioned basic q-PCR protocol.Primers for IBRV detection and EGFR quantification were listed in
.
Western blot
Cells were grown in 6-well plates, washed twice with PBS, lysed on ice for 20 min using RIPA lysis buffer containing protease inhibitor, and centrifuged at 12,000 g for 20 min before collecting the supernatants. Protein concentration was estimated using BCA analysis kit (Catalog Number: P0012 Beyotime Biotechnology, China). The protein per lane (20 μg) was resolved by SDS-PAGE and transferred to a PVDF membrane. After blocking with 5% skim milk powder in TBS and Tween-20 buffer, the membrane was incubated overnight at 4 °C with a suitable primary antibody followed by incubation with the secondary antibody for 1 h at the room temperature. After TBST cleaning, the membrane was detected by Bio-Rad Gel Doc XR. Details on antibodies used in this study were summarized in .
Immunofluorescence
Cells were fixed with cell fixature and permeabilized with 1% Triton X-100. Cells were blocked in 1% bovine serum albumin (BSA) followed by incubation with the primary antibodies for 8 h. Cells were incubated with the secondary antibody and imaged using laser-scanning confocal microscope Zeiss Axio Imager Z2 (Zeiss, Germany).For mitochondria morphology imaging, cells were incubated with 100 nM MitoTracker (Catalog Number: M7512 Thermo Scientific, USA) for 30 min at 37 °C prior to the performance of the aforementioned protocol.
Mutation of EGFR(Tyr1068) to EGFR(Phe1068)
The pRP[CRISPR]-EGFP/Puro-hCas9-U6>{EGFR[gRNA]} and Single-stranded Oligo Donor (ssODN) (CAGGGATCCTGCATGGGATGGTGCTTTGCTGATTACTTCACCTCTGATTTCTTTCCACTTTCAGAGTTCATTAATCAGTCCGTTCCCAAAAGGCCCGCTGGCTCTGTGCAGAATCCTGTCTATCACAATCAGCCTCT) were purchased from Vector Builder. The ssODN-EGFR was ethanol precipitated and re-suspended (100 μM) in 10 mM Tris-HCl (pH=7.5). Oligos of EGFR(Tyr1068) (not including the signal peptide of 24 Aa at N-terminal) were diluted to 1 μM prior to transfection. When MDBK cells grew to 60% -70% confluence in 6-well plates, 1 μM ssODN, 1 μg pRP[CRISPR]-EGFP/Puro-hCas9-U6 and 6 μL lipofectamine 3000 were added followed by incubation for 8 h.
Cell cycle assay
Cells were grown in 6-well plates, washed using PBS and digested with EDTA-free trypsin. Cells were centrifuged at 1000 rpm for 5 min to retain the pellets. Cell pellets were washed with 500 μL PBS, centrifuged at 1000 rpm/min for 5 min, and the supernatant was removed to retain the pellet. Cell pellets were re-suspended in 70% ethanol and placed in a refrigerator at 4 °C overnight for fixation. Fixed cells were centrifuged at 1000 rpm for 5 min to remove the supernatant, and cell pellets were suspended in 500 μL PBS. 5 μL propidium iodide (Catalog Number: ST511, Beyotime Biotechnology, China) was added and mixed with cells on ice for 30 min. Cell cycle detection was performed using a BD Accuri C6 flow cytometer, and data analysis was performed using Flowjo software.
ROS detection assay
DCFH-DA (Catalog Number: S0033S, Beyotime Biotechnology, China) was diluted with serum-free culture medium at a ratio of 1:1000 to make the final concentration 10 mM/L. Cell culture medium was removed followed by addition of DCFH-DA in an appropriate volume. Cells were incubated in a 37 °C cell incubator for 20 min. Cells were washed 3 times using serum-free cell culture medium to fully remove the rest of DCFH-DA. Cells were collected by trypsin without adding EDTA. Real-time fluorescence intensity detection was performed using Zeiss Axio Imager Z2 (Zeiss, Germany) before and after the signal stimulation using 488 nm excitation wavelength and 525 nm emission wavelength.
Scavenger assay
Mannitol (200 mM, Catalog Number: M8140, Solarbio, China), sodium pyruvate (10 mM, Catalog Number: SP0100, Solarbio, China), uric acid (100 μM, Catalog Number: IU0150, Solarbio, China), tiron (20 mM, Catalog Number: T104954, Aladdin, China), hemoglobin (20 μM, Catalog Number: H8020, Solarbio, China), and monopotassium phosphate (1 mM, Catalog Number: P7392, Solarbio, China) were used to quench hydroxyl radical (OH·), hydrogen peroxide (H2O2), ozone (O3), superoxide anion (O2·-), nitric oxide (NO·), and electron (e-), respectively.After treating cells with CAP for 2 or 4 min followed by incubation for 1 h, the quencher of each CAP component was added, separately. Viruses were added to cells and incubated for 1 h. The medium was refreshed, and cells were cocultured with viruses for additional 46 h prior to subsequent analyses.
Optical emission spectroscopy (OES)
The optical emission spectrum, in the gas phase, of CAP ejected from our home-made He-based device () was detected using a spectrometer (Andor Shamrock SR-500i-A-R, England), where the optical probe was placed at a distance of approximately 10 mm from the center of the ejection device.
Gene expression determination
Gene expression, represented as FPKM (Fragments Per Kilo Per Million reads) 22, was computed using Htseq software (V 0.6.1) following Equation 1.The mapped reads represent how much percent of all reads are mapped to a gene divided by the length of the gene. FPKM normalization normalizes both the sequencing depth and the gene length to make the expression of genes at different lengths and different sequencing depths comparable. In general, FPKM value 0.1 or 1 is considered as the threshold to determine whether a gene is expressed.
RNA-Sequencing correlation analysis
The correlation of gene expression levels between samples is an important index to test the reliability of the experiments. Pearson correlation was conducted among samples in a pair-wise fashion, with R2>0.8 being considered highly correlated.
Principle component analysis
Principle component analysis (PCA) was conducted using R packages 'gmodels', 'ggplot2', 'ggrepel'.
Clustering analysis
A hierarchical clustering analysis was performed based on the FPKM values of all genes in different samples, where 'euclidean' was used as the distance and 'complete linkage' was set as the linkage approach.
Identification of differentially expressed genes
Differentially expressed genes were identified using the 'DESeq2' bioconductor package, where genes differentially expressed over 2 folds between the compared groups were considered as differentially expressed, and those with adjusted p value ≤ 0.05 and FDR ≤ 0.05 were selected.
Gene ontology analysis
Gene ontology (GO) analysis was conducted using GOseq 23 that is based on Wallenius non-central hyper-geometric distribution. Threshold used for enrichment filtering was set as p ≤ 0.05 for over represented genes.
KEGG pathway analysis
KEGG (Kyoto Encyclopedia of Genes and Genomes) 24 analysis was conducted using the 'clusterProfiler' package 25 from R. The analysis was conducted using hypergeometric test where KEGG pathway was considered as the unit following Equation 2.In Equation 2, 'N' is the number of genes annotated in the pathways among all genes, 'n' is the number of differentially expressed genes among 'N', 'M' is the number of genes annotated to the specific pathway among all genes, and 'm' is the number genes annotated to the specific pathway among differentially expressed genes. Threshold for enrichment significance was set as p value ≤ 0.05.
Results
CAP enhances IBRV titration through ROS-triggered selective autophagy
Through activating the cell culture medium (), CAP could substantially enhance the number of cells undergoing CPE after IBRV infection (Figure ) and effectively increase IBRV titer from 10-2.57/mL to 10-3/mL on 2 min CAP exposure and to 10-4.5/mL on 4 min exposure (Figure ). The qRT-PCR also revealed reduced PCR cycles required for IBRV detection on 2 min and 4 min CAP exposure (Figure ).CAP is featured by dose-dependent cellular redox level modulation 8, 13, 26, 27. Substantially enhanced level of ROS was observed on 4-min CAP exposure as compared with 2-min CAP exposure in IBRV-infected MDBK cells (Figure ).Selective autophagy is one important process governing virus replication 20 and constitutes to an important part of cell stress responses including redox stress in mammalian cells 28. P62 is the best characterized selective autophagy substrate in mammals that localizes at the autophagosome formation site 29, and LC3B is responsible for selective degradation of p62 through selective autophagy 30, both of which are typical markers of selective autophagy 31. We observed considerably elevated LC3B and substantially reduced p62 expression on joint CAP exposure and IBRV infection (Figure ). The fluorescence imaging signal of LC3B in cells receiving both CAP exposure and IBRV infection was considerably higher than that in cells treated with CAP or IBRV alone (Figure ). These results collectively suggested the accompany of selective autophagy in CAP-triggered increase on virus titer.
EGFR(Tyr1068) phosphorylation plays a central role in increasing IBRV titer on CAP exposure
Various evidences have supported the roles of EGFR in ROS-induced cellular response 32-37. EGFR level was considerably reduced when cells were exposed to IBRV infection and 4-min CAP treatment followed by 46 h culturing (p<0.001, Figure ). EGFR phosphorylation sites (Tyr1068, Tyr1148, Tyr1086, Tyr845) are highly conserved between human and bovine protein sequences (Figure ), enabling the use of human rather than bovine antibodies in the following experiments here.For all the four phosphorylation sites examined, p-EGFR (Tyr1068) was synergistically enhanced by IBRV infection and CAP exposure (Figure ). With the increase of CAP dose (from 2 min to 4 min) that did not trigger cell death (Figure ), p-EGFR(Tyr1068) started to accumulate in cell nucleus (Figure ). IJoint exposure of cells to CAP and IBRV infection substantially enhanced p-EGFR(Tyr1068) level that was co-localized with mitochondria (Figure ), associating observed selective autophagy to mitophagy.
EGFR(Tyr1068) phosphorylation enhances mitophagy on CAP exposure and IBRV infection through interacting with phosphorylated Drp1(Ser616)
We next examined the role of p-EGFR(Tyr1068) in CAP-triggered mitophagy after IBRV infection. Mitochondria accumulated to the nucleus surrounding area, and the signal was intensified with the increase of CAP treatment duration (Figure ), implicating the occurrence of mitophagy. Mitofusin 1 (Mfn1) and dynamin-related protein 1 (Drp1) coordinate the processes of mitochondrial fusion and fission, which are canonical markers of mitophagy 38, 39. On joint exposure to IBRV infection and CAP treatment, p-EGFR(Tyr1068) and p-Drp1(Ser616) expression were substantially increased, whereas Mfn1 level was reduced (Figure ), suggesting the occurrence of cell mitophagy and involvement of p-EGFR(Tyr1068) in cells' response to both CAP exposure and IBRV infection. LC3B was co-localized with mitochondria and the signal was intensified on joint exposure to CAP and IBRV infection (Figure ), confirming the presence of mitophagy. Co-immunoprecipitation suggested physical interactions of p-EGFR(Tyr1068) with p-Drp1(Ser616) but not with Mfn1 on joint exposure to IBRV infection and CAP treatment (Figure ), indicating that the enhanced cell fission was mediated via the p-EGFR(Tyr1068)/p-Drp1(Ser616) axis.
EGFR(Tyr1068) mutation reduces virus titer and mitophagy on CAP exposure after IBRV infection
To consolidate the role of p-EGFR(Tyr1068) in CAP-triggered increase on virus titer and mitophagy after IBRV infection, we generated an EGFR(Tyr1068) mutant plasmid where tyrosine (Tyr) at the 1068 site was mutated to phenylalanine (Phe) (Figure ). The p-EGFR(Tyr1068) level was successfully reduced in cells transfected with the mutant plasmid (Figure , 4F). Cells transfected with the mutant plasmid produced considerably less CPE after IBRV infection with and without CAP exposure (Figure ). Accordingly, virus titer reduced substantially (Figure ) and the Ct values from the qRT-PCR assay were significantly enhanced in EGFR(Tyr1068) mutant cells (Figure ). Each primary marker used for selective autophagy and mitophagy characterization (i.e., LC3B, p-Drp1(Ser616), Mfn1) exhibited a relapsed pattern in EGFR(Tyr1068) mutant cells as compared with the wild type under the same treatment (Figure ).
The effects of CAP components on virus titer
CAP ejected from our home-made He-based device () was primarily composed of OH, N2, N2+ and O in the gas phase (Figure ), which became H2O2, O3, •O2-, •OH, •NO, e- in the liquid form 40 (Figure ). By removing/quenching H2O2 from PAM, cell amount (Figure ) and virus yield (Figure ) were substantially increased after PAM treatment. We next confirmed the roles of H2O2 in decreasing virus titer using TCID50, i.e., it dropped from 10-5 to 10-5.33 in IBRV-infected cells and from 10-6.625 to <10-10 in CPV-infected cells on CAP exposure (Figure ).The p-EGFR(Tyr1068) mediated virus titer increase was primarily triggered via •NO and e- given the dramatic decrease on p-EGFR(Tyr1068) expression after removing each of these species (Figure ). The effect of H2O2 on virus titer was in-dependent of p-EGFR(Tyr1068) signaling as no visible alteration was observed regarding p-EGFR(Tyr1068) expression when H2O2 was removed (Figure ), suggestive of the involvement of additional mechanisms in virus titer control. Autophagy as assessed via p62 and LC3B expression here was primarily affected by •O2-, •OH, •NO that, once being removed separately, showed opposite profiles on CAP exposure (Figure ). Mitochondria fission through p-Drp1(Ser616) and fusion via Mfn1 were not primarily affected by any of these components as the fluctuations were not dramatic by adding any of these reactive species quenchers (Figure ), suggestive of the combinatorial role of these species in triggering cell mitophagy.
Transcriptome sequencing predicts the role of cell cycle arrest in H2O2-triggered virus titer decrease and consolidates EGFR-mediated virus titer increase on CAP exposure
We next conducted transcriptome sequencing to explore the mechanism of H2O2 in decreasing virus titer and gain a broad view on CAP-triggered cell response. Gene expression did not considerably vary among sample groups (), and those of samples within the same group were highly correlated (). Samples of the same group were clustered together from both PCA and clustering analyses (Figures ). CAP treatment caused rightward movement of samples along the first principal component (PC1) that explained 27.4% of the total variance; and removing H2O2 from CAP leftward shifted samples along PC1 and downward along PC2 that explained 15.8% of the total variance (Figure ). If PC1 reflected the effect of mitophagy, PC2 might represent another cell behavior (namely 'behavior X') that was affected by CAP and, in particular, H2O2. Additionally, removing H2O2 decreased the expression of under-expressed (0-0.1) genes (p=0.0129 for IBRV+CAP-H2O2 vs. IBRV; p=0.0019 for IBRV+CAP-H2O2 vs. IBRV+CAP) and caused relapsed expression of 1-3 level genes (p=0.0046 for IBRV+CAP-H2O2 vs. IBRV+CAP) with statistical significance that was oppositely regulated by CAP (Figure ). These are suggestive of the controversial roles of H2O2 and CAP in modulating virus titer, as well as the association of these altered genes with the 'behavior X'. Specifically, 420, 168, 78 genes were differentially expressed in the pairwise comparisons 'IBRV vs IBRV+CAP', 'IBRV vs IBRV+CAP-H2O2' and 'IBRV+CAP vs IBRV+CAP-H2O2'; and genes simultaneously modulated in all of these three group-wise comparisons showed a consistent regulatory direction in 'IBRV vs IBRV+CAP', 'IBRV vs IBRV+CAP-H2O2' but an opposite direction in 'IBRV+CAP vs IBRV+CAP-H2O2' (Figure ,
). These results suggested that CAP was the primary contributor to the altered transcriptome profile, and H2O2 played an opposite role.Gene ontology (GO) and KEGG pathway analyses revealed that CAP-triggered cell behavior was associated with 'extracellular space' and 'EGFR tyrosine kinase inhibitor resistance', which were the top GO term and pathway, respectively, from both 'IBRV vs IBRV+CAP' and 'IBRV vs IBRV+CAP-H2O2' group-wise comparisons, but not from the 'IBRV+CAP vs IBRV+CAP-H2O2' comparison (Figure ). These results are supportive to the mediating role of p-EGFR(Tyr1068) in CAP-triggered mitophagy (Figure ) since the extracellular region of EGFR has been previously proposed as a potential target for anti-EGFR drug discovery 41. The top GO term and KEGG pathway identified from the 'IBRV+CAP vs IBRV+CAP-H2O2' comparison but not from the other two group-wise comparisons was 'lysosome' (Figure , ), which is known playing essential roles in autophagy 42. Given the differential regulation of autophagy during cell cycle progression 43 and our knowledge on the roles of H2O2 in triggering cellular damage and consequently cell cycle arrest under certain concentrations 44, we hypothesized H2O2-induced cellular 'behavior X' to be 'cell cycle alteration'.
H2O2 decreases virus titer through triggering G0/G1 cell cycle arrest
We firstly explored CAP-imposed H2O2 concentration in the medium (or precisely, quenched H2O2 amount in the scavenger assay) via removing H2O2 first using 10 mM sodium pyruvate followed by H2O2 titration, the lowest Ct value of IBRV infected cells was achieved when 5 mM and 1 mM H2O2 were supplemented, respectively, with and without adding sodium pyruvate (Figure ); thus, H2O2 quenched by 10 mM sodium pyruvate in our experimental setting was approximately 4 mM (5 mM - 1 mM) (Figure ). On the other hand, virus titer decreased when cellular H2O2 exceeded 5 mM (Figure ), suggesting that the intracellular H2O2 raised in response to virus infection was over 1 mM (5 mM - 4 mM). Either virus-triggered H2O2 (over 1 mM) or CAP-imposed H2O2 (approximately 4 mM) led to moderate cell cycle arrest (around 40% G0/G1 phase) that corresponded to slightly increased virus titer. Both sources of H2O2, once added together, dramatically decreased virus yield as a result of substantially increased number of cells arrested at the G0/G1 stage (Figure ). Cellular ROS increased with H2O2 dose, and the intensity dramatically dropped at 10 mM (Figure ), indicative of cell death due to exceeded ROS level. Given these results, together with the known functionality of ROS in triggering cell cycle arrest 45, we assumed that the observed inhibition on virus titer was due to exceeded level of H2O2.The levels of p-EGFR(Tyr1068) and p-Drp1(Ser616) were both slightly up-regulated when H2O2 was low (< 1 mM) and dramatically dropped under high (1-10mM) level of H2O2 (Figure ), which were supportive of the physical interactions of both phosphorylated proteins (Figure ) and the opposite role of high dose (1-10mM) of H2O2 and CAP in triggering p-EGFR(Tyr1068)-mediated cell response. Autophagy markers p62 and LC3B showed a similar pattern with that of p-EGFR and p-Drp1 (Figure ). Cyclin B1 is primarily distributed in the M phase and serves as the master regulator of the G2/M transition 46. CDK1 interacts with 9 different cyclins including cyclin B1 that becomes inactivated at the end of the M phase 47. Both cyclin B1 and CDK1 expression declined with the increased dose of H2O2 (Figure ), suggestive of a suppressive role of high H2O2 dose on the M stage. Cyclin D1 is rapidly synthesized in the G1 phase and degraded as cells enter the S phase 48, and CDK4/6 creates complexes with cyclin D1 to mediate cell progression through the G1 phase 49. Cyclin D1 expression showed a positive correlation with H2O2 dose; CDK4 expression increased with H2O2 concentration and declined when H2O2 exceeded 1 mM (Figure ), implicating that cells were accumulated and arrested at the G0/G1 stage when H2O2 exceeded 1 mM.
Discussion
As integrin represents a common receptor mediating virus entry 50 and is linked to intracellular signaling via EGFR tyrosine activation, we focused on the four integrin-dependent EGFR tyrosine phosphorylation residues, i.e., Tyr1068, Tyr1086, Try845, Tyr1173 51 in this study. We excluded Tyr1173 given its primary role in the MAPK cascade and cell proliferation 52 to narrow our focus down to cell selective autophagy/mitophagy. Among the three EGFR tyrosine phosphorylation sites, EGFR(Tyr1068) showed the highest phosphorylation level in response to joint IBRV infection and CAP treatment (Figure ). The expression profile of p-EGFR(Tyr1068) under varied CAP doses matched well with that of selective autophagy biomarkers (LC3B, p62, Figure ), in particular mitophagy markers (p-Drp1(Ser616), Mfn1, Figure ), and virus titer (Figure ). In addition, p-EGFR(Tyr1068) co-localized with mitochondria (Figure ). These were, collectively, implicative of the regulatory role of p-EGFR(Tyr1068) in mitophagy. We, therefore, considered p-EGFR(Tyr1068) as the key EGFR phosphorylation site that drove the observed efficacy of CAP in boosting virus titer.Selective autophagy degrades certain proteins, organelles to maintain cellular homeostasis and, on virus invasion, can be hijacked to recycle cell nutritional resources for virus propagation 20. Elevated LC3B expression and decreased p62 level on CAP exposure after virus infection (Figure , 1F) attributed the promotive role of CAP on virus multiplication to cell selective autophagy. Mitochondria accumulation at the nucleus surrounding region (Figure ), enhanced Drp1(Ser616) phosphorylation and reduced Mfn1 level (Figure , 3C), providing additional evidence associating CAP-triggered selective autophagy to mitophagy. Mitochondrial fusion, fission, biogenesis and mitophagy constitute mitochondrial dynamics that determines mitochondrial morphology, quality and abundance 53, 54. Activated mitochondrial fusion as represented by elevated Mfn1 38 is protective of mitochondria on pressure. Mitochondrial fission machinery as featured by Drp1 38 actively participates in apoptosis 55 and promotes or inhibits cell death depending on the initial lethal stimulus 56. We observed physical interactions between phosphorylated p-EGFR(Tyr1086) and p-Drp1(Ser616) on IBRV infection and/or CAP exposure (Figure ), suggesting that mitochondria fission was enhanced due to elevated level of Drp1 that was possibly increased by activated EGFR(Tyr1068). Through introducing the EGFR(Tyr1068) point mutation to native EGFR genes using the CRISPR/Cas9 system (Figure ), we consolidated the role of p-EGFR(Tyr1068) in mediating CAP-induced virus titer increase. To this end, we could preliminarily conclude that CAP promoted IBRV titration via, at least partially, the trigger of cell mitophagy, and this process was driven by p-EGFR(Tyr1068)/p-Drp1(Ser616)-mediated mitochondria fission. We also observed elevated expression of the pro-apoptotic protein caspase 7 () that was supportive to the pro-apoptotic role of mitochondria fission.Quenching each component of PAM using chemical scavengers, though being a qualitative approach, has been accepted as a standard measure to examine CAP-liquid interactions and the effect of CAP ingredients on cell behavior, based on the fact that each RONS scavenger has a higher reaction rate (often in an order of magnitude) with its targeted species than with other species 57, 58. Here, we used tiron (20 mM), D-mannitol (200 mM), hemoglobin (20 µM), sodium pyruvate (10 mM), uric acid (100 µM) and monopotassium phosphate (1 mM) to trap ·O2-, ·OH, ·NO, H2O2, O3 and e-, respectively, with the reaction rates being 2.9109 mol/Ls, 1109 mol/Ls, 1108 mol/Ls, 2.4 mol/Ls, 1.4106 mol/Ls 58, 59. Except for H2O2 whose removal led to a substantial increase on virus titer, eliminating each of the other ingredients unanimously decreased virus multiplication to some extent (Figure ), suggestive of their indispensable and collective role in promoting virus multiplication.Exceeded level of H2O2 (1-10 mM) triggered G0/G cell cycle arrest that was associated with recessed cell activities and reduced virus production (Figure ). Thus, cells underwent mitophagy in acute response to CAP-triggered redox stress, leading to the creation of a favorable environment for virus multiplication as a result of shrunken cell biomass usage. However, high H2O2 dose (1-10 mM) may result in cell cycle G0/G1 arrest due to the trigger of moderate level of DNA damage signaling (not reaching the threshold of cell apoptosis) and thus counteract virus production. Therefore, a favorable environment for virus multiplication requires enhanced available cellular biomass materials and normal/accelerated cell cycle. Importantly, these results suggested the irreplaceable role of CAP in boosting virus titer that could not be surrogated by H2O2, an easily produced CAP component, and H2O2 might function as an opposite regulator of CAP that made its effect on virus titer control reversible.CAP is a known cocktail of ROS and non-ROS 40. Both CAP exposure and virus infection enhanced cellular redox level 26, 60 (Figure ), suggesting that the promotive role of CAP in IBRV titer is due to its synergy with virus infection in enhancing cellular ROS level. We observed similar expression profiles between p-EGFR(Tyr1068) and FOXO1 () on CAP exposure, where FOXO1 is a key measure of cells' anti-oxidative ability 61. This implicated the mediating role of p-EGFR(Tyr1068) in enhancing cellular anti-oxidant ability in response to CAP treatment and/or virus infection.We additionally found that blocking EGFR(Tyr1068) phosphorylation reduced caspase 3 expression that was elevated on CAP exposure or its joint CAP and IBRV treatments (). This suggested the essential role of p-EGFR(Tyr1068) in regulating cell apoptosis, and that elevated cellular ROS, on CAP exposure, triggered mitophagy and concomitantly tilted cells towards the pro-apoptotic state. This warranted us to keep appropriate CAP dosing to achieve mild yet effective boost of virus titer as over-dosing might kill the host that ultimately led to reduced virus production. We also observed rescued p65 expression in p-EGFR(Tyr1068) mutant cells on CAP or CAP+IBRV treatments (). This implicated that the cellular system was hijacked by viruses for maximum virus production and other cellular behaviors including cell migration (p65 is a key protein controlling cell migration 62) were reduced, whereas p-EGFR(Tyr1068) was the hub controlling these processes.Though we claimed on the driving role of p-EGFR(Tyr1068) and cell mitophagy in CAP-mediated boost of IBRV propagation, we could not exclude the possible involvement of p-EGFR(Try1086) and p-EGFR(Tyr845) in this process. However, these functionalities were more likely to be associated with cells' natural response to IBRV infection rather than CAP exposure given our results.Though different viruses may attach and/or trigger cellular signaling using different cell surface receptors beyond EGFR that may limit the generality of the uncovered driving mechanism, the facts that virus infection imposes cells with redox pressure and CAP relies on ROS to deliver its efficacy do not vary. In consistent with this, we observed enhanced titer on CAP exposure when CPV and CDV were used (). Therefore, the efficacy of CAP in boosting virus production may be generalizable to a broad spectrum of, if not all, viruses and hosts that deserves intensive experimental explorations and additional consolidations.
Conclusion
We report in this study that CAP can enhance IBRV propagation towards increased yield of vaccines against viral diseases through triggering cell selective autophagy and, in particular, mitophagy; this process is driven by the p-EGFR (Tyr1068)/p-Drp1(Ser616) signaling through physical interactions in response to CAP-induced cellular ROS level in a dose-dependent manner (). High level of H2O2 (1-10 mM) may decrease virus titer due to enhanced G0/G1 cell cycle arrest. Thus, controlling H2O2 below 1 mM through the use of H2O2 quencher (such as sodium pyruvate) together with CAP may represent a good strategy towards maximal virus production (). Our results contribute in advancing our understandings on CAP-triggered cellular responses that make CAP a potential modulator on cell survival such as mitophagy and cell cycle arrest. Importantly, this study provides a novel strategy for boosting IBRV multiplication that can be potentially generalized to a broad spectrum of viruses towards enhanced cell-based viral vaccine production in the industry. The generality has been preliminarily examined using CDV and CPV, which needs to be validated using more virus and cell models.Supplementary figures and tables.Click here for additional data file.
Authors: Arnica Karuna; Francesco Masia; Sally Chappell; Rachel Errington; Andrew M Hartley; Darran Dafydd Jones; Paola Borri; Wolfgang Langbein Journal: Cytometry A Date: 2020-07-01 Impact factor: 4.355
Authors: Lisa-Marie Sturla; George Amorino; Michael S Alexander; Ross B Mikkelsen; Kristoffer Valerie; Rupert K Schmidt-Ullrichr Journal: J Biol Chem Date: 2005-02-11 Impact factor: 5.157